ID: 1084594509

View in Genome Browser
Species Human (GRCh38)
Location 11:70108987-70109009
Sequence GGGCAAGGGACCCACTGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084594509_1084594518 23 Left 1084594509 11:70108987-70109009 CCCCCACAGTGGGTCCCTTGCCC 0: 1
1: 0
2: 3
3: 16
4: 205
Right 1084594518 11:70109033-70109055 GCCAGAACATTGCAGAGCAAAGG 0: 1
1: 0
2: 0
3: 11
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084594509 Original CRISPR GGGCAAGGGACCCACTGTGG GGG (reversed) Intronic
900225695 1:1532778-1532800 GGGCCCCGGACCCACAGTGGTGG + Intronic
900512392 1:3066847-3066869 GGGGAAGGGACCCTCTCTGCAGG + Intergenic
900955061 1:5881570-5881592 GGGCAAAGGCCCCGATGTGGTGG + Intronic
902580343 1:17403994-17404016 GTGCTGGGGACCCAGTGTGGGGG + Intergenic
902709795 1:18230886-18230908 GGGGAAGGAAGCCACAGTGGGGG - Intronic
903144863 1:21364821-21364843 GGGAAAGGGTCCCTCTGGGGAGG - Intergenic
903806017 1:26006114-26006136 GGTCAGGGGACCCAGGGTGGGGG + Intergenic
903807947 1:26018742-26018764 GTGCAAGTGAGCCACTGCGGTGG - Intergenic
904256540 1:29258423-29258445 GGGCAAGGGGAGCACTGAGGAGG - Intronic
905450113 1:38050886-38050908 GGGCAGAGGCCCCACTGGGGAGG - Intergenic
906033140 1:42735822-42735844 GGGCAAGGGGGCCACTGGGTGGG + Intronic
906206966 1:43992062-43992084 GGGCCAGGGACCCGCAGAGGTGG - Intronic
907552878 1:55319170-55319192 GGGTAAGGGAGCTGCTGTGGAGG + Intergenic
909779256 1:79521936-79521958 GGGCTAGGGCACCAATGTGGTGG + Intergenic
912578734 1:110701054-110701076 GGGCAAGAGACAGACTGAGGAGG + Intergenic
913415580 1:118602926-118602948 GGACAATAGTCCCACTGTGGAGG - Intergenic
913710472 1:121477808-121477830 GGGTCAGGGACCCATTGAGGAGG - Intergenic
914839932 1:151240071-151240093 GGGTAAGGGAGCCACTGGGCAGG - Intronic
915073217 1:153289101-153289123 GAGCTAGGGACGCACTGGGGAGG + Intergenic
915657941 1:157377054-157377076 GGCCAAGGGAACTACTGAGGGGG + Intergenic
917890117 1:179428516-179428538 GGCCCAGGGACCCCTTGTGGGGG + Intronic
920400639 1:205674096-205674118 GGGGGTGGGACCCAATGTGGGGG + Intronic
921368828 1:214401203-214401225 GGGCTAGGAACCCACAGGGGAGG + Intronic
921702633 1:218285040-218285062 GGGCTGGGGACGCACTGGGGCGG + Intergenic
924477303 1:244393565-244393587 GGGGAAGGGGCCAAGTGTGGTGG - Intergenic
1062937836 10:1401196-1401218 AGCTGAGGGACCCACTGTGGAGG + Intronic
1063377394 10:5562198-5562220 GTGCAATGGGCCCAGTGTGGAGG - Intergenic
1064125467 10:12656225-12656247 ATGCAGGGTACCCACTGTGGGGG - Intronic
1070304984 10:75234589-75234611 GAGTAAGGGATCCACTGCGGGGG - Exonic
1072610015 10:97011601-97011623 GGTCAAGGCACCCACTGAGCAGG - Intronic
1073138544 10:101232767-101232789 GGGCAAGGCAGACACTCTGGGGG + Intergenic
1074533416 10:114312026-114312048 GGGGAAGGGTCTCTCTGTGGAGG + Intronic
1074839694 10:117337766-117337788 GGGCAAGGGAGCTACTTTGCTGG - Intronic
1077095058 11:795726-795748 GGGCAAGGGGCTGGCTGTGGGGG - Intronic
1077145199 11:1041463-1041485 GGACAAGGGCCCCTCTCTGGAGG - Intergenic
1078179057 11:8995148-8995170 TAGCAAGAGAACCACTGTGGGGG - Intronic
1079342507 11:19624210-19624232 GGGTCAGGGGCCCACTGAGGAGG + Intronic
1079711293 11:23685425-23685447 GGGAAAGGGACCTCCAGTGGGGG + Intergenic
1080346813 11:31334854-31334876 GGGTCAGGGACCCACTGAGGAGG + Intronic
1081043822 11:38246887-38246909 TGTAAAGGGACCCACTGCGGAGG - Intergenic
1083309884 11:61778711-61778733 GGGCAAGAGAAACCCTGTGGAGG + Intronic
1083668190 11:64286351-64286373 GGGCAAGGGTCTCTCTGTTGAGG + Intronic
1083706182 11:64518006-64518028 GGCCCTGGGACCCACTGAGGCGG - Intergenic
1084594509 11:70108987-70109009 GGGCAAGGGACCCACTGTGGGGG - Intronic
1084935445 11:72584329-72584351 GGGCAAGGAACCACCGGTGGAGG + Intronic
1085340925 11:75731075-75731097 AGGCAAGGGACCCTCGGTGCAGG - Intronic
1088714149 11:112534108-112534130 GGGCAAGTGACCCCAGGTGGAGG + Intergenic
1089110972 11:116055761-116055783 GGGCCACGGGACCACTGTGGAGG + Intergenic
1089672280 11:120064734-120064756 GGGCAAGGTACACAGGGTGGGGG + Intergenic
1090416989 11:126547537-126547559 GGGTAGGGGACCCACTGCTGGGG + Intronic
1091672452 12:2462106-2462128 TAGCAAGGGAGTCACTGTGGAGG - Intronic
1092903913 12:13085051-13085073 GGTCAAAGGACCCACGGTGGGGG + Exonic
1093714485 12:22366136-22366158 GGGCATGGGATCCACTGTGCTGG - Intronic
1094126828 12:27032298-27032320 GGGCAAGGTAACCAGTGAGGTGG + Intronic
1095938687 12:47711762-47711784 GGGTAAGAATCCCACTGTGGAGG + Exonic
1097085021 12:56461303-56461325 TCACATGGGACCCACTGTGGAGG - Intronic
1097262006 12:57725587-57725609 GGGGAGGGGTCCCACTGTAGGGG + Intronic
1101679272 12:106949011-106949033 GAGCAAGGCACCCAAAGTGGTGG - Intergenic
1102035424 12:109768381-109768403 GGCCAAGGGACCCAGAGTGCTGG - Exonic
1102951337 12:117033501-117033523 GGTCAAGGGGCCCGCTGAGGAGG - Intergenic
1103285330 12:119796302-119796324 AGGCAAGGGAATCACTGAGGAGG + Intronic
1103964844 12:124632232-124632254 GGGCAGGGGACCCACCTGGGTGG + Intergenic
1105389406 13:19960019-19960041 GGGCAAAGGACTCACAATGGGGG - Exonic
1106698322 13:32202448-32202470 GGGCAAGTGACACGCTGTAGAGG - Exonic
1119429632 14:74557973-74557995 GGGCAAGGAAACCAGTGGGGAGG - Intronic
1121382890 14:93489845-93489867 CAGGAAGGGAACCACTGTGGGGG - Intronic
1121961627 14:98265533-98265555 GGGCAATGGATCCACTGTTGAGG + Intergenic
1124945123 15:34258504-34258526 TGGCAAGGGATCCAGAGTGGAGG - Intronic
1125521062 15:40348021-40348043 GGGCAAGGGAGCCTCTGATGAGG + Intergenic
1132801638 16:1757615-1757637 GAGCAAGGGCCCCACTGTGGAGG - Intronic
1137674372 16:50297037-50297059 GGGCAAGGGACCCTCTGTGTGGG - Intronic
1139328344 16:66168883-66168905 AGGCAAGGGACCCGCTGCAGAGG + Intergenic
1141432895 16:83980134-83980156 GTGCAAGGGACCCAATACGGTGG - Intronic
1141607777 16:85164957-85164979 GGGCAAAAGGCCCACTGAGGAGG + Intergenic
1141756759 16:85996617-85996639 GGGCAGGAGAGCCACTGTGGGGG - Intergenic
1142180279 16:88665377-88665399 TGGCAGGTGACCCACTGTGCTGG - Intergenic
1143733958 17:8897319-8897341 GGGGAAGGAACCCACTGGGCAGG + Intronic
1144653360 17:17020468-17020490 GAGCAAGGGTCCCATTCTGGTGG + Intergenic
1145229781 17:21165218-21165240 GGACAAGGCACTGACTGTGGTGG - Intronic
1147715815 17:42507549-42507571 GGGCAACGGACCGACAGAGGAGG + Exonic
1151254022 17:72861114-72861136 GGGCAAGAGGCCCATGGTGGAGG + Intronic
1155114283 18:22749281-22749303 GGGTCAGGGACCCACTGAGGAGG - Intergenic
1157501465 18:48193815-48193837 GGTCCAGGGACCCATCGTGGGGG + Intronic
1159627535 18:70712092-70712114 GGGCAAGTGACACACTATGAAGG + Intergenic
1160300923 18:77677666-77677688 GGGCTAAGGAGCCACTGGGGTGG + Intergenic
1160872476 19:1283551-1283573 TGGCAGGGGGGCCACTGTGGGGG - Intergenic
1160913869 19:1487671-1487693 AGGCACGGGACCCGCTGTGCTGG - Exonic
1161412313 19:4123593-4123615 GGGCAGGGGACCCTCGGGGGAGG - Intronic
1162343260 19:10105228-10105250 GGCCGAGGGGCCCAGTGTGGGGG - Intergenic
1162348755 19:10136386-10136408 GTGCAAGGGGCCCCCTGGGGTGG + Intronic
1162353368 19:10165326-10165348 GTGCAAGGGGCCCCCTGGGGTGG + Intronic
1165078474 19:33293998-33294020 AGGCTAGGGACCAAATGTGGTGG - Intergenic
1165711105 19:38011644-38011666 GGTCAAGGCAGCCAGTGTGGCGG + Intronic
1165900710 19:39168016-39168038 GAGCACGGGACCCAGTCTGGAGG - Intronic
1166650727 19:44572354-44572376 GGGCCTGCGACCCAGTGTGGAGG + Intergenic
1167042512 19:47030925-47030947 GGCAAAGGGGCCCAGTGTGGTGG - Intronic
1167593642 19:50416863-50416885 GGGCCGAGGACCCTCTGTGGGGG - Intronic
928427559 2:31191889-31191911 GGGCATGGGACCAAGCGTGGGGG - Intronic
928808926 2:35198445-35198467 GGGCAGGGGACCCTATGTGGGGG - Intergenic
932152573 2:69386922-69386944 GGGCAAGGGGCGCCCAGTGGTGG - Intronic
934473696 2:94578245-94578267 AGGAAAGGGATACACTGTGGAGG - Intergenic
934855283 2:97725444-97725466 GGCCAAGGGACCGAGTCTGGAGG - Intronic
934979283 2:98826871-98826893 GGGCATGAGACCCTGTGTGGGGG + Intronic
936467325 2:112764887-112764909 GGGCGTGGGACCCTCCGTGGGGG + Intergenic
937463640 2:122110568-122110590 GGGAGAGGGACACACTGCGGAGG - Intergenic
943866520 2:192930947-192930969 GGGCATGGGAGCCACTGAGCTGG + Intergenic
945628193 2:212237553-212237575 GGGTCAGGGACCCACTGAGGAGG + Intronic
945978295 2:216287528-216287550 CCCCAAGGGACACACTGTGGGGG + Intronic
946444531 2:219726989-219727011 GGACAAGGGACTCACTGTCAAGG + Intergenic
946811574 2:223530986-223531008 AGGCAAGGGGCCCACTGAGCTGG + Intergenic
947693081 2:232157902-232157924 GTGAAAGGCTCCCACTGTGGAGG - Intronic
947946347 2:234106187-234106209 GTGGAAGGGTCCCACTGAGGAGG - Intergenic
948387629 2:237591463-237591485 GGGCGGAGGAACCACTGTGGTGG - Intronic
1170472918 20:16685977-16685999 GGGCAAGGGATCCTCTTTGCTGG + Intergenic
1170623501 20:18013215-18013237 GGGCATGGGAGCCACTTGGGAGG + Intronic
1171567429 20:26208430-26208452 GGGAAAGCGTCCCACGGTGGGGG - Intergenic
1172131827 20:32661099-32661121 AGGAAAGAGACCCACTGTGCGGG + Intergenic
1175507461 20:59495926-59495948 GGGCTGGTGACCCTCTGTGGTGG - Intergenic
1175993875 20:62803885-62803907 GAGCAAGGGACCCGCGGTGCTGG + Intergenic
1176212896 20:63933861-63933883 TGGCAAGGGGCCCACTCTGATGG - Exonic
1176307568 21:5131963-5131985 GGGCACAGGACCCTCTGTGCAGG + Intronic
1176547407 21:8207844-8207866 GGGAAAGCGTCCCACGGTGGGGG + Intergenic
1176555312 21:8252053-8252075 GGGAAAGCGTCCCACGGTGGGGG + Intergenic
1176566358 21:8390891-8390913 GGGAAAGCGTCCCACGGTGGGGG + Intergenic
1176574234 21:8435078-8435100 GGGAAAGCGTCCCACGGTGGGGG + Intergenic
1178955033 21:37014357-37014379 GTGCACGGCACCCACTGTGCTGG - Intronic
1179177839 21:39021693-39021715 GGGCCTGGGTCCCCCTGTGGAGG + Intergenic
1179658937 21:42862577-42862599 TGGCCAGGGACCCTCTGGGGAGG - Intronic
1179849492 21:44130067-44130089 GGGCACAGGACCCTCTGTGCAGG - Intronic
1180629781 22:17220461-17220483 TGACAATGGACCCTCTGTGGTGG - Intronic
1180999925 22:19983270-19983292 AGGCAAGGGACCCATTGTGCAGG - Intronic
1181031578 22:20150773-20150795 GGGCAGTGGGCCCACAGTGGAGG - Exonic
1181168299 22:20994794-20994816 GGGCGAGGGGCTCACAGTGGTGG - Intronic
1183039541 22:35166353-35166375 GGGTCAGGGACCCACTTGGGAGG - Intergenic
1184727239 22:46354281-46354303 TGGTAAGGTCCCCACTGTGGTGG - Intronic
1203252280 22_KI270733v1_random:124129-124151 GGGAAAGCGTCCCACGGTGGGGG + Intergenic
1203260337 22_KI270733v1_random:169215-169237 GGGAAAGCGTCCCACGGTGGGGG + Intergenic
949342509 3:3044998-3045020 GGGCATGGGACCCTCTGAGCCGG - Intronic
949922026 3:9010402-9010424 GGGAATGGGACTCACTGCGGGGG + Intronic
950505454 3:13391731-13391753 GGGGAGGGGACCCAGGGTGGAGG + Intronic
951131009 3:19044980-19045002 GTGCAAGGGACACAGTGTTGGGG + Intergenic
951687538 3:25361955-25361977 GGTTCAGGGACCCACTGAGGAGG + Intronic
954108450 3:48421394-48421416 GAGCCAGGGACACACTGTTGGGG + Intronic
961558532 3:127713077-127713099 GGGCAAGGGCCACACTGTGAGGG + Intronic
961779698 3:129314525-129314547 GGCCGATGGACCCCCTGTGGGGG + Intergenic
963602122 3:147387836-147387858 GGGGAAGGGAGCCACCCTGGGGG - Exonic
963851102 3:150211176-150211198 GGCAAGGGGACCCTCTGTGGTGG + Intergenic
965757278 3:172039868-172039890 GGGACAGGGACGCACTTTGGCGG - Intronic
967409284 3:189151195-189151217 TGTTAAGGGACCCACTTTGGAGG - Intronic
968277344 3:197450510-197450532 GGGCCAGGGCCCCTTTGTGGAGG + Intergenic
968425817 4:522552-522574 GATCAAGGGACCCACTGCAGTGG + Intronic
973332392 4:48923177-48923199 GGGTCAGGGACCCACTGAGGAGG + Intergenic
973867092 4:55125206-55125228 GGGTAAGGAGCCCACTCTGGAGG - Exonic
976673081 4:87675079-87675101 GTTCAAGGGACCCAGTGGGGAGG - Intergenic
984892052 4:184502971-184502993 GGGGTGGGGACCGACTGTGGAGG + Intergenic
985378577 4:189368355-189368377 GAGCAAGGGACACAGTGTGACGG + Intergenic
986287422 5:6370209-6370231 TGCCTGGGGACCCACTGTGGTGG + Intergenic
986747747 5:10759381-10759403 TGGACAGGGACCCGCTGTGGTGG + Intronic
989422031 5:41251526-41251548 GGGCAAGGGACACAAAGAGGAGG - Intronic
990234316 5:53750834-53750856 GGGCATGGGACCCACTGAGCTGG - Intergenic
997652841 5:135535173-135535195 AGGCAGGGGACGCACTGCGGCGG + Exonic
1001240916 5:170069266-170069288 GGGCAAGTGAACCACGGTGGGGG - Intronic
1003272983 6:4623782-4623804 GGGCAAGGAACCCAGTTAGGAGG - Intergenic
1003273006 6:4623947-4623969 GGGCAAGGAACCCAGTTAGGAGG - Intergenic
1003971005 6:11299195-11299217 GGGCGTGGGACCCACTGAGCCGG - Intronic
1004455129 6:15785130-15785152 GTGCAAGGGACCCAGTGTAGGGG - Intergenic
1005857098 6:29870898-29870920 AGACTAGGGACCCATTGTGGGGG - Intergenic
1005862914 6:29915049-29915071 AGACTAGGGACCCAGTGTGGGGG - Intergenic
1005874423 6:30000245-30000267 AGACTAGGGACCCAGTGTGGGGG - Intergenic
1006026181 6:31148565-31148587 GGGCAAGGGAGCCCCTGTTCCGG - Intronic
1008865482 6:56204646-56204668 GGGTCAGGGACCCACTGTGGAGG - Intronic
1009305841 6:62088676-62088698 GGGACAGGGACCCACTTGGGGGG + Intronic
1010707127 6:79128058-79128080 AGGCTAGGAACCCACTGTGCTGG - Intergenic
1013349813 6:109295315-109295337 GGACAAGGGAACCCCTGTGGGGG - Intergenic
1015921005 6:138266382-138266404 GGGAAAGGGTCTCACTGTGTTGG + Intronic
1016527678 6:145021053-145021075 TGGCTAGGGACCCACTGGGCAGG - Intergenic
1017123280 6:151044134-151044156 AGGAAAGGGATACACTGTGGAGG + Intronic
1019290966 7:249998-250020 GAGCAAGGTCCCCACTGGGGAGG + Intronic
1022411173 7:30139744-30139766 GTGCAAGGGACCCAAAATGGAGG - Intronic
1023233038 7:38053812-38053834 GTGGCAGGGACCCACAGTGGGGG + Intergenic
1025004654 7:55344540-55344562 GGGCATGGGTCCCAGTGGGGAGG - Intergenic
1025610087 7:63070593-63070615 GGGCAGGGGACTCACTGCTGTGG - Intergenic
1027188581 7:75985530-75985552 GGGCAAGGGCCTCGGTGTGGCGG + Intronic
1028946396 7:96585290-96585312 GGGTCAGGGACCCATTGAGGAGG + Intronic
1030987545 7:116260275-116260297 ATGCAAAGGACCCACTGTGCTGG + Intergenic
1034618247 7:152436570-152436592 GGGCGAGGGGCCGAGTGTGGGGG - Intergenic
1034725387 7:153330931-153330953 GTTCAAGGGAGCCACTGTGTGGG - Intergenic
1034808436 7:154108755-154108777 GGGCTGGGGAGCCACTGGGGCGG + Intronic
1035735672 8:1885829-1885851 GGGCCAGGAACCTACAGTGGAGG - Intronic
1037454902 8:19053301-19053323 GGGCAGGGGACGCAGTGCGGAGG - Intronic
1037896319 8:22658761-22658783 GGGCAAGAGACCCACAGTTTTGG + Intronic
1038011711 8:23481335-23481357 TGGCAAGGGGCCCACTTTGATGG + Intergenic
1038311570 8:26449519-26449541 GGGAGAGGGACCCACTGCGTAGG + Intronic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1038975406 8:32690318-32690340 GGGTAAGGGACTTGCTGTGGGGG - Intronic
1042857924 8:73285990-73286012 GGGCAAGGGGCCCAGTGTTAGGG + Intergenic
1042922928 8:73938220-73938242 GCGGAAGGGACCCAGTGGGGAGG + Intergenic
1046663285 8:116972398-116972420 GGGCAAGTGACTAACCGTGGAGG + Intronic
1048984889 8:139730075-139730097 GGGCCAGCTGCCCACTGTGGCGG + Intergenic
1049444003 8:142621804-142621826 TGGCTGGGGACCCAGTGTGGGGG - Intergenic
1053684634 9:40510267-40510289 AGGAAAGGGATACACTGTGGAGG + Intergenic
1053934600 9:43138545-43138567 AGGAAAGGGATACACTGTGGAGG + Intergenic
1054279092 9:63114698-63114720 AGGAAAGGGATACACTGTGGAGG - Intergenic
1054297728 9:63345729-63345751 AGGAAAGGGATACACTGTGGAGG + Intergenic
1054395744 9:64650240-64650262 AGGAAAGGGATACACTGTGGAGG + Intergenic
1054430388 9:65155435-65155457 AGGAAAGGGATACACTGTGGAGG + Intergenic
1054499992 9:65866086-65866108 AGGAAAGGGATACACTGTGGAGG - Intergenic
1055807868 9:80116966-80116988 GGGTCAGGGACCCACTGAGGAGG + Intergenic
1056769130 9:89464377-89464399 GGGCAAGGCAGCCACAGTTGGGG + Intronic
1056789091 9:89613981-89614003 GGACAAGAGACCCACTTTGAGGG - Intergenic
1060537241 9:124400082-124400104 GGGCAAGGGACCCATGCAGGGGG - Intronic
1060894388 9:127208342-127208364 TGGGACTGGACCCACTGTGGGGG - Intronic
1061271757 9:129547705-129547727 GGGCTATGGATCCACTGGGGAGG + Intergenic
1061949219 9:133926875-133926897 TGGCAACAGCCCCACTGTGGAGG + Intronic
1062129185 9:134883501-134883523 GGGCAGGGGTCTCAGTGTGGGGG + Intronic
1062415412 9:136446810-136446832 GGGAAAGGTACCCAGTGAGGAGG - Intronic
1203468685 Un_GL000220v1:107280-107302 GGGAAAGCGTCCCACGGTGGGGG + Intergenic
1203476506 Un_GL000220v1:151252-151274 GGGAAAGCGTCCCACGGTGGGGG + Intergenic
1187376976 X:18764150-18764172 GGGCAAGGGATGCCCTGGGGTGG + Intronic
1190044206 X:47099368-47099390 GGGCAAGAGAGCCACACTGGGGG - Intergenic
1192149040 X:68700467-68700489 GGGCAGGGGTTCCTCTGTGGTGG - Intronic
1192834310 X:74782828-74782850 GGGTAAGGGAGGCAGTGTGGTGG + Intronic
1193154325 X:78157327-78157349 GGGTCAGGGACCCACTTGGGAGG + Intergenic
1200876072 Y:8155824-8155846 ATGGAAGGGCCCCACTGTGGTGG - Intergenic
1201057547 Y:10011068-10011090 ATGGAAGGGCCCCACTGTGGTGG + Intergenic