ID: 1084591552

View in Genome Browser
Species Human (GRCh38)
Location 11:70093516-70093538
Sequence ACTCTTGGCTGTGTGTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 472
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 434}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084591547_1084591552 11 Left 1084591547 11:70093482-70093504 CCATGGGGTCATTGCGGAGAACG 0: 1
1: 0
2: 1
3: 0
4: 42
Right 1084591552 11:70093516-70093538 ACTCTTGGCTGTGTGTGCTGGGG 0: 1
1: 0
2: 2
3: 35
4: 434

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084591552 Original CRISPR ACTCTTGGCTGTGTGTGCTG GGG Intronic
900913504 1:5618647-5618669 GTTGTTGGCTGTGTCTGCTGGGG - Intergenic
900985438 1:6070446-6070468 ACTCGTGTCTGTGGCTGCTGGGG - Intronic
901153691 1:7121760-7121782 AGACTTGGCTGTTGGTGCTGAGG + Intronic
902613502 1:17610668-17610690 GCTATGTGCTGTGTGTGCTGTGG + Intronic
902728966 1:18356280-18356302 TCTCTGGGGTGTGTGTGGTGGGG - Intronic
902819898 1:18937486-18937508 ACTCTTGTTTGTGTGTTGTGGGG - Intronic
903065722 1:20698200-20698222 ACTCTTTGCTGTGTGACCTTGGG + Intronic
903152879 1:21425154-21425176 ACTGTTTGCTGTGTGTCCTGAGG - Intergenic
903153042 1:21426698-21426720 ACTGTATGCTGTGTGTCCTGAGG - Intergenic
903160252 1:21482827-21482849 ACTGTTTGCTGTGTGTCCTGAGG + Intronic
903453635 1:23471636-23471658 CCTCTTAGCTGTGTGACCTGAGG + Intronic
904498522 1:30901089-30901111 GCTCCTGGCTGTGTGTGCTTTGG + Intronic
905956040 1:41996950-41996972 ACTCTTGTCTGTGTCTTATGAGG + Intronic
906033276 1:42736406-42736428 AGTCTTGGCTGGGAGTTCTGTGG - Intronic
906153825 1:43602645-43602667 ACTCTTCTCTCTGTGTGGTGTGG + Intronic
906250572 1:44307834-44307856 AATCCTGGCTGTGTGTCCTCTGG + Intronic
906397056 1:45475493-45475515 TCTCTTGGCCGGGTGTGGTGGGG - Intronic
906543142 1:46603567-46603589 CCTCTTAGCTGTGTGTCCTGGGG - Intronic
907122692 1:52021464-52021486 ACTGAGGGGTGTGTGTGCTGGGG + Intronic
908176513 1:61560733-61560755 ACTCTTTGTTGTGAGGGCTGTGG - Intergenic
909678739 1:78267610-78267632 TCTCTTGCCAGTGTGTGCAGAGG + Intergenic
910176724 1:84438674-84438696 TCTCTTGGCGGTGGGTGGTGGGG + Intergenic
912168636 1:107070194-107070216 GGTCTTGCCTGTGTCTGCTGTGG + Intergenic
912722148 1:112029109-112029131 ACCATTTGCTGTGTGTTCTGTGG - Intergenic
913605541 1:120462485-120462507 ACTGTTCGCTGTGTGTCCCGAGG + Intergenic
913642406 1:120825205-120825227 ACTGTTCGCTGTGTGTCCCGAGG + Intronic
913642586 1:120826745-120826767 ACTGTTCGCTGTGTGTCCCGAGG + Intronic
913642957 1:120830103-120830125 ACTGTTCGCTGTGTGTCCCGAGG + Intronic
913643726 1:120836856-120836878 ACTGTTCGCTGTGTGTCCCGAGG + Intronic
913989473 1:143597273-143597295 ACTGTATGCTGTGTGTTCTGAGG - Intergenic
913989623 1:143598797-143598819 ACTGTATGCTGTGTGTCCTGAGG - Intergenic
914082818 1:144425195-144425217 ACTGTATGCTGTGTGTCCTGAGG - Intronic
914177923 1:145295257-145295279 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914178468 1:145300019-145300041 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914179013 1:145304761-145304783 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914179391 1:145307944-145307966 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914179766 1:145311127-145311149 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914180310 1:145315897-145315919 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914180854 1:145320659-145320681 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914181397 1:145325409-145325431 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914181942 1:145330176-145330198 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914182487 1:145334932-145334954 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914183032 1:145339686-145339708 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914183577 1:145344440-145344462 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914184120 1:145349210-145349232 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914184664 1:145353974-145353996 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914185209 1:145358721-145358743 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914185754 1:145363475-145363497 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914186300 1:145368235-145368257 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914186845 1:145372983-145373005 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914187389 1:145377733-145377755 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914187933 1:145382489-145382511 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914188476 1:145387237-145387259 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914189019 1:145391993-145392015 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914210688 1:145576138-145576160 ACTGTATGCTGTGTGTCCTGAGG - Intergenic
914210874 1:145577702-145577724 ACTGTTCGCTGTGTGTCCCGAGG - Intergenic
914269446 1:146066864-146066886 ACTGTTTGCTGTGTGTCATGAGG - Intronic
914269635 1:146068462-146068484 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914270173 1:146073190-146073212 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914270710 1:146077926-146077948 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914271248 1:146082656-146082678 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914271782 1:146087383-146087405 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914272319 1:146092101-146092123 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914272857 1:146096823-146096845 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914273395 1:146101545-146101567 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914273934 1:146106263-146106285 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914274471 1:146110971-146110993 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914275005 1:146115689-146115711 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914275542 1:146120415-146120437 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914276077 1:146125155-146125177 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914366942 1:146987585-146987607 ACTGTATGCTGTGTGTCCTGAGG + Intronic
914367286 1:146990805-146990827 ACTGTTCGCTGTGTGTCCCGAGG + Intronic
914367478 1:146992346-146992368 ACTGTATGCTGTGTGTCCTGAGG + Intronic
914380759 1:147113895-147113917 ACTGTTTGCTGTGTGTCCTCAGG - Intergenic
914485506 1:148105859-148105881 ACTGTATGCTGTGTGTCCTGAGG - Intronic
914485697 1:148107401-148107423 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914532469 1:148535143-148535165 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914533010 1:148539869-148539891 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914533545 1:148544583-148544605 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914534080 1:148549291-148549313 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914534615 1:148553999-148554021 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914535150 1:148558711-148558733 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914535686 1:148563456-148563478 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914536221 1:148568172-148568194 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914537117 1:148576100-148576122 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914586029 1:149062552-149062574 ACTGTTCGCTGTGTGTCCCGAGG - Intronic
914628806 1:149489244-149489266 ACTGTTCGCTGTGTGTCCCGAGG + Intergenic
914628992 1:149490794-149490816 ACTGTATGCTGTGTGTCCTGAGG + Intergenic
914629340 1:149493999-149494021 ACTGTTCGCTGTGTGTCCCGAGG + Intergenic
914629525 1:149495551-149495573 ACTGTATGCTGTGTGTCCTGAGG + Intergenic
914629874 1:149498756-149498778 ACTGTTCGCTGTGTGTCCCGAGG + Intergenic
914630060 1:149500306-149500328 ACTGTATGCTGTGTGTCCTGAGG + Intergenic
914630408 1:149503517-149503539 ACTGTTCGCTGTGTGTCCCGAGG + Intergenic
914630594 1:149505067-149505089 ACTGTATGCTGTGTGTCCTGAGG + Intergenic
914630942 1:149508278-149508300 ACTGTTCGCTGTGTGTCCCGAGG + Intergenic
914631127 1:149509828-149509850 ACTGTATGCTGTGTGTCCTGAGG + Intergenic
914631473 1:149513039-149513061 ACTGTTCGCTGTGTGTCCCGAGG + Intergenic
914631659 1:149514589-149514611 ACTGTATGCTGTGTGTCCTGAGG + Intergenic
914632007 1:149517795-149517817 ACTGTTCGCTGTGTGTCCCGAGG + Intergenic
914632195 1:149519343-149519365 ACTGTATGCTGTGTGTCCTGAGG + Intergenic
914632544 1:149522550-149522572 ACTGTTCGCTGTGTGTCCCGAGG + Intergenic
914632732 1:149524098-149524120 ACTGTATGCTGTGTGTCCTGAGG + Intergenic
914633079 1:149527301-149527323 ACTGTTCGCTGTGTGTCCCGAGG + Intergenic
914633266 1:149528847-149528869 ACTGTATGCTGTGTGTCCTGAGG + Intergenic
914633614 1:149532030-149532052 ACTGTTCGCTGTGTGTCCCGAGG + Intergenic
914633802 1:149533578-149533600 ACTGTATGCTGTGTGTCCTGAGG + Intergenic
914634150 1:149536785-149536807 ACTGTTCGCTGTGTGTCCCGAGG + Intergenic
914634338 1:149538333-149538355 ACTGTATGCTGTGTGTCCTGAGG + Intergenic
914634683 1:149541532-149541554 ACTGTTCGCTGTGTGTCCCGAGG + Intergenic
914634872 1:149543086-149543108 ACTGTATGCTGTGTGTCCTGAGG + Intergenic
914635218 1:149546269-149546291 ACTGTTCGCTGTGTGTCCCGAGG + Intergenic
914635407 1:149547823-149547845 ACTGTATGCTGTGTGTCCTGAGG + Intergenic
914635753 1:149551006-149551028 ACTGTTCGCTGTGTGTCCCGAGG + Intergenic
914635942 1:149552560-149552582 ACTGTATGCTGTGTGTCCTGAGG + Intergenic
916849473 1:168688818-168688840 TATCTTTGCTGTGTGTGCTCTGG - Intergenic
918313518 1:183303832-183303854 ACTGTTAGCTGAGTGGGCTGAGG + Intronic
918409950 1:184248181-184248203 ACTGTTGGCTGTGTCTGCCATGG - Intergenic
921297863 1:213721721-213721743 TCTCTTGGGTGGGTGTGCAGTGG - Intergenic
921542246 1:216430449-216430471 ACTATTAGCTGTGTGTTCTTGGG + Intergenic
921567510 1:216737695-216737717 ACTGTTGGCTGTGTGACCTTGGG + Intronic
922328754 1:224555200-224555222 ACACTTAGCTGTGTGTCCTGGGG - Intronic
923419804 1:233801380-233801402 GCTCTTGTGTGTGTGTGTTGGGG - Intergenic
1062827831 10:585372-585394 ACTCAGGGCTGTGTGTGTTTGGG - Intronic
1063130118 10:3171037-3171059 ATTTTTGTCTGTGAGTGCTGGGG - Intronic
1063668705 10:8082473-8082495 AATCTTGGCTGTATTTGCTGAGG + Intergenic
1063700168 10:8376661-8376683 ACTGTCTGCTGTATGTGCTGGGG - Intergenic
1065617319 10:27541764-27541786 TTTCTTGTTTGTGTGTGCTGTGG + Exonic
1065861270 10:29874023-29874045 ACACTTGGCTGTGTGGGTTGAGG + Intergenic
1066146592 10:32564822-32564844 ACACTTGGCTGGGTGTGTGGTGG + Intronic
1066541382 10:36450393-36450415 ACACTGGACTGTGTGTGTTGGGG - Intergenic
1067581511 10:47449527-47449549 ACCTCTGCCTGTGTGTGCTGGGG + Intergenic
1067926086 10:50509186-50509208 ACTCTTGGCTGTGATTCGTGGGG - Intronic
1068307272 10:55227950-55227972 ACCCTTGACTGTTTGTCCTGGGG + Intronic
1069032409 10:63611277-63611299 ACTCTTTACTGTAAGTGCTGTGG + Intronic
1069823769 10:71242922-71242944 ACTCTTGAATGGGTGGGCTGAGG - Intronic
1069845396 10:71367503-71367525 TCTCTTGCCTATGTGGGCTGGGG - Intergenic
1070937447 10:80312043-80312065 ATTCTTGTGTGTGTGTGTTGGGG - Intergenic
1071819437 10:89264914-89264936 CCCCTGGGCTGTTTGTGCTGAGG + Intronic
1071868110 10:89760731-89760753 ACAATTAGCTGTGTGTGCTCTGG + Intronic
1072249592 10:93571192-93571214 ATTCCAGCCTGTGTGTGCTGTGG + Intronic
1072721899 10:97786335-97786357 GCACTGGGCTGTGTGTGTTGCGG + Intergenic
1073180327 10:101579431-101579453 ACCCATGGCTGGGGGTGCTGAGG - Exonic
1073229808 10:101959508-101959530 TCTCTGTGCTGTGTGTCCTGGGG - Intronic
1073756747 10:106588918-106588940 ATTCTTCACTGTGTGTGGTGAGG + Intronic
1074489031 10:113922262-113922284 ACCCTTGGGTGTTTTTGCTGTGG + Intergenic
1074776375 10:116770941-116770963 GCTGCGGGCTGTGTGTGCTGGGG + Intergenic
1074776392 10:116770996-116771018 GCTGTGGGCTGTGTGTGCTGGGG + Intergenic
1075336214 10:121610487-121610509 TCTCTTTGCTGTGTGACCTGGGG + Intergenic
1076005352 10:126944365-126944387 ACACATGGCTCTGCGTGCTGAGG - Intronic
1076392244 10:130111499-130111521 ACTGTCGGGAGTGTGTGCTGTGG + Intergenic
1077228557 11:1448769-1448791 CCCCTTGGCTGTGTCTGGTGAGG + Intronic
1077309267 11:1881279-1881301 GCTCTGGGCTGTGTCTCCTGTGG - Intronic
1077462873 11:2719522-2719544 ACTCTGGGATTTGTGTGCAGGGG - Intronic
1078118623 11:8482142-8482164 AGTCTGGGATTTGTGTGCTGTGG - Intronic
1080173485 11:29334360-29334382 TCTGAAGGCTGTGTGTGCTGAGG + Intergenic
1081675288 11:44965043-44965065 ACTCTTGGCTAAGTGGACTGAGG - Intergenic
1081876275 11:46410440-46410462 ACTCCTGGCTTTGTGGACTGTGG + Intronic
1083489467 11:63004959-63004981 TGTCTAGGCTGTATGTGCTGAGG + Intronic
1083621936 11:64053563-64053585 ACTCTGGCCCTTGTGTGCTGTGG - Intronic
1083776013 11:64894663-64894685 ACACTTGGCTGAGTGGGATGGGG + Exonic
1084492042 11:69484188-69484210 TTTCTTGGCTGAGTGTTCTGAGG - Intergenic
1084591552 11:70093516-70093538 ACTCTTGGCTGTGTGTGCTGGGG + Intronic
1084732168 11:71080664-71080686 ACTCTTTGTTGTGTGGGCTGTGG - Intronic
1085581051 11:77650937-77650959 GCTCATGCCTGTGTGAGCTGGGG + Intergenic
1086253240 11:84842889-84842911 AATTTTTGCTGTGTGTGTTGGGG - Intronic
1086338544 11:85824318-85824340 ACTGTTGGGTGTGTGTGAGGAGG + Intergenic
1087241251 11:95783788-95783810 ACTCTTGTGTATGTGTGCAGTGG - Intronic
1087952115 11:104235058-104235080 ACTCTTTGCTGTGTTTTCAGTGG + Intergenic
1088832189 11:113546933-113546955 GCTCATGGCTATGTATGCTGGGG - Intergenic
1089047150 11:115511967-115511989 CCTCTTGTCTGTGTCAGCTGTGG + Intergenic
1089590993 11:119540604-119540626 AGCCATGGCTGTGTGGGCTGGGG - Intergenic
1090243906 11:125202331-125202353 CCTGATGGCTGTGTGTCCTGGGG + Intronic
1090420781 11:126573470-126573492 CCTCCTTGCTGTGTGGGCTGGGG - Intronic
1093030499 12:14284342-14284364 CCTCCTGGTTGTGTGGGCTGTGG - Intergenic
1095239132 12:39836248-39836270 ACTGTGGGATGTGAGTGCTGGGG + Intronic
1095826502 12:46535549-46535571 ACCCTTGGCTGTATGATCTGGGG - Intergenic
1096145814 12:49277807-49277829 ACCCTTGGGTGTGGGGGCTGTGG + Intergenic
1096478111 12:51921028-51921050 ATTTTTGGCTGGGTGGGCTGGGG - Exonic
1096511718 12:52133677-52133699 ACTCTTGGCTGAGGGTGGTGGGG - Intergenic
1096616463 12:52835897-52835919 ACACTGAGCTGTGTGTCCTGGGG + Intergenic
1096813007 12:54183585-54183607 ATGCTTGGCTGGGTGTGCTGTGG - Intronic
1097733926 12:63160410-63160432 ACTACTGGCTGTGTGTTCTCGGG - Intergenic
1098296263 12:69007154-69007176 ACTTTCTCCTGTGTGTGCTGAGG + Intergenic
1099886312 12:88535522-88535544 AACCCTGGCTTTGTGTGCTGGGG + Intronic
1101938260 12:109077807-109077829 ACTCTTGTGTGTTTGTGTTGGGG + Intronic
1103740303 12:123086662-123086684 CCTCTTGGCTGTATGTCCTGGGG - Intronic
1103961601 12:124612333-124612355 AGTGTGGGCTGTGTGTGCTCAGG - Intergenic
1104100001 12:125598787-125598809 ACTCCTGGTTATGAGTGCTGAGG + Intronic
1104548487 12:129733520-129733542 AATCTTGGCAGAGTGTGATGGGG - Intronic
1104657231 12:130582391-130582413 CCTCTGGGCTGTGTGTTCTTAGG - Intronic
1104859110 12:131915563-131915585 CCTCCTGGCTGTGTGGGCTGGGG + Intronic
1105305330 13:19164824-19164846 GCTCTTGGGTGTGTGGACTGTGG - Intergenic
1105306475 13:19172563-19172585 GCCCTTGGCAGTGTGTGCAGGGG - Intergenic
1105491971 13:20897588-20897610 ACACTATGCTGTGTATGCTGAGG - Intronic
1105563444 13:21518506-21518528 ATTCTTGGATGTGTGTACAGTGG + Intronic
1107321119 13:39189650-39189672 AATTTTGGCTATATGTGCTGAGG + Intergenic
1109210339 13:59527767-59527789 ACTCTTGGCTGTGTGTGGTATGG - Intergenic
1110773801 13:79382536-79382558 ACTCTTCTGTGTGTGTGTTGGGG + Intronic
1110983925 13:81939431-81939453 GCGCTTGGCTGGGTATGCTGGGG + Intergenic
1113332745 13:109346277-109346299 ACTCCTGGCTGTCAGTCCTGTGG + Intergenic
1113489751 13:110682023-110682045 ACTCTCGGCACTGTGTGCTCTGG - Intronic
1113773578 13:112929062-112929084 CCTCCTGGCTGTGTCTTCTGGGG + Intronic
1113773863 13:112931099-112931121 AGTCCTGGCTGTGTCTTCTGGGG + Intronic
1113784714 13:112996437-112996459 ACCCTGGGCTATGTGTGCAGCGG + Intronic
1113839450 13:113350522-113350544 GCTGTGGGGTGTGTGTGCTGTGG - Intronic
1113839453 13:113350538-113350560 GCTGTGGGGTGTGTGTGCTGTGG - Intronic
1113839458 13:113350570-113350592 GCTGTGGGGTGTGTGTGCTGTGG - Intronic
1113994532 14:16055331-16055353 GCTCTTAGCTGAGTGTCCTGCGG + Intergenic
1114458667 14:22873164-22873186 ACTCTAGGCTGTGTGTGGGCAGG + Intronic
1114636090 14:24187672-24187694 TCTCTGGGCTGTGGGGGCTGTGG + Exonic
1115402039 14:32972650-32972672 AATCTTTGCTTTGTCTGCTGTGG + Intronic
1116537139 14:46046621-46046643 ACTGTTAGCTGACTGTGCTGTGG - Intergenic
1116805832 14:49493310-49493332 ACTTGTGTCTGTGTGTGTTGGGG - Intergenic
1119711542 14:76826203-76826225 AGGCTTGGCTGTGAGTGCTCAGG - Intronic
1121719501 14:96099353-96099375 ACTCAGGGCTGTGGCTGCTGTGG - Intergenic
1122007808 14:98719750-98719772 ACACTCGGCTGTGTGAGCTTGGG - Intergenic
1122150726 14:99724782-99724804 ACCCCTGGCTCTCTGTGCTGGGG - Intronic
1122264826 14:100541684-100541706 ACTCCTGGCTGTGGCTGGTGGGG - Intronic
1122375214 14:101252721-101252743 GCACCTGGCTGTGTGTGCTCAGG + Intergenic
1122522162 14:102352442-102352464 ACTGTGGTCTGTGTTTGCTGTGG - Intronic
1122625969 14:103085475-103085497 CCCCTGGGCTGTGGGTGCTGAGG + Intergenic
1123911377 15:24971056-24971078 ACTATTTGCTATGTGTGCTTTGG + Intronic
1127650226 15:60999651-60999673 ACATCTGTCTGTGTGTGCTGGGG + Intronic
1128313330 15:66645126-66645148 ACTCTGTGCTGTGTGAGCTTGGG + Intronic
1129752449 15:78075894-78075916 ACTCCTGGCCTTGTGAGCTGAGG - Intronic
1130286506 15:82559611-82559633 ACTCCTTGCTGGATGTGCTGTGG - Intronic
1130399496 15:83536287-83536309 AGTCTTGGCTGAGTGTGCCCAGG - Intronic
1132251109 15:100335987-100336009 GATCTTGGATGTGTGTGATGGGG - Intronic
1133207320 16:4241349-4241371 GGGCTTGGCTCTGTGTGCTGAGG - Intronic
1133427182 16:5702788-5702810 GATCTTTGCTGTGTGTGTTGTGG + Intergenic
1134046786 16:11107033-11107055 ACTCTTGGTGGTGTGGGCAGAGG + Intronic
1134860561 16:17556655-17556677 AGTCCTGGCTGTGTGTGCATTGG - Intergenic
1137879704 16:52033360-52033382 ACTCATGGCTGTGTGACCTTAGG + Intronic
1138136342 16:54526436-54526458 GCTCTTGGCTGTGTCCTCTGAGG + Intergenic
1138370883 16:56525384-56525406 ACTCTGTGATGTGTCTGCTGTGG + Intergenic
1139006149 16:62573744-62573766 TATCTTGGTTGTGTATGCTGTGG - Intergenic
1139944251 16:70628130-70628152 ACTCTAGGGTGTGTGTGTAGTGG + Intronic
1140469129 16:75204934-75204956 ACTCTTGGCTGAGTGAGCCCAGG - Intronic
1140472655 16:75224005-75224027 ACTCTTGGCTGAGTGAGCCCAGG + Intronic
1140836232 16:78796761-78796783 ACTCATTGCTGTGTGAGCTCTGG + Intronic
1141492400 16:84382986-84383008 ACTCTTGCCTGTCTCTTCTGAGG - Intronic
1142618366 17:1149844-1149866 AGTTTTAGCTGTGTGTCCTGGGG + Intronic
1142900285 17:3007471-3007493 ACTCCTGGCTGTAAGTGTTGTGG + Intronic
1143378606 17:6481546-6481568 AGTCCTGGCTGTGTGGTCTGGGG - Intronic
1144162839 17:12578456-12578478 ACACTTGGCCCTGTGTGGTGTGG + Intergenic
1144735654 17:17553944-17553966 ACCCCTGGCTGGGTGTGCTCTGG - Intronic
1145746026 17:27320419-27320441 TCTCTTAGCTGTGTGACCTGAGG - Intergenic
1147430338 17:40366920-40366942 ACTCCTGCTTGTGTGTGTTGGGG + Intergenic
1148022381 17:44561986-44562008 GATCTTGGCTCTGTGTGCTTTGG + Intergenic
1148515089 17:48209548-48209570 ACTCTTTGCTCTGTGTTCTAAGG + Intronic
1148570780 17:48667184-48667206 AATTTTGGGTGTGTGTGGTGGGG + Intergenic
1148894669 17:50832863-50832885 ACTCTTCCCTGTGGGTGGTGTGG - Intergenic
1149485642 17:57040705-57040727 ATACTTGGCTGGCTGTGCTGTGG - Intergenic
1149605226 17:57919857-57919879 ACTGGGGGCTGTTTGTGCTGAGG - Intronic
1150469105 17:65421130-65421152 GCTCTTGGGTGGGTGTGCAGTGG - Intergenic
1150503899 17:65678849-65678871 TCACTGGGCTGAGTGTGCTGCGG - Intronic
1150562924 17:66310692-66310714 CCTCTTGGCTGTGTGAGCTGAGG + Intronic
1151423358 17:74013441-74013463 AACCTTGGCTGTGTGTGTAGGGG + Intergenic
1151463914 17:74272467-74272489 ACTCTTAGGGGTGGGTGCTGAGG - Intergenic
1151663939 17:75534791-75534813 ACTCTTGACTGTTTGAGCTTGGG + Intronic
1152202194 17:78953701-78953723 CCTCTTGGCTGTGTGATCTTAGG - Intergenic
1152279420 17:79376494-79376516 ACACTTGGCTGTGTGTGTTTTGG - Intronic
1152587851 17:81197053-81197075 ACGCTCGGCTGTGTCTGCAGGGG - Exonic
1152649385 17:81484786-81484808 ACTCTGGGTTGGGGGTGCTGGGG + Intergenic
1153434959 18:5059196-5059218 CCTCTGAGCTGTGTGTGGTGAGG - Intergenic
1155166574 18:23237069-23237091 TCTCCTGGCTGTCTCTGCTGGGG + Intronic
1155691219 18:28625860-28625882 ATTCTTTGCTGTGACTGCTGTGG + Intergenic
1157273712 18:46295218-46295240 ACTCTCTGCTGTGTTTGCCGCGG + Intergenic
1157733699 18:50027534-50027556 ACTCTTGGTTGTGTGTGAGGTGG - Intronic
1157820775 18:50767077-50767099 ACTCTGGGAAGTGTGTGCTTTGG - Intergenic
1158547898 18:58411420-58411442 ACACTTGGCTGTCCGTGCAGAGG + Intergenic
1159900571 18:74041034-74041056 ACTGTGGTCTCTGTGTGCTGTGG - Intergenic
1159900583 18:74041146-74041168 ACTGTGGTCTCTGTGTGCTGTGG - Intergenic
1159900602 18:74041306-74041328 GCTCTGGTCTCTGTGTGCTGTGG - Intergenic
1160310642 18:77786848-77786870 ACTTCTGGCTGTGTGTGCATTGG - Intergenic
1160557628 18:79736336-79736358 ACTCTTGGCTGTTTGTCAGGTGG + Exonic
1161532748 19:4800040-4800062 CCTCTTGGCTGTGTGGCCTTAGG - Exonic
1161966856 19:7553942-7553964 AATCCTGCCTGTGTGTGCTGAGG + Exonic
1162453572 19:10769034-10769056 GCTCCTGCCTGTGTGTGCTGGGG + Intronic
1162888371 19:13713511-13713533 ACTTTGGGCTGTTTGGGCTGTGG + Intergenic
1164128678 19:22341941-22341963 ACTGTTGGCTGAGTGTGCATAGG - Intergenic
1164170792 19:22723395-22723417 ACTGTTGGCTGAGTGTGCATAGG + Intergenic
1164181262 19:22820866-22820888 ACTGTTGGCTGAGTGTGCATAGG - Intergenic
1164777678 19:30865683-30865705 ACTCGTGGCTGAGCATGCTGCGG + Intergenic
1164981578 19:32618575-32618597 TCTCTTGGCTGTCTCTGCTATGG + Intronic
1165074297 19:33272411-33272433 CCTCAGGGCTGTGTGTGATGGGG + Intergenic
1165159243 19:33806142-33806164 CCTGTTGCATGTGTGTGCTGTGG + Intronic
1166126005 19:40715759-40715781 AATCTTGGCTGAGTGTGTTCTGG - Intronic
1202676099 1_KI270711v1_random:8282-8304 ACTGTATGCTGTGTGTCCTGAGG - Intergenic
925916952 2:8613809-8613831 CCACTTGGCTGTGTGAGCTTGGG + Intergenic
926060655 2:9802750-9802772 GCTCTTGGCTGTGTCTGGAGGGG + Intergenic
926339251 2:11891173-11891195 ACTCTTAGCTGTGTGAGCTTGGG + Intergenic
928364882 2:30692739-30692761 ACTTTGGGCTTTGTGGGCTGAGG - Intergenic
929030860 2:37648928-37648950 CTTCCTGGCCGTGTGTGCTGAGG - Intronic
929493939 2:42423083-42423105 ACTGTTGGCTCTGTGCACTGGGG - Intronic
929605117 2:43228401-43228423 GCTCTTGGCTGTGAGTCCTAGGG - Intergenic
931986791 2:67749898-67749920 AGTCTCTGCTGTGTGTGATGTGG - Intergenic
932303790 2:70687187-70687209 ACTCTGGGCTGTGTGCCCTTGGG - Intronic
934692885 2:96375310-96375332 GCTGTGGGCTATGTGTGCTGTGG + Intergenic
934793346 2:97081604-97081626 CCTCTGCCCTGTGTGTGCTGTGG + Intergenic
935204258 2:100883908-100883930 ACACTTCTCTGTGTGGGCTGGGG - Intronic
936010586 2:108922760-108922782 ACTCTTAGATGTGTGGTCTGGGG - Intronic
937148829 2:119672001-119672023 AAGCTTGGCTGTCTTTGCTGAGG + Intergenic
937242473 2:120471152-120471174 CCTGTTGGCTCTGTGTGATGTGG + Intergenic
938386100 2:130868437-130868459 ACTCTTGGCTGGGTGTGGGAGGG + Intronic
938536939 2:132255419-132255441 GCTCTTAGCTGAGTGTCCTGTGG - Intronic
939978002 2:148742463-148742485 ATTCTTGGCTGGGTGTGTGGTGG + Intronic
941794324 2:169583421-169583443 ACACTTCGCTGTGTGTGGAGGGG - Intergenic
943513411 2:188854801-188854823 ACTCTTGGCAGTTGGTGTTGGGG + Intergenic
944674026 2:202020227-202020249 GCTGCTGGCTGTTTGTGCTGGGG - Intergenic
945416522 2:209579600-209579622 GCTCGTGTCTGTGTGTGCCGGGG - Exonic
946059148 2:216926967-216926989 ACACTAGGCTGGGTGTGCTGTGG - Intergenic
946334538 2:219028407-219028429 ACATTTGTCTGTGTGTGGTGGGG + Intronic
946416160 2:219540779-219540801 CCTCTTGGCTGTCTATGCTGGGG - Intronic
946567297 2:220980746-220980768 TGTCATGGCTGTGTGTGCTAAGG - Intergenic
947874219 2:233457812-233457834 ACACTGGGCTGTGTGAGCTGGGG + Intronic
948973073 2:241444318-241444340 AACCTTGGATTTGTGTGCTGGGG + Intronic
1168965525 20:1895696-1895718 ACCCTTGGCTGTGTGACCTTGGG - Intronic
1170033872 20:11969944-11969966 AGTCTGGGCTGTGTCTGCTCTGG + Intergenic
1171433351 20:25101099-25101121 AGTTTTGGCTCTCTGTGCTGAGG - Intergenic
1173841406 20:46159573-46159595 ACTATTTGCTGTGTGTCCTTGGG - Intergenic
1174422484 20:50408694-50408716 CCTCTTGGCTGTGTGACCTGGGG - Intergenic
1174674917 20:52344550-52344572 ACTTTTTACTGAGTGTGCTGTGG + Intergenic
1176148971 20:63579218-63579240 GCACATGGCTGTGTGTGCAGAGG - Intergenic
1176358817 21:5975378-5975400 TTGCTTGGCTGAGTGTGCTGCGG + Intergenic
1177228953 21:18294208-18294230 ACGCTTGGCAGTGTCTGCTGTGG + Intronic
1179349707 21:40596511-40596533 ACTTTTGGTTCTTTGTGCTGTGG - Intronic
1179474675 21:41635582-41635604 ACTATTGGCTGTGGGGGCTGGGG - Intergenic
1179764701 21:43563172-43563194 TTGCTTGGCTGAGTGTGCTGCGG - Intronic
1179886505 21:44316378-44316400 CCTCTAGGCCGTGTGGGCTGGGG + Intronic
1180229862 21:46420751-46420773 ACTCTGGGATGTGACTGCTGCGG - Intronic
1180312559 22:11252073-11252095 GCTCTTAGCTGAGTGTCCTGCGG - Intergenic
1180868824 22:19134687-19134709 GCCCTTGGCTGTGGGGGCTGGGG + Intronic
1180918310 22:19505069-19505091 CATCTTGGCTGTATGGGCTGTGG + Intronic
1181968349 22:26672129-26672151 ACTCCTGTGTGTGTCTGCTGAGG + Intergenic
1182035540 22:27195522-27195544 GCTCCTGTCTGTGTGTCCTGGGG + Intergenic
1182282526 22:29225657-29225679 ACTCCTGGCTGTGGGGCCTGGGG - Intronic
1182712127 22:32329721-32329743 ACTCTGGTGTGTGTGTGTTGGGG + Intergenic
1182712189 22:32330033-32330055 GCTCTGGTCTGTGTGTGTTGGGG + Intergenic
1183501134 22:38180109-38180131 TCTATTGGGTGTGTGTGCTGGGG - Intronic
1184399394 22:44265008-44265030 ACTCTGGTGTGTGTGTGTTGGGG - Intronic
1184455496 22:44607557-44607579 CCTCTTGGCCGTGTGTGTTCGGG - Intergenic
1185181489 22:49366025-49366047 CCTCTTCACTGTGTGTGCCGAGG - Intergenic
949521263 3:4856297-4856319 AGTCCTGGGTGTGTGGGCTGTGG - Intronic
950184313 3:10935699-10935721 ACTGTTGGCTGTGTGACCTCAGG - Intronic
950642307 3:14356278-14356300 AACCCTGGCTGTGAGTGCTGGGG + Intergenic
950765424 3:15269685-15269707 AGTCATGGCCGGGTGTGCTGTGG - Intronic
954106204 3:48411003-48411025 ACTATTGGCTGTGGGGCCTGGGG - Exonic
954579616 3:51696220-51696242 ACTGCTGGCTGTCTGGGCTGTGG + Intronic
955743602 3:62118824-62118846 AGTCTTGGCTGTGTGACCTGAGG - Intronic
956407721 3:68945994-68946016 CTTCTTGGCAGTGTATGCTGAGG + Intergenic
957487486 3:80881612-80881634 CCTCATGGCTTTTTGTGCTGTGG + Intergenic
957556563 3:81769416-81769438 ACTGTGGGCTGTCTGGGCTGTGG + Intergenic
960146700 3:114211495-114211517 ATTCCTGGCTCTGTGTGCAGTGG - Intergenic
960524206 3:118691217-118691239 TCTCTGGGCTGTCTGTGCTTAGG - Intergenic
960989736 3:123302661-123302683 AGTCCTGGCTGTGTGATCTGGGG + Intronic
961080116 3:124019519-124019541 ACAGTTGGCTGTGTGTGTGGAGG - Intergenic
961171986 3:124803606-124803628 TCTCTTAGCTGGGTGAGCTGGGG + Intronic
961190150 3:124953549-124953571 AAAGTTGGCTGTGTCTGCTGAGG + Intronic
961376264 3:126468219-126468241 CCTCGGGGCTATGTGTGCTGGGG - Intronic
962543508 3:136408181-136408203 ACACTTGGATGTGTGTACAGAGG - Intronic
962805391 3:138923432-138923454 TCTCTTGTCTGTGGGTGCTAGGG + Intergenic
963318374 3:143785393-143785415 ACTGTTGGCTGATTGTTCTGGGG - Intronic
964778445 3:160307610-160307632 AGTTTTGTCTGTCTGTGCTGAGG - Intronic
967906371 3:194504278-194504300 ATTCTTTGCTGTGGGGGCTGGGG + Intergenic
968605739 4:1534486-1534508 ACTCTGGTCGGTGTGGGCTGAGG - Intergenic
969167115 4:5325377-5325399 TCTTTTTGCTCTGTGTGCTGGGG + Intronic
969656843 4:8503583-8503605 ACTCTTTGCTGTGTTCTCTGAGG - Intergenic
970554641 4:17219016-17219038 AATCTAGGCTGTGTGTTCTCAGG + Intergenic
975676744 4:76834753-76834775 ACTATTACCTGTGTGTGCAGAGG - Intergenic
978381884 4:108137542-108137564 ATTAGAGGCTGTGTGTGCTGGGG + Intronic
978473060 4:109092509-109092531 AGTGATGGCTGTGTGTGATGTGG - Intronic
983177982 4:164614315-164614337 AGTCTTGGCTGGGGGAGCTGGGG - Intergenic
983294418 4:165847959-165847981 AGTCTTGGCTGTGTATGATGTGG + Intergenic
983727783 4:170951201-170951223 ACTCTTGGTGGTGGGTGTTGGGG - Intergenic
983941851 4:173542219-173542241 ATTCTTGGCTGTGTAAGTTGAGG - Intergenic
984339493 4:178437589-178437611 ACTCCTGTCTGTGACTGCTGGGG + Intergenic
985173602 4:187177581-187177603 ACTCTAATCTGTGTGTGGTGGGG - Intergenic
987380629 5:17282513-17282535 ATTCTTAGATGTCTGTGCTGAGG - Intergenic
992642768 5:78782846-78782868 GCTCTTGGCTGTGTGCTCTAAGG - Intronic
994774261 5:104024627-104024649 ACCCATGGCTGTGGGTGTTGGGG - Intergenic
994981722 5:106883568-106883590 ACTCTTAGATTTGTGTGTTGAGG - Intergenic
997887201 5:137640660-137640682 ACTCTTAGCTGTGTGACCTTGGG - Intronic
998517457 5:142769529-142769551 ACTATGTGCTGTGTGTGCTACGG - Intergenic
999232624 5:150070443-150070465 ACCCTTCGATGTGAGTGCTGGGG - Exonic
1000015344 5:157271025-157271047 ACTCTAGACTGTGAGTGCTAAGG + Intronic
1000510261 5:162172493-162172515 ATTCTTGTGTGTGTGTGTTGTGG + Intergenic
1001294361 5:170488784-170488806 TGTCTTGAGTGTGTGTGCTGGGG + Intronic
1001937463 5:175715508-175715530 ATCCTTGGCGGTGTGTGCTCTGG - Intergenic
1002323355 5:178388804-178388826 ACTCAGGGCTTTGTGTTCTGAGG - Intronic
1002704096 5:181148722-181148744 CCTCCTGGCTTTGTGTGCTGTGG + Intergenic
1005394514 6:25367521-25367543 ACACTCAGCTGTGTGTGATGTGG + Intronic
1005458669 6:26046290-26046312 ACTTTTGGCAGTGTGTACTGAGG - Intergenic
1007768960 6:44178238-44178260 ACCCTTGGATGTGTGAGCTTGGG - Intronic
1010190555 6:73191586-73191608 ACACTGGGCTAAGTGTGCTGGGG - Intronic
1011127317 6:84021083-84021105 ACTCATGGGTGTCTGTGCTCTGG - Intergenic
1011700856 6:89953148-89953170 AATTTTGGCTCTGTATGCTGCGG - Intronic
1014479852 6:121922354-121922376 ACTTATGGATGTGTGTGGTGGGG + Intergenic
1015307337 6:131724404-131724426 CTTCCTGGCTGTGTGAGCTGGGG + Intronic
1017914718 6:158822648-158822670 AGTCTTCTGTGTGTGTGCTGGGG - Intergenic
1017945912 6:159096217-159096239 TATCTTTGCTGTGTGTGCTATGG - Intergenic
1018227589 6:161644143-161644165 ACTCTTGGCTGTGAGCAATGAGG + Intronic
1018571009 6:165209974-165209996 CCTATTGGCTGTGTGTGATCTGG + Intergenic
1019355293 7:575499-575521 ATTCTTGGCTGTCTTTCCTGTGG - Intronic
1019399572 7:844546-844568 ACTTGTGGTTGTGTCTGCTGTGG + Intronic
1019510412 7:1414847-1414869 ATCCTTGGGTGTGGGTGCTGGGG + Intergenic
1019685812 7:2381476-2381498 GCCCTTGGCTGTGAGTTCTGAGG - Intergenic
1021754903 7:23842616-23842638 AATGTTGGCTGTGTTAGCTGTGG + Intergenic
1022895681 7:34748497-34748519 ACTCTGGGCTGTGTGACCTTGGG + Intronic
1023830100 7:44034273-44034295 ACCAGTGGCTGTCTGTGCTGCGG - Intergenic
1024333543 7:48180264-48180286 ACCCATGCCAGTGTGTGCTGTGG - Intronic
1025211662 7:57022644-57022666 GCTCTTGGCTGTGTGTGGCGTGG + Intergenic
1025660294 7:63554183-63554205 GCTCTTGGCTGTGTGTGGCATGG - Intergenic
1027607479 7:80318246-80318268 AACCTGGGCTGTGTGTGGTGGGG + Intergenic
1029674879 7:102061644-102061666 GCCCTTGGCTGTGTGTGGCGTGG + Intronic
1032001525 7:128268388-128268410 ACTCCAGGCTGGGTGAGCTGGGG + Intergenic
1033126524 7:138711840-138711862 GCTCATGGGTGTCTGTGCTGCGG - Intronic
1033845868 7:145431212-145431234 ACTCCTTGGTCTGTGTGCTGTGG + Intergenic
1034044337 7:147912270-147912292 ACCCTTATCTGTGTGTGCTTGGG - Intronic
1034357979 7:150468402-150468424 ACTCCTGGCTGAGTGTGAGGGGG + Intronic
1034496788 7:151427876-151427898 GCTCTTGGCTGTGGCTGCTGGGG - Intergenic
1034604354 7:152297208-152297230 ACTCTTATCGTTGTGTGCTGGGG - Intronic
1036771391 8:11580665-11580687 ACTCTAGAATGTGTGTGCAGAGG - Intergenic
1037583739 8:20262166-20262188 ACACTTGGCTGGGTGGGCTTGGG - Intronic
1038561866 8:28587852-28587874 TCTCTTGGGTGTGACTGCTGGGG + Intergenic
1039216993 8:35283258-35283280 ACTCTTGTATTTGTATGCTGGGG - Intronic
1041925790 8:63234834-63234856 GATCTGGGCTGTGTGTGCTATGG - Intergenic
1044662505 8:94605414-94605436 TCTCTTGGCTGTGGGAACTGAGG + Intergenic
1047135855 8:122077674-122077696 ACTCTAGGAAGTGTTTGCTGAGG + Intergenic
1048138395 8:131768990-131769012 ACTGTTGTCTGTTTGTGCTGAGG - Intergenic
1048481731 8:134802305-134802327 ATTATTTGCTGTGTGTGCTCAGG - Intergenic
1048956743 8:139543695-139543717 AATCTTGGCTGTGTGGGTGGTGG - Intergenic
1049167235 8:141133935-141133957 ACTTTGGGCTGTGAGTGCTGAGG + Intronic
1049254131 8:141604945-141604967 GCCCTTGGCTGTGTGTTCCGTGG + Intergenic
1049529598 8:143147789-143147811 TGGCTTGGCTGTGGGTGCTGGGG - Intergenic
1051789227 9:20781400-20781422 TCTCTTAGCTCTGTTTGCTGAGG + Intronic
1053384651 9:37677260-37677282 ATTCTTGGTTGCTTGTGCTGTGG + Intronic
1053623545 9:39844972-39844994 ACCATTGTGTGTGTGTGCTGAGG + Intergenic
1053881324 9:42598256-42598278 ACCATTGTGTGTGTGTGCTGAGG - Intergenic
1053891341 9:42696057-42696079 ACCATTGTGTGTGTGTGCTGAGG + Intergenic
1054220355 9:62405727-62405749 ACCATTGTGTGTGTGTGCTGAGG - Intergenic
1054230360 9:62503445-62503467 ACCATTGTGTGTGTGTGCTGAGG + Intergenic
1054750285 9:68898304-68898326 CCCATTGGCTGTGTGTGGTGGGG + Intronic
1055438245 9:76313923-76313945 ACACTTGGCTGAGTTTGCTGGGG - Intronic
1057619318 9:96620475-96620497 ACTCATTGCTGTGTATACTGAGG + Intergenic
1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG + Exonic
1057748610 9:97772118-97772140 ACTTTTGGCTGTGTGACCTTGGG - Intergenic
1058884341 9:109312036-109312058 ATTCTCTGCTGTGTGTGATGTGG - Intronic
1059452109 9:114376991-114377013 ACTCTGGGCTGGGGGAGCTGAGG + Exonic
1059856686 9:118406370-118406392 ACTCTTGGGGGTGTGTACTTGGG - Intergenic
1060214267 9:121729199-121729221 GCTCTTGGCTGTGTGAGCCCAGG - Intronic
1060425864 9:123504931-123504953 AGTCTTTTCTGTATGTGCTGTGG - Intronic
1060803317 9:126558118-126558140 GCTTCTGGCTGTGTGTGTTGCGG - Intergenic
1060829556 9:126705206-126705228 ATTCTGGGCTTTCTGTGCTGTGG - Intergenic
1060934562 9:127507710-127507732 ACTCTTCGCTGTGTGGCCTCCGG - Intronic
1061920327 9:133778988-133779010 GCGCAAGGCTGTGTGTGCTGGGG - Intronic
1185467239 X:362240-362262 ACTCTTGAGTGAGTGTTCTGGGG - Intronic
1186431594 X:9509889-9509911 ACTGTTGGCTGTGTGTGTGGAGG + Intronic
1186660547 X:11664607-11664629 ACTCTCGGCTGGGAGTGATGGGG + Exonic
1189231036 X:39452631-39452653 CCTCCTGGCTGTGGGAGCTGAGG + Intergenic
1192436730 X:71147865-71147887 AGTGTTGACTGTGGGTGCTGGGG - Exonic
1193027601 X:76861382-76861404 CCCCTTAGCTTTGTGTGCTGGGG - Intergenic
1199742140 X:150745556-150745578 ACTGATGGCAGTGTGTGTTGGGG + Intronic
1200168909 X:154057904-154057926 AACCTTGGCTGTGTTTGCAGTGG - Intronic
1200184205 X:154171053-154171075 ACTCTCCTCTCTGTGTGCTGAGG - Intergenic
1200189858 X:154208181-154208203 ACTCTCCTCTCTGTGTGCTGAGG - Intergenic
1200195611 X:154245990-154246012 ACTCTCCTCTCTGTGTGCTGAGG - Intergenic
1200201264 X:154283111-154283133 ACTCTCCTCTCTGTGTGCTGAGG - Intronic
1200708717 Y:6464980-6465002 ACTCTTGCCTGTCTTTTCTGTGG - Intergenic
1200709848 Y:6473614-6473636 ACTCTTGCCTGTCTTTTCTGTGG - Intergenic
1201024264 Y:9691094-9691116 ACTCTTGCCTGTCTTTTCTGTGG + Intergenic
1201025395 Y:9699729-9699751 ACTCTTGCCTGTCTTTTCTGTGG + Intergenic