ID: 1084597102

View in Genome Browser
Species Human (GRCh38)
Location 11:70123459-70123481
Sequence TCCTCCAGTGCCTGGAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 317}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084597102_1084597110 -3 Left 1084597102 11:70123459-70123481 CCTGCCCTCCAGGCACTGGAGGA 0: 1
1: 0
2: 3
3: 34
4: 317
Right 1084597110 11:70123479-70123501 GGAGTTATGGAGGCTCCAAGGGG 0: 1
1: 1
2: 2
3: 14
4: 167
1084597102_1084597109 -4 Left 1084597102 11:70123459-70123481 CCTGCCCTCCAGGCACTGGAGGA 0: 1
1: 0
2: 3
3: 34
4: 317
Right 1084597109 11:70123478-70123500 AGGAGTTATGGAGGCTCCAAGGG 0: 1
1: 0
2: 1
3: 11
4: 119
1084597102_1084597108 -5 Left 1084597102 11:70123459-70123481 CCTGCCCTCCAGGCACTGGAGGA 0: 1
1: 0
2: 3
3: 34
4: 317
Right 1084597108 11:70123477-70123499 GAGGAGTTATGGAGGCTCCAAGG 0: 1
1: 0
2: 1
3: 15
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084597102 Original CRISPR TCCTCCAGTGCCTGGAGGGC AGG (reversed) Intronic
900238596 1:1604108-1604130 TCCTCCAGGGCCTTCAGGGAAGG + Intergenic
900479951 1:2893205-2893227 TGCTCCAGGGCCTGGACGCCTGG + Intergenic
900791837 1:4685850-4685872 TCATCCAGAGGCTGCAGGGCTGG + Intronic
900822027 1:4897167-4897189 TCCTCCTGTGCCTGCTTGGCTGG - Intergenic
900897378 1:5493163-5493185 TCCTCCTGTGCCTTCAGGGCAGG - Intergenic
900997218 1:6129105-6129127 TCCTCCATTGCCTGGAGCCCTGG - Intronic
901058369 1:6460203-6460225 TCCACCAGGGCCTGGCTGGCTGG - Exonic
901422783 1:9162251-9162273 TGCTCCAGTGCCTGTCCGGCTGG - Intergenic
901853930 1:12032112-12032134 TCCACAGGTGCCAGGAGGGCAGG - Intergenic
901914031 1:12484181-12484203 TCCTGCTGTGCCTGGAGGCAGGG + Intronic
902113759 1:14104258-14104280 TCCTCCAGCGCCAGGAGACCAGG - Intergenic
902160976 1:14530157-14530179 TCCCCCAGTGCCAGGAGGGCAGG + Intergenic
902183390 1:14706888-14706910 TCCTCCAGTTCCTGGTGGGGTGG - Intronic
902516547 1:16992571-16992593 TCCTCCAGGACCTGGCAGGCAGG + Exonic
902650547 1:17834522-17834544 TCCTCCAGCTTCTGGAGGACTGG + Intergenic
903183684 1:21618014-21618036 TCCTCCAGTGCCCCCAGAGCTGG + Intronic
903330499 1:22594687-22594709 GCCTCCAGTGCTTGTAGGCCTGG + Intronic
903744493 1:25577439-25577461 ACCTCGAGTTCCTTGAGGGCAGG - Intergenic
903775501 1:25790797-25790819 TCCCTCAGTGCCTGGTGGGCAGG + Intergenic
903968870 1:27106321-27106343 GCCTCCAGTGGCTGGAGGGCTGG + Intronic
904027619 1:27514299-27514321 TCCTGCAGTGCCAGGACAGCTGG - Intergenic
904425863 1:30422565-30422587 TCCTGCAGTGCCCTCAGGGCAGG + Intergenic
905201359 1:36319326-36319348 TCCTCCAGTGCGGGGAGGACTGG + Intronic
905938102 1:41840740-41840762 TCGTCCAGTGACTGGCTGGCTGG - Intronic
908090353 1:60678987-60679009 ACTTCTAGTGCCTGGAGGGTAGG + Intergenic
908193628 1:61727953-61727975 TCCTCCTGTGCCTGGCGTGGTGG + Intergenic
908383097 1:63615091-63615113 TCCTCCAGTGCCTGGACCATTGG + Intronic
908435629 1:64102856-64102878 GCATCCAGTGCGTGGAGGCCAGG - Intronic
912680554 1:111726431-111726453 TGCTCCAGTCCCAGGAGGCCTGG + Exonic
912717047 1:111990083-111990105 TCCTCCACTGCCTGGCGGCTCGG - Intergenic
912797832 1:112703583-112703605 TCATTCAGTGACTGGGGGGCGGG + Intronic
913261050 1:116998487-116998509 ACCCCAAGTTCCTGGAGGGCAGG + Intergenic
915168594 1:153962634-153962656 GCCTCCAGTGCCTGTGGGGCTGG - Exonic
915367844 1:155325379-155325401 GCCACCAGGGCGTGGAGGGCCGG - Exonic
917835558 1:178938990-178939012 TCCTCCAGAGCGTGGAGGGCTGG + Intergenic
920340739 1:205273751-205273773 TGCTCCAGCACCTGGAGAGCAGG - Intergenic
920400019 1:205670576-205670598 TCCCCCAGGGCCTGGAGGCCAGG + Intronic
920544107 1:206801345-206801367 TCCTCATGTGCCTGGAGGCGGGG + Intronic
920746243 1:208631675-208631697 TCCTCCAGGCCCTGGGGAGCTGG - Intergenic
921118919 1:212119744-212119766 TCAGCCAGTGCCTGCAGGGCTGG - Intergenic
921332478 1:214053231-214053253 TCCTCCAGGGCCTGGCGCGGTGG - Intergenic
921884996 1:220296620-220296642 TCCTCCAAGGACTGCAGGGCAGG - Intergenic
922515204 1:226202632-226202654 TCCTACAGTCCCTGAAGGGCAGG + Intergenic
923467166 1:234259472-234259494 TCCTCCAGTTCCTCTGGGGCAGG + Intronic
923766578 1:236897812-236897834 TCCTGCAGTGCCTGGAAAACAGG + Exonic
924453298 1:244198480-244198502 TCCTCCCTGGCTTGGAGGGCAGG - Intergenic
924811864 1:247409993-247410015 TCCTCTGGGGCCTGGAGTGCTGG - Intergenic
1063022849 10:2146800-2146822 CCCTCCATCACCTGGAGGGCAGG - Intergenic
1063393184 10:5663491-5663513 TCCCACAGTGCCTTGAGGGTGGG - Intronic
1066361997 10:34740193-34740215 TCCTCCAGTTCCAGCAGAGCTGG + Intronic
1066372837 10:34831818-34831840 GGCTCCAGTTCCTGGAGGGTAGG - Intergenic
1067218623 10:44324703-44324725 CCCTCCAGTGCCTCTAGGGGAGG - Intergenic
1067728232 10:48789795-48789817 TCCACGAGCTCCTGGAGGGCAGG - Intronic
1069714343 10:70510938-70510960 TCCTGCAGGCCCTGGTGGGCAGG + Intronic
1069814858 10:71187227-71187249 ACCCCCAGTGCCTGGATGTCCGG - Intergenic
1070289794 10:75106690-75106712 TCCACCAGTTCCAAGAGGGCAGG + Intronic
1070700432 10:78597981-78598003 TCCTGCAGTGCCCGGGGGGTGGG - Intergenic
1072549153 10:96463989-96464011 TCCTCCAGTGCCGTGAGAGAGGG - Intronic
1073429804 10:103478765-103478787 TCCTCCGGTGCCCTGCGGGCCGG + Exonic
1073988557 10:109237845-109237867 TCATCCAGAGCCTGGAGCTCTGG + Intergenic
1076031000 10:127158313-127158335 TTCTCCAGTGACAGTAGGGCTGG + Intronic
1076194176 10:128503634-128503656 TCCTCTAGAGCCTGCAGGGAGGG - Intergenic
1076495908 10:130897895-130897917 TCCCCCAGTTCCTGGAGTGGAGG + Intergenic
1077289794 11:1783717-1783739 CCCTCCTCTGCCTGGAGGGCAGG - Intergenic
1077388954 11:2290485-2290507 TCCCCCCATGCCTGGAGGGCTGG + Intergenic
1077516818 11:3007119-3007141 TCCTCCAGTGCTTGGGAGGGAGG + Intronic
1077518065 11:3014165-3014187 CCCTCCAGTGCCCCTAGGGCTGG - Intronic
1077557492 11:3232630-3232652 TCCCACACTGCCTGGAGAGCTGG - Intergenic
1078267418 11:9765609-9765631 TTCTCCATTCCCTGGAGGCCTGG - Intergenic
1078552921 11:12292863-12292885 ACCTCTGGTGCCTGAAGGGCAGG - Intronic
1079557941 11:21784297-21784319 TACTCCAGAGCCTGAAGAGCAGG + Intergenic
1081626613 11:44659775-44659797 TGCTCCAGTGCCAGGAGGGAGGG - Intergenic
1081739988 11:45432221-45432243 TCCCTGAGTGCCTTGAGGGCTGG - Intergenic
1081811080 11:45914439-45914461 CTCCCCAGTGCCTGGAGTGCAGG + Exonic
1082812097 11:57484593-57484615 CCTTCCAGGGCCAGGAGGGCAGG - Exonic
1083522860 11:63332246-63332268 TCCTTCAGTTCTTGTAGGGCAGG + Intronic
1083902268 11:65649406-65649428 TCCTCCAGGGCCTGGGGATCTGG + Exonic
1084395157 11:68904476-68904498 CCCTCCAGTGCGTCCAGGGCCGG + Intronic
1084454647 11:69261416-69261438 TCTGCCTGTGCCTGGAGGGCTGG + Intergenic
1084597102 11:70123459-70123481 TCCTCCAGTGCCTGGAGGGCAGG - Intronic
1084664911 11:70571129-70571151 TCCCCCACTCCCTGGAGGTCAGG + Intronic
1085405734 11:76260684-76260706 TACTGCAGGGCCTGGAGGACAGG + Intergenic
1085463115 11:76707052-76707074 TCCTCTAGTGCCAGAAGGCCTGG + Intergenic
1086839281 11:91665723-91665745 TCCTGCTGTGCCTAGTGGGCTGG + Intergenic
1087812353 11:102622324-102622346 TCCTCTGGTGCCTGGTGGCCTGG - Intronic
1090118373 11:123998822-123998844 TCCTCTAGTCCCTGTAGGGTGGG + Intergenic
1090736985 11:129618682-129618704 TTCTCCAGTTCCAGAAGGGCCGG - Intergenic
1091602994 12:1929306-1929328 TCCCCCGATGCCTGCAGGGCAGG - Intergenic
1091633313 12:2178515-2178537 TGCTCCTGTGTCTGGAGAGCTGG + Intronic
1091654487 12:2335555-2335577 CCCTCCTGTCCCTGGAAGGCAGG + Intronic
1091795956 12:3297656-3297678 TCCTGCAGGGCCTGGAGGTGGGG - Intergenic
1091829482 12:3539569-3539591 ACCTCCTCTGCCTGGAGTGCAGG - Intronic
1092487456 12:8914686-8914708 TCCTCCCCTTCCTGGAGGGGCGG - Exonic
1092511940 12:9166013-9166035 TCCTCCATTTGCTGGAGGGGAGG - Intronic
1092833112 12:12464253-12464275 TGCTTGAGTGCCTGCAGGGCAGG - Intronic
1094496348 12:30991779-30991801 TGCTCCAGGGCCCTGAGGGCCGG + Intronic
1096399287 12:51291780-51291802 CCCTCCAGAGGCTGTAGGGCTGG + Exonic
1096504206 12:52082409-52082431 GAGTCCAGTGCTTGGAGGGCAGG + Intergenic
1096580244 12:52580426-52580448 TCCTGAAGTGGCTGGAGGGGAGG - Intergenic
1096946716 12:55414955-55414977 TCCTCCCCTTCCTGGAGGGGCGG + Intergenic
1097048590 12:56206303-56206325 CCCTTCAGTGCCAGAAGGGCAGG + Exonic
1101841058 12:108327895-108327917 TCCTCCATGTCCTGGAAGGCTGG - Intronic
1102050413 12:109857762-109857784 CCCTGCTGTTCCTGGAGGGCAGG - Intronic
1103504594 12:121433327-121433349 TCCTCCACAGGCTGGCGGGCGGG - Intronic
1103749687 12:123150603-123150625 TCCTCCAGCCCCCGGCGGGCTGG + Intergenic
1103921144 12:124399757-124399779 TCCCGCAGTGGCTGGAGGGCTGG + Intronic
1103936832 12:124481476-124481498 CCCTCCAGGGCCTGCATGGCAGG - Intronic
1106720168 13:32428075-32428097 TCCTCCATGGGCAGGAGGGCTGG + Exonic
1109255498 13:60075749-60075771 TCCTCCATTACCTTCAGGGCTGG + Intronic
1113467924 13:110525092-110525114 CCCTGCAGTGCCTGGAGTGTGGG + Intronic
1117723115 14:58646388-58646410 TTCTCCAGCCCCTGGAGGGCTGG - Exonic
1118255434 14:64201390-64201412 TCCCACAGGGCCTGGTGGGCAGG - Intronic
1118287315 14:64487647-64487669 TCCTCCAGGGCCTGGGTGGCAGG + Exonic
1118887739 14:69880313-69880335 TCTTCCAGTGCCTGCCCGGCAGG - Intronic
1119658771 14:76436069-76436091 TCATCCAGGGCCTGGAGGTGGGG + Intronic
1121690782 14:95876202-95876224 AGCTCCAGTGCGGGGAGGGCCGG - Intergenic
1122094947 14:99363885-99363907 TCCTCCCGGGCCTGGTGCGCTGG + Intergenic
1122198364 14:100106932-100106954 TCCTCCAGTGCCTGGAAGTGTGG + Intronic
1122246675 14:100408005-100408027 GCCCCCAGTGCCTGGTGTGCAGG - Intronic
1122804171 14:104248281-104248303 TCCCCCAGGGCCTGGAGGCCTGG - Intergenic
1123029568 14:105445313-105445335 ACCTGCAGTCCCTGGACGGCAGG + Intronic
1124493624 15:30173475-30173497 TCCTCCCCAGCCTGGAGGCCCGG + Intergenic
1124749944 15:32365174-32365196 TCCTCCCCAGCCTGGAGGCCCGG - Intergenic
1125891939 15:43273591-43273613 TCCCCCAGGGCCTGGAACGCTGG - Intergenic
1129728323 15:77915415-77915437 GCCCCCAGTTCCTGGGGGGCTGG + Intergenic
1129913886 15:79250804-79250826 ACATCCAGTGTCTGGAGGCCAGG - Intergenic
1131668535 15:94595617-94595639 TTTTCCAGTGTCTAGAGGGCTGG - Intergenic
1132681485 16:1144271-1144293 TCCTCCAGGGCCTGGATGAGAGG + Intergenic
1132720136 16:1311697-1311719 TCCTTCAGTGTCTGGAGCACTGG + Intronic
1132854348 16:2038137-2038159 GCCCCCAGTACCTGGTGGGCAGG - Exonic
1133956317 16:10446935-10446957 ACCTCCAGTGGTTGGGGGGCAGG - Intronic
1134694276 16:16211667-16211689 TCCTCAAGTGCCTTGTGAGCTGG + Intronic
1135607755 16:23837632-23837654 TCTTCCAGAGCCGGGAAGGCAGG - Intronic
1136401909 16:30023913-30023935 TCCTCCAGACCCTGGCGGGGAGG - Intronic
1136610544 16:31362705-31362727 TCCTCCATTGCCTGGACACCTGG - Exonic
1136618118 16:31410830-31410852 TCCTCCATTGCCTGGACACCTGG - Exonic
1137668896 16:50267838-50267860 TCCTGCACTTCCTGCAGGGCTGG - Intronic
1138450784 16:57092584-57092606 TCCTCCCGGGCCGGGCGGGCGGG - Exonic
1138578422 16:57923518-57923540 TCCTCATTTGCCTGGAGGGAGGG + Intronic
1138689730 16:58756111-58756133 TCCTCCAGTTCCTGGATGTGTGG + Intergenic
1139482335 16:67237372-67237394 GCCGCCAGCGTCTGGAGGGCGGG + Exonic
1139751983 16:69114488-69114510 TCCAGCAGTTCCTGGAGGACTGG + Exonic
1140041927 16:71413852-71413874 TCCTGCACTGCCTGGACTGCAGG - Intergenic
1140116295 16:72044291-72044313 TCCTAAAGTACCTGCAGGGCTGG + Intronic
1140913033 16:79470488-79470510 ACCACAAGTTCCTGGAGGGCAGG + Intergenic
1142167514 16:88600383-88600405 TCCTCCAGGGCATTGATGGCTGG + Intronic
1142305823 16:89284900-89284922 TCCGCCAGTGCTTGGTGTGCTGG + Exonic
1143465135 17:7131422-7131444 ACCTCCAGGGCATGGAAGGCCGG + Intergenic
1143579467 17:7817278-7817300 TCCTCCAGGCCCTGGCGGACAGG - Exonic
1145038172 17:19555802-19555824 CCCTCGAGTGCCTGCAGGACTGG + Exonic
1145997435 17:29112722-29112744 TCCTCCAGCCCCTGAAGGCCAGG - Intronic
1146441232 17:32896889-32896911 TGCTCTAGAGCCTGTAGGGCTGG + Intergenic
1147189441 17:38730266-38730288 TCTTCCGGGGCCTGGCGGGCCGG + Exonic
1147424113 17:40337568-40337590 TCCTTCAGTGTCTGGAGATCGGG - Intronic
1148044527 17:44734726-44734748 TCGTCCTGTGCCTGGATGCCAGG - Intronic
1148206363 17:45782831-45782853 GCTCACAGTGCCTGGAGGGCTGG - Intergenic
1148804570 17:50257718-50257740 CCCTGCAGTGCATGGAGGGAGGG - Intergenic
1148957973 17:51369802-51369824 TCCTGCAGTGAATGGAGGCCTGG - Intergenic
1150214542 17:63459426-63459448 TCACCCAATGCCTGGGGGGCAGG + Intergenic
1150754772 17:67901857-67901879 TCCTCCAGTGGTGGGATGGCTGG - Intronic
1151376918 17:73695500-73695522 CTATCCAGAGCCTGGAGGGCTGG + Intergenic
1151459257 17:74245080-74245102 TCGTCCAGTGACTTGGGGGCTGG + Intronic
1151659113 17:75509351-75509373 TCCACCAGAGCCTGGGGGGCAGG - Intronic
1151715307 17:75828055-75828077 TCCTGCAGCTGCTGGAGGGCCGG - Exonic
1152445005 17:80337339-80337361 TCCTCCAGTGCCTGGTGCCCCGG - Intronic
1152656824 17:81523712-81523734 TCCTCCGATGCCTGCAGGGAGGG + Intronic
1152659004 17:81533893-81533915 TCCTTCAGTGCCCGCAGGGACGG + Intronic
1152686027 17:81694244-81694266 TCCTTCAGTTCCTGTGGGGCGGG - Intronic
1157194165 18:45606931-45606953 TCCCTCAGTTCCTGGAGGGCAGG + Intronic
1157862301 18:51152238-51152260 TGCTCCACTGCCTTGGGGGCAGG - Intergenic
1159014347 18:63089173-63089195 TCCCCGAGTTCCTGGAGGGCAGG - Intergenic
1159045070 18:63361927-63361949 TCCTCAAATGGGTGGAGGGCTGG - Intronic
1160414332 18:78697516-78697538 ATCTCCAGTGCCTGGAGGGGTGG - Intergenic
1160537699 18:79603817-79603839 TTTTCCAGGGCCTGCAGGGCTGG + Intergenic
1160685687 19:435536-435558 TCCTCCAATGGTGGGAGGGCAGG - Intronic
1160745889 19:710440-710462 TCCTCCGGGGCCTGGCGAGCAGG - Intronic
1160981896 19:1820047-1820069 TCGTTCAGTGCCTGGGGGACAGG + Exonic
1161704853 19:5814883-5814905 ACCTGCATTGCCTGGAGGGAGGG - Intergenic
1163321752 19:16578612-16578634 TCCTCCAGTGTGTGGTGTGCGGG + Intronic
1164160433 19:22622938-22622960 TGTCCCGGTGCCTGGAGGGCAGG + Intergenic
1165495517 19:36150302-36150324 TCCTCCTGGGCCTGGCAGGCTGG - Exonic
1166748311 19:45152406-45152428 CGCTGCAGTGCCTGGAGGACCGG - Exonic
1167233003 19:48297199-48297221 TCCACCAGTGCCTCGAGTGGGGG - Exonic
1167372481 19:49091677-49091699 TCCTCCAAATCCTGGAGTGCAGG + Intronic
1167456219 19:49597729-49597751 TCCCCCAGTGGCGAGAGGGCCGG - Exonic
1167810844 19:51828883-51828905 CCCTGCAGCTCCTGGAGGGCAGG + Intergenic
1168241643 19:55091863-55091885 CTCTCCAGTTCCAGGAGGGCTGG + Exonic
1168666764 19:58210244-58210266 TGCCACAGTGGCTGGAGGGCAGG - Intronic
924995779 2:359188-359210 TCATCCACAGCCTGGAGAGCAGG - Intergenic
925000779 2:401266-401288 TCCTCCACAGCCTGGAGGCAGGG - Intergenic
925002453 2:416331-416353 TCCGCCAGTGCTGGGGGGGCTGG + Intergenic
925224078 2:2167453-2167475 AACGCCAGTGCCTGGAGGACAGG - Intronic
927149553 2:20187802-20187824 TCCTCTAGTGGCTGGCGGGGAGG - Intergenic
927519270 2:23689334-23689356 TCCTCCTGTGCCTGGTGGCCAGG + Intronic
928012963 2:27628346-27628368 ACCTTCAGTGACTGGAGGGGAGG + Intronic
928132090 2:28659829-28659851 TTCTCCAGTGCTTGGAGGCCAGG - Intergenic
928325869 2:30319118-30319140 TCCTCCAGGGACAGGAGGCCTGG + Intronic
929444169 2:41989874-41989896 TCCTCCTGAGCCTGGAAGGCTGG + Intergenic
929553077 2:42906560-42906582 TCTTCCTGTGCCTGTGGGGCGGG + Intergenic
930046352 2:47176220-47176242 TCCTCTAGTGAGTTGAGGGCCGG - Intronic
931621657 2:64216667-64216689 TCCTCCAGTGCCTGGTTGTGTGG + Intergenic
932101201 2:68900737-68900759 TCCTCCACTGCCTGGAGTTAGGG - Intergenic
933726530 2:85430526-85430548 TCCTCCTGGGCCTGGAGGAAGGG - Intronic
934149781 2:89135204-89135226 TCCTCCATTTCCTGCAGGTCTGG - Intergenic
934217516 2:90046827-90046849 TCCTCCATTTCCTGCAGGTCTGG + Intergenic
934737643 2:96698064-96698086 TCCTGCAGGCCCTGGAAGGCTGG - Intergenic
935526773 2:104180692-104180714 GGCACCAGTGCCTGGAGTGCTGG + Intergenic
936360642 2:111797849-111797871 TCCTCCAGTGTCTTGAGGTCAGG - Intronic
937226933 2:120375502-120375524 TTCTCCAGCCCCTGGGGGGCGGG - Intergenic
938288272 2:130136292-130136314 TGCTCCAGGGCCTGGTGGCCAGG + Intergenic
938427309 2:131202604-131202626 TGCTCCAGGGCCTGGTGGCCAGG - Intronic
938468256 2:131536652-131536674 TGCTCCAGGGCCTGGTGGCCAGG - Intergenic
942246723 2:174014752-174014774 TCCTCCAGTGACACTAGGGCTGG - Intergenic
942452449 2:176116651-176116673 TGCTCCAGAGCCTGGCCGGCCGG - Exonic
944667929 2:201972325-201972347 TCCTCCTGTCCCTGGGAGGCAGG + Intergenic
945134176 2:206608710-206608732 CCATCCAGTGCTTGGTGGGCAGG - Intronic
946315142 2:218906485-218906507 TTCCCCAGTGTCTGGTGGGCTGG + Intergenic
947031966 2:225806604-225806626 TCCTCCTTTGCCTGGAGGTGGGG - Intergenic
947582109 2:231326700-231326722 ACCTCCTGGGCCTGGAAGGCAGG - Intronic
947793160 2:232879154-232879176 TCTTCCAGTCCCTGGGGGCCAGG + Exonic
948729951 2:239956535-239956557 GCCTCCCGTGCTTGGAGGACTGG + Intronic
948937580 2:241177697-241177719 ACATCCAGGGCCTGGAGGGTGGG + Intronic
1168801441 20:645899-645921 TCCTCCTGTGCCCGCTGGGCTGG - Intergenic
1168810125 20:699703-699725 CCTGCCAGTCCCTGGAGGGCAGG + Intergenic
1169332657 20:4729056-4729078 TCTGCCAGAGCCTGGAGGGGAGG - Intergenic
1169575592 20:6956636-6956658 TCCTTCAGTGCGTGGTGGGTGGG + Intergenic
1172014256 20:31863551-31863573 ACCTCCAAGGCCTGGAGGGGAGG + Intronic
1172668207 20:36615236-36615258 TCCACCAGGGCCTGGAGTGAGGG + Exonic
1172759831 20:37314249-37314271 TCCACCAGTGGGAGGAGGGCCGG + Intronic
1174576549 20:51541874-51541896 CACTTCAGTGCCTGGAGGGAAGG + Intronic
1174757130 20:53170576-53170598 TCATCCAGTGGGTGGAGGCCGGG - Intronic
1175442627 20:59002168-59002190 TCCCCCAGTGCCTTCGGGGCTGG - Intronic
1176109895 20:63406433-63406455 TCCAACAGGGGCTGGAGGGCTGG - Exonic
1176141253 20:63546112-63546134 TTCAGCAGTTCCTGGAGGGCAGG - Intronic
1176215628 20:63946379-63946401 CCCTCCAGTGCCTGTGGAGCAGG - Intronic
1176219372 20:63962771-63962793 TCCTCAGGGGGCTGGAGGGCAGG + Exonic
1179835949 21:44033600-44033622 TCCTACAGTGTCTGGATGACAGG - Intronic
1180600561 22:17012641-17012663 TCCTCCAGTGGCAGGTAGGCAGG - Intergenic
1181009775 22:20033332-20033354 GCCACTGGTGCCTGGAGGGCTGG + Intronic
1181275013 22:21682677-21682699 TGCTTCAGCGCCTCGAGGGCAGG + Intronic
1182828266 22:33284129-33284151 TCCTTCTGTGCCTGGCTGGCAGG - Intronic
1183742572 22:39677166-39677188 CCCTACAGGACCTGGAGGGCAGG - Intronic
1184451504 22:44585541-44585563 CCCTCCATGGCCTGCAGGGCAGG - Intergenic
1184689078 22:46109333-46109355 ACCTCCAGAGCCAGGATGGCAGG - Intronic
1184850069 22:47114988-47115010 ACCTCCAGGGCCTGCTGGGCAGG + Intronic
1185241524 22:49749960-49749982 TCCGGCAGGGCCTGCAGGGCAGG + Intergenic
1185310176 22:50149999-50150021 CCGTTCAGTGCCTGGAGGGGCGG + Intronic
950575649 3:13830582-13830604 TCCCACAGGGACTGGAGGGCAGG + Intronic
952321810 3:32284680-32284702 TACTCCAGTACCTGGAAGCCAGG + Intronic
953393371 3:42547167-42547189 TCCTTCTATGCCAGGAGGGCTGG - Intergenic
954432366 3:50477746-50477768 ACCTCCAGAGGCTGGGGGGCTGG - Intronic
955513744 3:59706764-59706786 TCCTCCAGTGCCTACAGCTCTGG - Intergenic
959533875 3:107464320-107464342 CCCTCTATTGCCTGGAGGGGTGG + Intergenic
961004865 3:123398166-123398188 TCTCCCAGTACCTGGAGGTCAGG + Intronic
961450930 3:127002014-127002036 TCCTGCTGTGGCTGCAGGGCAGG + Intronic
961468488 3:127096552-127096574 TGCAGCAGTGCCTTGAGGGCAGG - Intergenic
965432490 3:168606581-168606603 TCCTCCAGCTCCTGAGGGGCTGG + Intergenic
966220259 3:177544490-177544512 CTCCCCAGTGCCTGGAGGCCTGG + Intergenic
968147646 3:196312715-196312737 TCCCACAGTGCCTGGATTGCAGG + Intronic
968844258 4:3031183-3031205 TCCTCCAGTGACCGGAGAGGAGG + Intronic
968956370 4:3721800-3721822 TCCTCCCGGGCGTGGAGAGCAGG - Intergenic
969375654 4:6761717-6761739 TCCTTCAGTGGCGGGAGGCCAGG - Intergenic
969414681 4:7050641-7050663 TGCTCCGGAGCCTGCAGGGCTGG + Intronic
969461627 4:7332163-7332185 TCCTTCAGTGCCAGGAGCTCAGG + Intronic
975061319 4:70005145-70005167 TCCTACTGTTCCTGGAGGGAAGG + Intergenic
976168098 4:82276209-82276231 CCCTCCAGAGGCTGGAGGGCTGG - Intergenic
976227828 4:82810466-82810488 TCCTCCAGTCCCAGGAGGGTTGG + Intergenic
976597618 4:86908841-86908863 CCCACCTGTGCCAGGAGGGCTGG - Intronic
980002620 4:127508295-127508317 TCCACCACTGGGTGGAGGGCTGG - Intergenic
985547350 5:516330-516352 TCCTCCATTGCCCAGAGCGCTGG + Intronic
986596743 5:9430504-9430526 GACTCCAGTGCTTGGATGGCAGG + Intronic
987179423 5:15351503-15351525 TACTCTAGTGCCAGGAAGGCAGG - Intergenic
992349158 5:75911477-75911499 CCCTCCAGAGGCTGGAGGACTGG - Intergenic
993042211 5:82827078-82827100 TCCTCCAGGGCCTGGAGGAGAGG + Intergenic
993505382 5:88702583-88702605 TCCTGCAGTGCCTGAACAGCAGG - Intergenic
996888889 5:128393283-128393305 TCCCCCAGTGCCTCCAGGTCTGG + Exonic
997879900 5:137580228-137580250 CCCTCCAGCCCCTAGAGGGCAGG - Intronic
998271579 5:140711136-140711158 TCCTCAATTGTCTGGAGGTCGGG + Intergenic
998382048 5:141732581-141732603 TCCATCAGTCCCTTGAGGGCAGG + Intergenic
998399418 5:141840753-141840775 ACCTACTATGCCTGGAGGGCTGG - Intergenic
1000244252 5:159436313-159436335 TCTTCCAAATCCTGGAGGGCTGG - Intergenic
1001038818 5:168317363-168317385 TCCTCCAGTGCCTGAATTCCAGG - Intronic
1001679666 5:173546985-173547007 AGCTCTGGTGCCTGGAGGGCAGG - Intergenic
1001797252 5:174513010-174513032 TCCCCTGGTGCCTGGAGGTCAGG - Intergenic
1002042923 5:176527799-176527821 TCCTCCAGAACTTGGAGGACAGG + Exonic
1003278290 6:4671050-4671072 TCCTCCACTGCCTGGGGGCAAGG + Intergenic
1003476741 6:6490610-6490632 TCCTCCAGTGGCTCCAGGGAAGG - Intergenic
1004881602 6:20013807-20013829 TCCTCCCGTGGCTGGAGCTCAGG - Intergenic
1006732310 6:36245572-36245594 TGCAGCAGTGCCTGGAAGGCAGG - Intronic
1007286865 6:40754296-40754318 TGCTCCAGGGCCTTGAGGGTAGG + Intergenic
1007312903 6:40960960-40960982 TCCTCCACTGCCTGGATGGTGGG - Intergenic
1007350281 6:41268256-41268278 TTCTCCAGTTCCTGGAGAGAAGG + Intronic
1007810828 6:44484630-44484652 TGATCGAGTGGCTGGAGGGCGGG + Intergenic
1009975692 6:70668251-70668273 TCCTGCCCTGACTGGAGGGCGGG + Intronic
1013273221 6:108560958-108560980 TCCTCCTGTTCCTGGGAGGCGGG + Exonic
1013316984 6:108952503-108952525 TCATCTAGTGCGTGGAGGCCAGG + Intronic
1016982338 6:149864433-149864455 TCCTCCAGGGCTGGGAGAGCAGG + Intergenic
1017153904 6:151305909-151305931 CCTTCCAGTTCCTGGAGGGGCGG - Intronic
1017953456 6:159158275-159158297 TCCTTCAGTCCCTGGATGGGGGG + Intergenic
1019309474 7:353180-353202 TTTTGCAGGGCCTGGAGGGCGGG + Intergenic
1019346385 7:532888-532910 TTCTCTTCTGCCTGGAGGGCCGG - Intergenic
1019429219 7:991027-991049 CCCTGCAGGGCCGGGAGGGCGGG - Intergenic
1019897198 7:3991669-3991691 TCCTTCAGAGCCTGGAGTGTGGG + Intronic
1023856504 7:44187400-44187422 TCTTCTAGTGCCTGGATCGCAGG - Intronic
1026994586 7:74607039-74607061 TCCCCCAGTCCCTGGAGGCCTGG + Intergenic
1027239484 7:76318034-76318056 CTCCCCAGTGGCTGGAGGGCGGG + Intergenic
1028999561 7:97139037-97139059 CCCAGCAGTGCCTCGAGGGCTGG + Intronic
1029283147 7:99449581-99449603 CCCTCCAGTGCCTGGAAAGGGGG - Intronic
1034498506 7:151435767-151435789 TCCTCCAGGGCCTTATGGGCTGG - Intronic
1035305688 7:157929830-157929852 ACCTCCAGTGCCTGGTGTCCCGG - Intronic
1035377674 7:158416152-158416174 TCCTCCAGTGCATGGGGCCCAGG - Intronic
1035407802 7:158611176-158611198 TATTCCAGGGCCTGGAAGGCAGG + Intergenic
1036011595 8:4731341-4731363 TGCTCCAGTCCCTGAATGGCCGG - Intronic
1037678909 8:21076728-21076750 TCCCCAAGTTCCTTGAGGGCAGG + Intergenic
1038443213 8:27585965-27585987 TCTTGCAGTGCCTTGTGGGCTGG + Intergenic
1038455695 8:27670906-27670928 TCCTCTTGGTCCTGGAGGGCCGG - Exonic
1039467872 8:37796984-37797006 GCCTCCAGTGTCCCGAGGGCCGG + Intronic
1041317091 8:56575313-56575335 TCCTCCCCTTCCTGGAGGGCAGG + Intergenic
1042485099 8:69339243-69339265 TCCCACAGTGCCTGAGGGGCTGG - Intergenic
1043511969 8:80958772-80958794 TCCTCCAGTTCCTGGTGGATAGG + Intergenic
1043735657 8:83739856-83739878 TCTTCCAGTTTCTGGTGGGCAGG + Intergenic
1044467350 8:92523222-92523244 TCATCCAGTGCCTGGGGGTATGG - Intergenic
1045300096 8:100903493-100903515 TCCTGCAGTGCCTGGGGAGGAGG - Intergenic
1046804348 8:118463556-118463578 TCTTCCAGTTCCTGCAAGGCTGG - Intronic
1048276250 8:133068214-133068236 TCCTGCAGGGCATGGAGTGCTGG - Intronic
1048859888 8:138716369-138716391 ATCTCCAGTTCCTGGAGAGCAGG - Intronic
1048967177 8:139623661-139623683 CCCTGTAGTGCCTGGAGGGTAGG - Intronic
1049292556 8:141812386-141812408 GCCTCCAGGGCGGGGAGGGCGGG + Intergenic
1049311252 8:141935047-141935069 TCCTCAAGTGCCACGAGGGAGGG - Intergenic
1049540910 8:143208354-143208376 CCCTGCAGTCCCTGGAAGGCAGG - Intergenic
1049598634 8:143496936-143496958 TTCTCCAGTGCAGGAAGGGCTGG - Intronic
1055134250 9:72808816-72808838 TCATCCAGAGACTAGAGGGCAGG - Intronic
1055878815 9:80974222-80974244 TTCTCCTGTACCTGGAGGTCAGG - Intergenic
1056235881 9:84593756-84593778 ACCTCCACTGCCTAGAGAGCTGG - Intergenic
1057008345 9:91580790-91580812 TCCTCCAATGCCTCGAGGCTGGG - Intronic
1057314587 9:93960334-93960356 CCGTCCAGGGCCTGGAGGGCTGG - Intergenic
1057567951 9:96181540-96181562 TCCTGCAGAGGCTGCAGGGCAGG - Intergenic
1059336525 9:113572553-113572575 TCCTTCAGGGCCTGCAGCGCTGG - Intronic
1059344035 9:113616268-113616290 TCCTCCAGAGCCTGGAGCCTGGG - Intergenic
1059469763 9:114495862-114495884 TCCTCCTGTCCCTGGACGGAGGG - Intronic
1060225348 9:121786840-121786862 TCCTGCAGTGCTTGGTGGCCTGG - Intergenic
1060488319 9:124063437-124063459 CCCTCCTGGGCCAGGAGGGCAGG + Intergenic
1061015211 9:127977422-127977444 GGCTCCAGGGCCTGGAGGCCAGG + Intronic
1061135198 9:128729730-128729752 TGCTCCAGAGCCTGGAAGCCAGG + Intergenic
1061390192 9:130313362-130313384 TCCACCAGTGCCTCGCAGGCTGG - Intronic
1061674538 9:132208345-132208367 TCCTCCCGGGGCTGCAGGGCTGG - Intronic
1062001486 9:134218085-134218107 GCCATCAGTGTCTGGAGGGCTGG + Intergenic
1062034954 9:134378845-134378867 GCCTCTGGAGCCTGGAGGGCAGG + Intronic
1062400452 9:136370391-136370413 TCCTCCAGTACCTGGATGTAGGG + Exonic
1187419641 X:19122798-19122820 TCCCGCAGTGCCTGGAGCCCAGG - Intergenic
1190143142 X:47865596-47865618 TCCTCCACTGCCTGTTGGGTTGG + Intronic
1191659687 X:63636611-63636633 TCCTCCTGTGCTAGGATGGCAGG + Exonic
1193352234 X:80477004-80477026 GCCACTAGTGCCTGGAGTGCTGG + Intergenic
1199765240 X:150936596-150936618 TCTTACAATGCCAGGAGGGCAGG - Intergenic
1200063470 X:153494105-153494127 TCCTCCAGTGGCTAGAGCCCAGG - Intronic