ID: 1084593973

View in Genome Browser
Species Human (GRCh38)
Location 11:70106270-70106292
Sequence CCCTGCCCTATTCAAGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 252}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084593967_1084593973 7 Left 1084593967 11:70106240-70106262 CCAACTGAGGTTTGAAATCTGAC 0: 1
1: 0
2: 2
3: 12
4: 139
Right 1084593973 11:70106270-70106292 CCCTGCCCTATTCAAGGCACTGG 0: 1
1: 0
2: 0
3: 21
4: 252
1084593963_1084593973 27 Left 1084593963 11:70106220-70106242 CCAGGCCTTTGCCAGAGGAGCCA 0: 1
1: 0
2: 2
3: 25
4: 228
Right 1084593973 11:70106270-70106292 CCCTGCCCTATTCAAGGCACTGG 0: 1
1: 0
2: 0
3: 21
4: 252
1084593964_1084593973 22 Left 1084593964 11:70106225-70106247 CCTTTGCCAGAGGAGCCAACTGA 0: 1
1: 0
2: 1
3: 40
4: 276
Right 1084593973 11:70106270-70106292 CCCTGCCCTATTCAAGGCACTGG 0: 1
1: 0
2: 0
3: 21
4: 252
1084593966_1084593973 16 Left 1084593966 11:70106231-70106253 CCAGAGGAGCCAACTGAGGTTTG 0: 1
1: 0
2: 1
3: 23
4: 163
Right 1084593973 11:70106270-70106292 CCCTGCCCTATTCAAGGCACTGG 0: 1
1: 0
2: 0
3: 21
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084593973 Original CRISPR CCCTGCCCTATTCAAGGCAC TGG Intronic
900118520 1:1038806-1038828 CCCTGCCTTGTCCAAGGCCCTGG - Intronic
900498420 1:2987498-2987520 CCCTGGCATATTCAAGGGCCTGG - Intergenic
900979308 1:6037307-6037329 ACATGCCCTGTTAAAGGCACAGG + Intronic
901879131 1:12184102-12184124 GCCTCCCCAATCCAAGGCACAGG + Intronic
901882746 1:12203617-12203639 CCCTGATCTCTTCCAGGCACTGG - Intronic
901911549 1:12462860-12462882 CCATGCCCTCATGAAGGCACTGG + Intronic
903300646 1:22376269-22376291 CCCTGCCCACTTCAGGCCACTGG + Intergenic
903646118 1:24897403-24897425 CCCTCCCCTACCCACGGCACTGG + Intergenic
903832095 1:26181642-26181664 CCAAGCCCTGTTCTAGGCACTGG - Intronic
907748546 1:57239436-57239458 CCAGGCCCCATTCTAGGCACAGG - Intronic
907761719 1:57367970-57367992 CCCTGCCCTCTTGGAGGCCCAGG + Intronic
908117164 1:60951548-60951570 CCTTACCCTATTCAAGTTACTGG + Intronic
908266689 1:62386117-62386139 CCCTGCCCTACTCTAGGGATTGG - Intergenic
909219999 1:72945673-72945695 CCCTGCCCTATGCAATGTAGAGG + Intergenic
909284288 1:73795373-73795395 CCCTGCCCTTCTCAAGGCAAAGG - Intergenic
912434924 1:109655020-109655042 TCCTACCATATTCCAGGCACTGG - Intergenic
914785943 1:150830966-150830988 ACCTGCCATATGCCAGGCACTGG + Intronic
915591955 1:156875782-156875804 CCCAGCCCTATTCCAGCCATAGG + Intronic
916043634 1:160982097-160982119 CCGTGGCATCTTCAAGGCACGGG - Intergenic
916820573 1:168394272-168394294 GCATTCCCTATGCAAGGCACAGG + Intergenic
917447372 1:175118048-175118070 CCCTGCCCACTACTAGGCACTGG + Intronic
917516305 1:175711374-175711396 GCCTGCCACATTCAAGGAACAGG + Intronic
917834921 1:178933891-178933913 CCCTGCCCTCTGCTAGGCTCTGG + Intergenic
918394240 1:184097589-184097611 CCAGGCCCTCTTAAAGGCACGGG + Intergenic
919654147 1:200180986-200181008 GCCTGCTCTATGCCAGGCACTGG - Intergenic
919754880 1:201060594-201060616 TCCTGCCCTACCCAAGGCCCAGG + Intronic
921401519 1:214728319-214728341 CCCAACACTATTCTAGGCACTGG - Intergenic
922121583 1:222674527-222674549 CCCTGCTGTATTCAAGTCAAAGG + Intronic
923499056 1:234549740-234549762 CCCTGCAGTGTTAAAGGCACAGG - Intergenic
924589086 1:245386404-245386426 CCCGGCCCCCATCAAGGCACCGG - Intronic
1062967805 10:1623679-1623701 CCCTGCCTTATTGAAGACATTGG + Intronic
1070076667 10:73143086-73143108 CCAGGCCCTATTCCAGGTACTGG - Intronic
1070538623 10:77399800-77399822 CCTGGCACTGTTCAAGGCACTGG - Intronic
1070889153 10:79929310-79929332 CCCAGCCCTTTTCAAGGCAGTGG - Intergenic
1071073934 10:81729138-81729160 CCCTTCCCTAGTCAAGGCAGAGG - Intergenic
1071467517 10:85955172-85955194 CCCTGCACCATCCAAGGGACAGG - Intronic
1072421401 10:95292658-95292680 CCAGGCACTATTCTAGGCACTGG - Intergenic
1072709761 10:97708427-97708449 GCCTGCACTATTCAGGGAACAGG - Intergenic
1075739640 10:124686687-124686709 CCCTGCTCTGTGCTAGGCACTGG - Intronic
1077615373 11:3670180-3670202 CCCTCCCCTTTTCAAGGACCTGG + Intronic
1079709592 11:23665375-23665397 CCCAGCCCCATTCATTGCACAGG + Intergenic
1080602489 11:33833540-33833562 CCAGGCACTATTCTAGGCACTGG - Intergenic
1080694827 11:34594257-34594279 CCAGACACTATTCAAGGCACTGG - Intergenic
1081547146 11:44079515-44079537 CCCTGCCTCACTCCAGGCACAGG + Exonic
1081814891 11:45933432-45933454 CCCTTCCCTCTTCTGGGCACTGG + Intronic
1081869777 11:46378057-46378079 CCAAGCACTATTCCAGGCACTGG - Intronic
1082105458 11:48216605-48216627 GCCTACCCTATGCAAGACACTGG - Intergenic
1083915971 11:65744072-65744094 CCCTGCGCTCTTCAGGGCCCAGG + Intergenic
1084593973 11:70106270-70106292 CCCTGCCCTATTCAAGGCACTGG + Intronic
1084916028 11:72429695-72429717 CTCTGCCCTATACCTGGCACTGG + Intronic
1085086565 11:73671795-73671817 CACTGCCCTAGTAAAGGCTCCGG + Intergenic
1085130117 11:74031061-74031083 ACCTGCTCTCTACAAGGCACTGG + Intronic
1085131890 11:74047147-74047169 CCCTGCCCTGCTCAAGGGACAGG - Intronic
1085417823 11:76330895-76330917 CCCAGCCCTGTCCCAGGCACTGG - Intergenic
1089095588 11:115917666-115917688 CCCTGCCCTGTTGCAGGCACTGG - Intergenic
1089784921 11:120901026-120901048 CCCTGCCCTAATCCAGGATCGGG + Intronic
1090867008 11:130709929-130709951 CCCTGACCTTCCCAAGGCACAGG - Intronic
1092050367 12:5465287-5465309 AGCTGCCCTATTCTAGGCAACGG - Intronic
1094500881 12:31019981-31020003 CCCTGGCTTGTTGAAGGCACGGG - Intergenic
1094632028 12:32185103-32185125 CTCTGCCATCTTCAAGCCACTGG + Intronic
1096870894 12:54591451-54591473 CCCTCCCCTATTTTCGGCACTGG + Intergenic
1096875420 12:54626411-54626433 CCAGGCACTATTCTAGGCACTGG + Intergenic
1097081770 12:56436890-56436912 CCAAGCTCTATTCTAGGCACTGG - Intronic
1099854513 12:88146502-88146524 TCCAGCCCTAATCAAGCCACTGG + Intronic
1100260774 12:92929840-92929862 CCCTGCCCTTTTCCAGTCCCAGG + Intergenic
1100284452 12:93152074-93152096 CCCAGCACTTTTCAAGGCAGAGG + Intergenic
1101056921 12:100927018-100927040 CCATGCTCTGTTCAAGGCACTGG - Intronic
1101445722 12:104735695-104735717 CCCTGTCCCATGCAGGGCACTGG - Intronic
1102566181 12:113798882-113798904 CCAAGCCCTGTTCTAGGCACTGG - Intergenic
1103133844 12:118490834-118490856 ACATGCCCTCTGCAAGGCACTGG - Intergenic
1104020387 12:124988487-124988509 CCAGGCACTATTCTAGGCACTGG - Intronic
1104600809 12:130152159-130152181 CCCTTCCCTGTTCAGGGCACTGG - Intergenic
1106457507 13:29940018-29940040 CTGTGTCCTAGTCAAGGCACTGG - Intergenic
1108639056 13:52365118-52365140 GCATCTCCTATTCAAGGCACTGG + Intergenic
1108650886 13:52478443-52478465 GCATCTCCTATTCAAGGCACTGG - Intergenic
1110147145 13:72205454-72205476 CCCGGCCTTACTCAAGGCAGTGG - Intergenic
1110757754 13:79195932-79195954 GCCTACCATATTCTAGGCACTGG + Intergenic
1110877230 13:80524915-80524937 CCAGGCACTATTCTAGGCACTGG - Intergenic
1118200218 14:63664164-63664186 TCCTGCCCTGTTCATGGCAGTGG - Intergenic
1118321271 14:64754681-64754703 CCCTGCCCAAGTCAAGGGAGGGG + Intronic
1119211636 14:72836395-72836417 CCCTGGCCTACTCCAGCCACTGG + Intronic
1120207387 14:81601068-81601090 CCCTGCCCTAATCACTGCAGGGG + Intergenic
1121304609 14:92898229-92898251 CCCTGACATGTTCCAGGCACTGG + Intergenic
1121765853 14:96484851-96484873 CCAGGCACTATTCTAGGCACTGG - Intronic
1123030364 14:105448626-105448648 CCCTGCCCTGTTCTATGGACCGG + Intronic
1123442530 15:20302241-20302263 CCCTGCCCTTATCCAGGCCCTGG + Intergenic
1124836695 15:33202449-33202471 CCAGGCCCTTTTCAAGGCACTGG + Intergenic
1125608935 15:40958009-40958031 CCATGCACCATTCCAGGCACGGG + Intergenic
1127107546 15:55632866-55632888 CCAGGCTCTATTCTAGGCACTGG - Intronic
1128092473 15:64928286-64928308 TCCTACCCTGTGCAAGGCACTGG + Intronic
1128368543 15:67022464-67022486 CCAGGCACTATTCTAGGCACTGG + Intergenic
1130380913 15:83371790-83371812 ACCTGCCCTGTTCAGGGCACAGG - Intergenic
1130533031 15:84762136-84762158 CCAGGCACTATTCTAGGCACTGG + Intronic
1134058474 16:11184565-11184587 GCCTCCCCTATTAATGGCACAGG - Intergenic
1134237348 16:12477568-12477590 CCCTGCTCTATGCCAGGAACTGG + Intronic
1137406651 16:48194314-48194336 CACTGCCCTGTGCCAGGCACTGG - Intronic
1137729061 16:50676800-50676822 CCTGGCCCTATGCAGGGCACTGG - Intronic
1138340732 16:56287367-56287389 CCCTGCCCTCTGCCAGGCAGTGG + Intronic
1139612596 16:68069739-68069761 TCCTGCCCTCTCCAAGGGACTGG - Intronic
1140192037 16:72826066-72826088 CCCTACCCCATGCGAGGCACTGG - Intronic
1141076616 16:81011439-81011461 CCAGGCCCTTTTCTAGGCACTGG - Intronic
1142126476 16:88413106-88413128 CTCTGCCTTATCCAAGGCACGGG + Intergenic
1148393237 17:47288726-47288748 CCCTAATCTATGCAAGGCACTGG + Intronic
1149551135 17:57540743-57540765 CCATGCCCTCTTGAAGGCTCAGG - Intronic
1150146856 17:62776400-62776422 TCCTGCCTTTTTCAACGCACAGG - Intronic
1150225550 17:63522975-63522997 ACCTGCCCTATTCCAGGGCCAGG + Intergenic
1153525509 18:5991315-5991337 CCCTACTGTATGCAAGGCACTGG - Intronic
1153531850 18:6054742-6054764 CCCAGCATTATTCTAGGCACAGG - Intronic
1157589075 18:48825264-48825286 CCCTGCCCTTTCCAAGGGAAGGG + Intronic
1157590034 18:48830912-48830934 CCAGGCACTATTCTAGGCACAGG - Intronic
1159672306 18:71236814-71236836 CCTTTCCCTAGTCAATGCACTGG + Intergenic
1160185007 18:76669131-76669153 CTCTGCCCTCTTCTGGGCACTGG - Intergenic
1160932478 19:1577232-1577254 ACCTGCCCTCGCCAAGGCACTGG + Exonic
1162772034 19:12954874-12954896 CCAGGCCCAATTCTAGGCACAGG + Intronic
1163262555 19:16199890-16199912 CCCTGCCCTATGCCGGGCATAGG + Intronic
1164527147 19:29020863-29020885 CCAGGCCCTGTTCAAGGCTCTGG + Intergenic
1165776792 19:38409292-38409314 GCCAGCCCTGTTCTAGGCACTGG + Exonic
1166137868 19:40788103-40788125 CCAGGCCCTGCTCAAGGCACTGG + Intronic
1166930366 19:46298229-46298251 CCCTACTCTATTCCAGGCCCTGG + Intronic
1167156387 19:47741745-47741767 CCCAGCCCTGTTCTAGGCACTGG + Exonic
1167780938 19:51598436-51598458 CCCTGGTCTATTCCAGGCAGGGG + Intergenic
1167967119 19:53157057-53157079 CCCTACCCTATTCCAGGAAAAGG + Intronic
928616405 2:33043951-33043973 CTGTGCCCTATTCAAGGAAAGGG + Intronic
929034254 2:37675353-37675375 CCAGGCCCTATTCTAGGCACAGG - Intronic
930094673 2:47558151-47558173 CCATGCCCTGTGCCAGGCACTGG + Intronic
931637321 2:64352195-64352217 CCCTCCCCTTTCCAAGGCAAAGG - Intergenic
934238304 2:90249352-90249374 CCCTGCCCTTATCCAGGCCCTGG + Intergenic
935061788 2:99615086-99615108 CTCTGCCCCATTCAAAGCCCTGG - Intronic
937143016 2:119618219-119618241 CCCTGTCCTGTGCAAGGCACTGG - Intronic
937450823 2:122000960-122000982 CCCTGCTCTGTTCAAAGCACAGG - Intergenic
938634784 2:133211667-133211689 CCCAGCACTATTCTAGGCACTGG - Intronic
939068188 2:137508818-137508840 CCCTGGACGATTCTAGGCACAGG - Intronic
940715469 2:157218571-157218593 CCCTGCCTTCTTCAAATCACAGG + Intergenic
940908443 2:159189410-159189432 CCCTGACCTCTGGAAGGCACAGG - Intronic
942942306 2:181632762-181632784 CACTACCCTATCCAAGGCCCTGG - Intronic
948376767 2:237525880-237525902 CCCTGACCTATCCAACACACGGG + Intronic
948952806 2:241265460-241265482 CCCTGCCCTGCCCAAGGCAGAGG + Intronic
949017334 2:241720785-241720807 CCCTGGCCTGTGCAAGGGACAGG + Intronic
1168891162 20:1296149-1296171 ACCAGCCCTATTCAATTCACTGG + Intronic
1169005598 20:2204679-2204701 CCATGCCCTTTACCAGGCACTGG - Intergenic
1169132772 20:3174445-3174467 CCCTACCCTATTCAAGGCTGAGG - Intergenic
1170924174 20:20707804-20707826 CCCTGGCCTATGCAGGACACTGG + Intronic
1172122637 20:32607879-32607901 CCAGGCCCTATTCTAGGCCCGGG - Intronic
1173110154 20:40179686-40179708 CCAGGCACTATTCTAGGCACTGG + Intergenic
1173293850 20:41738336-41738358 CAAGGCCCTATACAAGGCACTGG - Intergenic
1176415386 21:6471714-6471736 CCCTGCCCAAGTCACGGCAGTGG + Intergenic
1176858068 21:13986671-13986693 CCCTGCCCTGGTCTTGGCACTGG + Intergenic
1179690886 21:43080047-43080069 CCCTGCCCAAGTCACGGCAGTGG + Intergenic
1180198144 21:46209442-46209464 CCCTGCCCTATTTCCTGCACTGG - Intronic
1181478700 22:23183925-23183947 CCCTGTCTGACTCAAGGCACTGG - Intronic
1181745149 22:24950926-24950948 CCAAGCCCTGTTCTAGGCACTGG + Intergenic
1182086337 22:27563641-27563663 CTCTGCCCTCCCCAAGGCACTGG + Intergenic
1182742458 22:32578048-32578070 CCAGGCACTATTCTAGGCACTGG - Intronic
1184176285 22:42791357-42791379 CCAAGCACTATTCTAGGCACAGG - Intergenic
950643177 3:14361353-14361375 CCCGGCCCTGCTCAAGGCCCTGG + Intergenic
952712546 3:36445960-36445982 CCTTTCCATCTTCAAGGCACAGG - Intronic
952777743 3:37062307-37062329 ACATGCACTATTCTAGGCACTGG - Intronic
953720825 3:45353495-45353517 CCCTGCCATGTTCCAGGCACTGG - Intergenic
953759856 3:45678109-45678131 TCCTGCCCAATTCTTGGCACAGG + Exonic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
954157176 3:48692370-48692392 CACTGCCCTCTTCTAGGCAGTGG + Intronic
954456286 3:50601420-50601442 CTCTGCCCTACACAAGGCCCAGG + Intergenic
955350814 3:58191843-58191865 CCCTGCCCTATTCCAGAGCCCGG - Intergenic
955866628 3:63390968-63390990 CCCTGCACTATTCTTGGCATTGG - Intronic
956304689 3:67811010-67811032 CCAGGCACTATTCTAGGCACTGG + Intergenic
961970521 3:130960252-130960274 CCCTGCTGTGTTCAGGGCACAGG - Intronic
962113623 3:132477043-132477065 CCATGTACTATTCCAGGCACTGG - Intronic
962311848 3:134332426-134332448 CCATGCCCTGTTCTAGGCATTGG + Intergenic
963328567 3:143889293-143889315 CTCAGCCCTACTCAAGGCAAGGG + Intergenic
965246372 3:166276146-166276168 CATTGCCCCATTCAAGGTACAGG - Intergenic
966946787 3:184782523-184782545 CCTTGCACTATTCAAGGAAGTGG - Intergenic
967320529 3:188190502-188190524 CCATGCTCTGTTCTAGGCACTGG + Intronic
968648392 4:1750917-1750939 CCCTGCACTGTTCCAGGCTCTGG + Intergenic
968949094 4:3681154-3681176 CCCTGCACAACTCCAGGCACTGG - Intergenic
969156025 4:5210646-5210668 CCCTGCCCTAGAGAAGGCATTGG + Intronic
969339628 4:6532023-6532045 TCCTGCCCTTTGCAAAGCACTGG - Intronic
969915969 4:10492093-10492115 CCCTGCCCTGTTCACCTCACAGG - Intronic
972833403 4:42839751-42839773 CCATGCACTATCCTAGGCACTGG - Intergenic
975711853 4:77168824-77168846 CCCTGCCCTTTTCAGAGCAGAGG + Exonic
976238570 4:82928674-82928696 TCATGCACTATTCTAGGCACTGG - Intronic
977707181 4:100085256-100085278 GCCTGATCTAGTCAAGGCACTGG + Intergenic
986095842 5:4553455-4553477 CCCTGCCCTATCCAACTCATTGG - Intergenic
986352843 5:6896051-6896073 ACCTGCTCTACTCAAGGCTCAGG - Intergenic
986673652 5:10165326-10165348 CCATGCCCTGTTGTAGGCACTGG - Intergenic
986685407 5:10271790-10271812 CAGTGCACTATTCAAGGCAGTGG + Intergenic
986836328 5:11642531-11642553 AACTGCTGTATTCAAGGCACAGG + Intronic
989341414 5:40379566-40379588 TCCTGCCCCATTCAAAACACCGG + Intergenic
993128361 5:83863331-83863353 CCCAACCCTATGCCAGGCACTGG + Intergenic
994047288 5:95324474-95324496 CCTTCCCCTAGTCAAGCCACAGG + Intergenic
994721992 5:103391136-103391158 CCTGGCACTATTCTAGGCACTGG - Intergenic
995870435 5:116738480-116738502 GTCTGCCCTGTTCCAGGCACAGG - Intergenic
997719962 5:136070385-136070407 CCAGGCCCTATGCTAGGCACTGG - Intergenic
998080969 5:139274476-139274498 GCCTGCCCCTTTCAAGGCTCGGG - Intronic
998365856 5:141630301-141630323 CCAAGCCCTGTGCAAGGCACTGG + Intronic
999449196 5:151665743-151665765 CCCTGCACTATTCTAGGCAGGGG - Intronic
1000215885 5:159155598-159155620 TCCTGCCCTATACCAGACACTGG + Intergenic
1001579435 5:172788971-172788993 ACTTTCCCTATTCAAGGGACAGG + Intergenic
1002089821 5:176797916-176797938 CCCTGACCCACTCCAGGCACAGG + Intergenic
1002160033 5:177309617-177309639 CTAGGCCCTATTCTAGGCACTGG - Intronic
1003527800 6:6912480-6912502 CCCAGCCCTGTTCTAGGCACTGG + Intergenic
1004178111 6:13358494-13358516 CCCTCCCCTGGGCAAGGCACAGG + Exonic
1006374257 6:33663210-33663232 CCAGGCACTATTCTAGGCACAGG + Intronic
1006799862 6:36752929-36752951 CCCTGGCCTCTTCAAAGCCCTGG - Intronic
1006919912 6:37620610-37620632 TCCTGCCCCAGTCAAGCCACTGG - Intergenic
1008089434 6:47278574-47278596 TCAAGCCCTATTCCAGGCACAGG + Intronic
1008714514 6:54272701-54272723 CTCTATCCTATTCAAGTCACTGG + Intergenic
1010027604 6:71238086-71238108 CCATACACTATTCAAAGCACTGG - Intergenic
1012417664 6:99027058-99027080 CCATGTCCCATGCAAGGCACAGG + Intergenic
1013848116 6:114479190-114479212 TCCTGCCCTATTGAAAACACTGG - Intergenic
1018343686 6:162879800-162879822 CCCTGCCCTCTTGAATTCACTGG - Intronic
1018641758 6:165910089-165910111 CCAGGCACTATTCTAGGCACTGG - Intronic
1022472233 7:30689002-30689024 CCCTTCCCCATTCTAGGCTCAGG - Intronic
1023082638 7:36539551-36539573 CCAGGCACTATTCTAGGCACAGG - Intronic
1023160160 7:37289098-37289120 CCAGGCACCATTCAAGGCACTGG - Intronic
1025810108 7:64870249-64870271 CCCTGCCCAATTCTAGGATCAGG - Intronic
1026732960 7:72927125-72927147 TGCTGCTCTTTTCAAGGCACAGG + Intronic
1028447367 7:90941018-90941040 CCCTAACCTATTTAAGGCAGAGG - Intronic
1029969044 7:104771322-104771344 TCCTGCCCTATTCAACTCATGGG - Intronic
1030080562 7:105774227-105774249 CCCTGCCTTCTTAAACGCACCGG + Intronic
1030528825 7:110686727-110686749 CACTGCCCTCATCAAGGAACAGG + Intronic
1030681835 7:112442434-112442456 CCCTGCCTTATTGATGTCACTGG - Intronic
1031146773 7:118005454-118005476 CCCTGCCCTGTTCACAGCTCAGG + Intergenic
1031957239 7:127955015-127955037 CCCTGCCCTGTTGCTGGCACTGG + Intronic
1035040039 7:155920666-155920688 CCCTACTCTATGCAAGGCCCGGG - Intergenic
1035079473 7:156204122-156204144 CCCTGCCTCAGTCAAGGCCCGGG + Intergenic
1039135396 8:34316960-34316982 CCATGCCCTATGCATGGCAAAGG - Intergenic
1039567954 8:38564676-38564698 CCCTCCCCTATTCAAGGGCCTGG + Intergenic
1040981651 8:53251315-53251337 CCCTCACCAATTCTAGGCACCGG + Intronic
1042739852 8:72031068-72031090 CCCTGCTCTATACTAAGCACTGG - Intronic
1042755529 8:72206474-72206496 CCCTGCTCTATACTAAGCACTGG - Intergenic
1043407955 8:79958164-79958186 CCCTCCCCTATTCTAGACTCTGG + Intronic
1044048531 8:87469170-87469192 ACCTCCTCTATTCTAGGCACTGG + Intronic
1044826779 8:96206005-96206027 CCCTACCCTCTTCAGAGCACTGG + Intergenic
1045617179 8:103930565-103930587 CCCTTCCCTAATTATGGCACAGG + Intronic
1049601178 8:143508351-143508373 CCCTCCCCTGTGCAGGGCACAGG - Intronic
1049633392 8:143672088-143672110 CCCCGCCCTGCGCAAGGCACAGG - Intergenic
1051007375 9:12362626-12362648 CCCTACACTGTTCTAGGCACTGG + Intergenic
1054805809 9:69395028-69395050 CCCTGCCCCATTCTTAGCACTGG - Intergenic
1054943701 9:70771965-70771987 CCAGGCACTATTCTAGGCACTGG - Intronic
1055632586 9:78238605-78238627 CCCGGCCCTTTTCTAGGCTCTGG + Intronic
1056319628 9:85424142-85424164 CCATGCTCTCTTGAAGGCACTGG - Intergenic
1057868464 9:98700190-98700212 CCTGGCCCTATTCTAGGCTCTGG - Intronic
1059009960 9:110446421-110446443 TGCTGCCCTACTCAAGGCTCTGG + Intronic
1059765182 9:117377252-117377274 TCCTGCCCTATTCAGAGCCCTGG - Intronic
1060187902 9:121575043-121575065 CCCCGCCCTGCTCCAGGCACAGG - Intronic
1060933708 9:127504273-127504295 GCCTGCCCTGTTCAGTGCACAGG - Intergenic
1061400709 9:130366783-130366805 CCAGGCCCTGTTCTAGGCACTGG + Intronic
1061621177 9:131812297-131812319 CCCTGCCCTGTCCAAGGAATAGG - Intergenic
1061887739 9:133601148-133601170 CACTGCCCCATACTAGGCACAGG + Intergenic
1062570746 9:137184080-137184102 ACCTGCCCTGATCCAGGCACGGG + Intronic
1187983222 X:24781988-24782010 CCATGCACTGTTCTAGGCACAGG + Intronic
1188015669 X:25105185-25105207 CCCAGCCCTATGCAAAGCACTGG + Intergenic
1188215230 X:27468287-27468309 CCAGGCCCTATACCAGGCACTGG + Intergenic
1188424433 X:30029929-30029951 CCAGGCCCTGTTCTAGGCACTGG - Intergenic
1190257462 X:48774224-48774246 CCAGGCCCTGTTCCAGGCACTGG + Intergenic
1191996839 X:67104908-67104930 CCCTTCATTATCCAAGGCACAGG - Intergenic
1194823292 X:98531490-98531512 CCCTCCCCTACTCCTGGCACTGG + Intergenic
1195100520 X:101550855-101550877 CCCTCCCTGATTCAAGGCCCTGG - Intronic
1195739316 X:108046508-108046530 CCCTGGCCCATACTAGGCACAGG + Intronic
1195968115 X:110447835-110447857 CTTTGCCCTATCCAAGGCTCAGG + Intronic
1196864370 X:120057593-120057615 CCCTTCCCCAATCATGGCACTGG - Intergenic
1196878730 X:120178738-120178760 CCCTTCCCCAATCATGGCACTGG + Intergenic
1197092884 X:122559420-122559442 CCCTGCCCTGTCCCAGTCACTGG + Intergenic
1197600427 X:128520672-128520694 CCTTCCCCTTTTCAAGGCAGAGG - Intergenic
1198802851 X:140465057-140465079 CCAAGCACTATTCTAGGCACTGG - Intergenic
1198854880 X:141005374-141005396 CCCTTCCCTATCCTAGGCAGTGG + Intergenic
1198877132 X:141239769-141239791 CCCTTCCCTATCCTAGGCAGTGG - Intergenic
1198907813 X:141581995-141582017 CCCTTCCCTATCCTAGGCAGTGG - Intergenic
1198908978 X:141592429-141592451 CCCTTCCCTATCCTAGGCAGTGG + Intronic
1198918100 X:141695723-141695745 CCCTTCCCTATCCTAGGCAGTGG - Intronic
1199991309 X:152989077-152989099 CCCTGCCCTATAGACTGCACAGG + Exonic
1200282774 X:154792195-154792217 CCCTGCCCAGGTCAAGGGACAGG - Exonic
1202363536 Y:24137612-24137634 CCCTTTCCTATTCAAAGCAAGGG + Intergenic
1202507244 Y:25532505-25532527 CCCTTTCCTATTCAAAGCAAGGG - Intergenic