ID: 1084598642

View in Genome Browser
Species Human (GRCh38)
Location 11:70132071-70132093
Sequence GGAGCCCTGCTTACCCCAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 195}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084598642_1084598651 23 Left 1084598642 11:70132071-70132093 CCCTCTGGGGTAAGCAGGGCTCC 0: 1
1: 0
2: 2
3: 19
4: 195
Right 1084598651 11:70132117-70132139 GGTGAGTCTGAGTGGTACCTAGG 0: 1
1: 0
2: 2
3: 6
4: 123
1084598642_1084598650 15 Left 1084598642 11:70132071-70132093 CCCTCTGGGGTAAGCAGGGCTCC 0: 1
1: 0
2: 2
3: 19
4: 195
Right 1084598650 11:70132109-70132131 TGGGCAGTGGTGAGTCTGAGTGG 0: 1
1: 0
2: 1
3: 25
4: 349
1084598642_1084598647 -4 Left 1084598642 11:70132071-70132093 CCCTCTGGGGTAAGCAGGGCTCC 0: 1
1: 0
2: 2
3: 19
4: 195
Right 1084598647 11:70132090-70132112 CTCCAGAGCACTGGGTTTTTGGG 0: 1
1: 0
2: 1
3: 30
4: 397
1084598642_1084598646 -5 Left 1084598642 11:70132071-70132093 CCCTCTGGGGTAAGCAGGGCTCC 0: 1
1: 0
2: 2
3: 19
4: 195
Right 1084598646 11:70132089-70132111 GCTCCAGAGCACTGGGTTTTTGG 0: 1
1: 0
2: 1
3: 22
4: 183
1084598642_1084598649 2 Left 1084598642 11:70132071-70132093 CCCTCTGGGGTAAGCAGGGCTCC 0: 1
1: 0
2: 2
3: 19
4: 195
Right 1084598649 11:70132096-70132118 AGCACTGGGTTTTTGGGCAGTGG 0: 1
1: 0
2: 3
3: 23
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084598642 Original CRISPR GGAGCCCTGCTTACCCCAGA GGG (reversed) Exonic
900013501 1:134590-134612 GCACCCCTTCTTTCCCCAGAGGG + Intergenic
900043569 1:490573-490595 GCACCCCTTCTTTCCCCAGAGGG + Intergenic
900065007 1:725576-725598 GCACCCCTTCTTTCCCCAGAGGG + Intergenic
901221288 1:7585457-7585479 GGAGCCCAGCCTACTCCAGTGGG + Intronic
901797737 1:11690665-11690687 GGAGCGCTGCTTCCCACATATGG + Intronic
901870254 1:12134693-12134715 GGAGCCCTTCTGACTCCAGCTGG - Intronic
903450741 1:23452191-23452213 GGAGCCGTGCTCCCCCAAGAGGG - Intronic
906666744 1:47627441-47627463 TCAGCCCTGCTTATCCCTGAGGG + Intergenic
912541515 1:110419928-110419950 AGAGCCCTGCTGACCCCAAGAGG + Intergenic
914308129 1:146441566-146441588 GGAGCCCTGGCTACAACAGAAGG - Intergenic
914593977 1:149131567-149131589 GGAGCCCTGGCTACAACAGAAGG + Intergenic
915129240 1:153685821-153685843 GGCTCCCTGCTAACCACAGAGGG + Exonic
916193872 1:162205145-162205167 GAAGCCCTGTGAACCCCAGATGG + Intronic
919813692 1:201424683-201424705 GGAGGCCTGCTTCCCCCTGCAGG - Intronic
922099908 1:222471591-222471613 GCACCCCTTCTTTCCCCAGAGGG + Intergenic
922261940 1:223951083-223951105 GCACCCCTTCTTTCCCCAGAGGG + Intergenic
922291352 1:224211412-224211434 GGAGCCCTGCTTATCTCTGCTGG - Intergenic
922889262 1:229047677-229047699 GGGGCCTTGCTTACCCTAGAGGG - Intergenic
923105694 1:230851656-230851678 GGAGGCCTGCCTGTCCCAGAAGG - Intronic
923312769 1:232751926-232751948 GGAGCCCTGCGTTCTGCAGACGG - Intergenic
924292070 1:242546887-242546909 GCAGCCTTGCTTAACCCTGAGGG - Intergenic
924343110 1:243053260-243053282 GCACCCCTTCTTTCCCCAGAAGG + Intergenic
924738987 1:246783646-246783668 GAAGCCCTGCTTTCCTCAGGAGG - Intergenic
1064632234 10:17328374-17328396 CCTGGCCTGCTTACCCCAGAAGG + Intronic
1066733378 10:38452314-38452336 GCACCCCTTCTTTCCCCAGAGGG - Intergenic
1067151113 10:43735615-43735637 GGGGCCTTGCTGACCCCAAAGGG - Intergenic
1069854915 10:71434785-71434807 GGAGACTTGCTCACCCCTGATGG + Intronic
1075175910 10:120160871-120160893 GGACCCCAGCTCAGCCCAGAGGG + Intergenic
1076823597 10:132955666-132955688 GGTGCCCTGCTCACTGCAGAGGG + Intergenic
1076969841 11:126804-126826 GCACCCCTTCTTTCCCCAGAGGG + Intergenic
1077288781 11:1779333-1779355 GGGGCCCTGCCTTCCCCAGCAGG - Intergenic
1077767008 11:5169875-5169897 AGAACCCTGCTTACCTCTGATGG - Intronic
1077884276 11:6374459-6374481 GAAGCCCTGCTGGCCCCAGCTGG - Intergenic
1078363371 11:10687429-10687451 AGAGCCCTACTTTCCCCAGTGGG + Intronic
1078702627 11:13702874-13702896 GTAGCCTTGCTTACCCTAGGGGG - Intronic
1081488235 11:43547832-43547854 GGAACCCTGCTTAGGCCGGAGGG - Intergenic
1082124456 11:48415680-48415702 GGAGGCCTCCTTGCCCCTGAAGG - Intergenic
1082577933 11:54832833-54832855 GGAGGCCTGCCTACCTCAGTAGG - Intergenic
1083855055 11:65389229-65389251 GTAGCCCTGGTCACCCCTGAGGG + Intronic
1084598642 11:70132071-70132093 GGAGCCCTGCTTACCCCAGAGGG - Exonic
1086942981 11:92817132-92817154 GCTGCCCTGCTTATCTCAGATGG - Intronic
1086984620 11:93234435-93234457 GGGGTCATGCTTACCCCAGGTGG + Intergenic
1088375233 11:109133552-109133574 TGAGCACTGCTTCCTCCAGAGGG - Intergenic
1089583821 11:119497554-119497576 GGATCCCTGCTGAGCCCAGAAGG - Intergenic
1090362419 11:126182857-126182879 GGAGTGCTGCTCACCCCAGGAGG - Intergenic
1090841198 11:130488668-130488690 GGAGCCCTGCTTCCGCTAGAGGG - Intergenic
1097107061 12:56632198-56632220 AGAGCCCTCCTTTCTCCAGAAGG - Intronic
1100764411 12:97847688-97847710 GGAGCCCTACTTACACCATCAGG + Intergenic
1101574061 12:105981128-105981150 AGAGCCCTGTTTGCTCCAGAGGG - Intergenic
1101600381 12:106204562-106204584 GCAGCCCTGCATACCACAAAGGG + Intergenic
1102470061 12:113154723-113154745 GGGGCAATGCTTACCCCAGAGGG + Intronic
1104040528 12:125127274-125127296 GGAGCCCTGCTCAACCTTGATGG + Intronic
1112299819 13:98219753-98219775 GGAGGCCCGCTGAGCCCAGAAGG - Intronic
1113535727 13:111064873-111064895 GGGTCCCTGCTTAGCCCTGAAGG - Intergenic
1115415638 14:33129954-33129976 GGAGCCATGCTAAACACAGATGG - Intronic
1116513983 14:45784332-45784354 AGAGCACTGCTTGTCCCAGATGG + Intergenic
1118373454 14:65157105-65157127 GGGGCCCTACTGACCCCAGAGGG + Intergenic
1120868465 14:89316293-89316315 GGAGCCCAGCTAACACCACAAGG + Intronic
1122721418 14:103724547-103724569 GGCCCCCTCCTTCCCCCAGAAGG + Intronic
1122962261 14:105100435-105100457 GGAGGACTGCTGAGCCCAGAAGG - Intergenic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1128577684 15:68787598-68787620 GCTGCCCGGCTTTCCCCAGACGG + Intronic
1129466483 15:75727109-75727131 GGAGCCCTGCGTTCCCCCGGTGG - Exonic
1130701949 15:86193139-86193161 GGAACCCTCTTCACCCCAGATGG + Intronic
1131357387 15:91757607-91757629 TGGGCACTGCCTACCCCAGAGGG + Intergenic
1132824788 16:1898846-1898868 GGTGGCCTGCTTTCTCCAGAAGG - Intergenic
1133192912 16:4147532-4147554 GGACTCTTGCTTTCCCCAGAAGG - Intergenic
1134539730 16:15055319-15055341 AGAGCCCTGCTTTCCGCAGCTGG - Intronic
1136535959 16:30899628-30899650 GGAGCCCTGATTTCCACAGTTGG - Intronic
1138025616 16:53520215-53520237 GGCACGCTGCTTACCTCAGAAGG - Intergenic
1138427458 16:56945565-56945587 AGAGTCCTGCTTGCCCCAGTGGG - Intergenic
1141134829 16:81458400-81458422 GGTGCCCTGCTTACCACTGGGGG - Intronic
1141445045 16:84052224-84052246 GGAGCCCTGCTGTCCCTAGCAGG - Intergenic
1141991932 16:87615524-87615546 GGAGCCATGCTTTCCCCACAAGG - Intronic
1142450838 16:90172328-90172350 GCACCCCTTCTTTCCCCAGAGGG - Intergenic
1142456727 17:61363-61385 GCACCCCTTCTTTCCCCAGAGGG + Intergenic
1142737489 17:1910457-1910479 GCAGCCATGCTCCCCCCAGAAGG - Intergenic
1144946777 17:18973388-18973410 GGAACACTGCTGACCCCAGGTGG + Intronic
1148000212 17:44383457-44383479 GGAGCCCTACTTGCTGCAGAGGG - Intronic
1148498962 17:48074509-48074531 GGAGCCTTGCTGACCCCTGCTGG + Intronic
1151590879 17:75043846-75043868 TCAGTCCTGCTTGCCCCAGAGGG + Intronic
1152020996 17:77780172-77780194 GCACCGCTGCTTGCCCCAGACGG + Intergenic
1152345322 17:79747649-79747671 GGGGCCCTGCGCACCTCAGAAGG - Intergenic
1152400709 17:80064821-80064843 GCAGCCCTGCTTCCCCCAGCTGG + Intronic
1157600005 18:48887984-48888006 GGAGCCCTTCCTCCCCCACAAGG + Intergenic
1160646644 19:196722-196744 GCACCCCTTCTTTCCCCAGAGGG + Intergenic
1165476575 19:36034128-36034150 GGAGCCCTCTTTCCCTCAGAGGG + Intergenic
1165829232 19:38722320-38722342 GGAGCCCTGCTGCCCCTCGAGGG - Intronic
1166790911 19:45397991-45398013 GGAACCAGGCTTACCCTAGAAGG + Exonic
1167356252 19:49006095-49006117 GGACCCCTGGTGTCCCCAGATGG + Intronic
1168185362 19:54696798-54696820 AGAGCCTGGCTTAGCCCAGAGGG - Intronic
1168308218 19:55447661-55447683 GGGGCACTCCTTACCCCAAATGG - Intergenic
1168639237 19:58019827-58019849 TGAGCCCTGCAGAACCCAGAAGG + Intergenic
925012629 2:496974-496996 CGAGCTCTGCTGATCCCAGAAGG + Intergenic
927104356 2:19810885-19810907 GGAGCCCAGCTGGCCCCAGCTGG + Intergenic
927869303 2:26613588-26613610 GCAGCCCTGCCTACTTCAGAGGG - Intronic
928483447 2:31706704-31706726 GGAGTCCTGCCTAGCGCAGAAGG + Intergenic
928611145 2:32993658-32993680 GGAGTCCTGTTTTCCCCACACGG - Intronic
928964046 2:36959282-36959304 GTGGCTCTGCTTACCTCAGAAGG + Intronic
932685954 2:73870431-73870453 GGAGGCCTGCTAAGCCCAGATGG - Intronic
937454964 2:122033193-122033215 GTAGCCCTCCTTTCCCTAGAGGG - Intergenic
937979859 2:127608632-127608654 CCAGCCCTGCCTACCCCACAGGG - Intronic
938127394 2:128684488-128684510 GGAGCCCCACCTACCCCAGGAGG - Intergenic
942026269 2:171913606-171913628 GTAGGCCTGCTTATCACAGAAGG - Intronic
942394839 2:175536110-175536132 GGAATCCTGCTTACCCCATTAGG - Intergenic
944508482 2:200440415-200440437 GGAGACAAGCGTACCCCAGATGG + Intronic
947873924 2:233455757-233455779 GGAGCCATGCTGACACCTGAGGG + Intronic
948894236 2:240920924-240920946 GGGGCCCTGAGTACCCCACAAGG - Intronic
1169673841 20:8132633-8132655 GGAGCCCAGATGAGCCCAGATGG + Exonic
1171476164 20:25410650-25410672 GGAGAATTGCTTAACCCAGAAGG - Intronic
1172623949 20:36336876-36336898 GGAGCCCAGCAGACCCCAGAGGG + Intronic
1173177856 20:40777946-40777968 GGAGTCCTACTTACCCAAGGTGG - Intergenic
1173310168 20:41890213-41890235 CGAGCTCTGCTTCTCCCAGAGGG - Intergenic
1173827201 20:46055606-46055628 GGAGCCCTTCTGTCCCCAGCTGG - Intronic
1174404183 20:50292958-50292980 GCAGCCCTGATCACCCAAGACGG - Intergenic
1176140654 20:63543310-63543332 GCAGCCCTGCATGCCCCAGGTGG - Exonic
1176278862 20:64289500-64289522 GCACCCCTTCTTTCCCCAGAGGG - Intergenic
1178119091 21:29449963-29449985 GGACCTCAGCTTATCCCAGAAGG - Intronic
1179236560 21:39552402-39552424 GGAGCCTTGCTGACCCTGGACGG - Intergenic
1179920044 21:44503028-44503050 AGAGCCTTGCTTCCCCCCGAGGG - Intronic
1179920125 21:44503287-44503309 AGAGCCTTGCTTCCCCCCGAGGG - Intronic
1179920141 21:44503333-44503355 AGAGCCTTGCTTCCCCCCGAGGG - Intronic
1179920169 21:44503425-44503447 AGAGCCTTGCTTCCCCCCGAGGG - Intronic
1179920274 21:44503759-44503781 AGAGCCTTGCTTCCCCCCGAGGG - Intronic
1179920421 21:44504262-44504284 AGAGCCCTGCTTCCCCCTGAGGG - Intronic
1179967014 21:44813224-44813246 GGAGCCCTGCTTGCCTGAGTGGG - Intronic
1179976179 21:44868435-44868457 GGAGCCCTGCTTCCGGCTGATGG - Intronic
1180875894 22:19175161-19175183 GGAGCTGGGCATACCCCAGAGGG + Intergenic
1181181082 22:21068952-21068974 GCAGCCATGCTCACCCCTGAAGG - Intergenic
1181385124 22:22539239-22539261 TGAGCCCAGCTTAATCCAGAGGG - Intergenic
1181958933 22:26609168-26609190 GGGACCCTGCTCTCCCCAGAAGG + Intronic
1182959820 22:34461721-34461743 GGAGCCCTGCTGACCCAATCAGG - Intergenic
1184068024 22:42131125-42131147 GAAACCCTGGTTATCCCAGAAGG - Intergenic
1184444805 22:44540837-44540859 GGATCCCTCCTGACCCCAGTTGG - Intergenic
1184889216 22:47369244-47369266 GTAGCCCTGCAGACCCCAGCAGG - Intergenic
1184903923 22:47465927-47465949 AGTGCCCTGCTGACCCCTGAGGG - Intronic
1185082412 22:48717357-48717379 GGAGCCCTGCACATCCCAGGAGG + Intronic
1185103894 22:48856444-48856466 GGAGCCCTGCTTGCAGCAGACGG + Intergenic
949459494 3:4274969-4274991 GAAGCCCTGATCACACCAGAGGG + Intronic
950163193 3:10775058-10775080 GGGGCCCTGCTTACTTCAGAAGG - Intergenic
950583447 3:13878062-13878084 GGACCTCTCCCTACCCCAGAGGG + Intronic
950592524 3:13948506-13948528 GGAGCACTGCTTCCTTCAGAGGG + Intronic
950962246 3:17118987-17119009 GGAGGCCTGCTTTGGCCAGAGGG + Intergenic
954078228 3:48196611-48196633 TGAGCAATGCTTGCCCCAGAAGG + Intergenic
954614767 3:51964046-51964068 GGAGCCCTGCTGACCAGAGGGGG - Intronic
955572501 3:60323180-60323202 GGAGCCCTGCGTCCCCTTGAGGG - Intronic
959688211 3:109170461-109170483 GGAGCCTTGCTAACCCCAGAGGG - Intergenic
962100011 3:132332249-132332271 GCAGCCCTGTTTCCCCCAGAAGG + Exonic
962942918 3:140141895-140141917 GAAGCTGCGCTTACCCCAGAAGG + Intronic
968371037 3:198222800-198222822 GCACCCCTTCTTTCCCCAGAGGG - Intergenic
969407994 4:7007695-7007717 GGAACCCTGCTTCTCCCACAGGG + Intronic
969610416 4:8224937-8224959 GGAGCACTGCTGACACCTGAGGG - Intronic
969643200 4:8411490-8411512 GGAGCCCTCCTTACCCTCGCAGG - Intronic
971236748 4:24849289-24849311 TGAGCCCTCCTTTTCCCAGAGGG + Intronic
975512663 4:75210913-75210935 GGACCCATGGTTACCACAGAGGG - Intergenic
979259723 4:118635284-118635306 GCACCCCTTCTTTCCCCAGAGGG - Intergenic
979328654 4:119405337-119405359 GCACCCCTTCTTTCCCCAGAGGG + Intergenic
979931767 4:126640801-126640823 GGAGCCCTGCTTCTCCCAGGAGG - Intergenic
984786462 4:183571845-183571867 GGAGCCCTGCTTCCCCGGGACGG + Intergenic
987956728 5:24750308-24750330 GCAGCACTGCTTACCACAGCGGG + Intergenic
998174916 5:139895844-139895866 AGAGCCCAGCTTTCCCCAGTAGG - Intronic
998523893 5:142825278-142825300 GGACCCCTGCTTACTCAATAAGG - Intronic
999197477 5:149792242-149792264 GGAGCCCTGCTGGCTCCCGAGGG - Intronic
1002730274 5:181328356-181328378 GCACCCCTTCTTTCCCCAGAGGG - Intergenic
1002754256 6:145748-145770 GCACCCCTTCTTTCCCCAGAGGG + Intergenic
1004151777 6:13127217-13127239 GATGCCCTTCTTACACCAGAAGG - Intronic
1006394435 6:33777925-33777947 GGATCCCTGCAGAGCCCAGAAGG + Intronic
1006458766 6:34146016-34146038 GGACCCCTTCTCACCCCAGAGGG + Exonic
1008111728 6:47502365-47502387 GGAGCACTGCTTGACCCAGGAGG - Intronic
1009681347 6:66897160-66897182 GGTGCCCCGCTTGCCCCTGAAGG - Intergenic
1014130820 6:117829992-117830014 GCAGCACTGCCTATCCCAGATGG - Intergenic
1017642303 6:156506287-156506309 GGAGCCCTGGTCACTCTAGAAGG + Intergenic
1019008837 6:168825690-168825712 GGTGCCCTGTTTATCACAGAGGG - Intergenic
1019362758 7:613940-613962 GCAGCCCTGCTTGCCCCTGCGGG - Intronic
1019517236 7:1445413-1445435 GGAGCACTGCTTACACCTGGGGG + Exonic
1020196195 7:6041336-6041358 GGAGACCAGCTTACCCAACATGG + Intronic
1023401449 7:39794906-39794928 GCACCCCTTCTTTCCCCAGAGGG - Intergenic
1024512179 7:50212907-50212929 GGAGCCCTGCATACTGCAGAGGG + Intergenic
1024648168 7:51385772-51385794 GCACCCCTTCTTTCCCCAGAGGG + Intergenic
1025052027 7:55740257-55740279 GCACCCCTTCTTTCCCCAGAGGG + Intergenic
1025128985 7:56365925-56365947 GTACCCCTTCTTTCCCCAGAGGG + Intergenic
1029439786 7:100581095-100581117 GCAGCCCTGCTCACCCCAGCAGG - Intronic
1029480875 7:100812265-100812287 GGAGCCCAGCCTTTCCCAGAGGG + Intronic
1032051946 7:128655275-128655297 GCACCCCTTCTTTCCCCAGAGGG - Intergenic
1033349067 7:140547045-140547067 GAAGCCCTGCTTTCCCCATGAGG + Intronic
1033975831 7:147099342-147099364 GGGGCCTTGCTGACCCTAGAGGG - Intronic
1034517030 7:151589124-151589146 GGAGCCCTGCTAGCCGCTGACGG - Intronic
1037742779 8:21620629-21620651 CTAGCCCTGCTTCCCCCAGCAGG - Intergenic
1039404016 8:37297421-37297443 GGTGCCCTGCATTGCCCAGAAGG - Intergenic
1044962446 8:97543975-97543997 GAAGCCCTGCCTTCCCCAGCTGG + Intergenic
1048573455 8:135673105-135673127 AGCGCCCTGCAGACCCCAGAAGG + Intergenic
1049391949 8:142376252-142376274 GGTGCCCTGTTTTCCCCTGAGGG + Intronic
1052066487 9:24027770-24027792 TTACCCCTGCTTACCTCAGAGGG + Intergenic
1052726163 9:32230516-32230538 GGAGGCCTGCTTACCTCTGTAGG - Intergenic
1055118134 9:72627340-72627362 GGGACCCTGCTTATCCCAGTGGG + Intronic
1056755780 9:89381269-89381291 GGTGCCGTGCTTCCCACAGAAGG + Exonic
1057210459 9:93198439-93198461 GGAGCCCTGCTTACCCCGGTAGG + Intronic
1057484977 9:95475709-95475731 GCAGCGCTGGTGACCCCAGAGGG + Intronic
1057587615 9:96343584-96343606 GGAGAGCTACTTACCCTAGAAGG - Intronic
1057927994 9:99170084-99170106 GCAGCTCTGCTGACCCCTGAGGG + Intergenic
1058678586 9:107422372-107422394 GAAGCCCTGCTTCCTCCAGAGGG + Intergenic
1059004292 9:110384274-110384296 GGAGCTCTGCTTGCCCCATGTGG + Intronic
1061328788 9:129879652-129879674 GGAGCCTGGCTGACCCCAGGGGG - Intronic
1061483562 9:130908998-130909020 GGAGCCCTCCTGACCCCGGCTGG + Intronic
1062754686 9:138280870-138280892 GCACCCCTTCTTTCCCCAGAGGG - Intergenic
1203578593 Un_KI270745v1:25030-25052 GCACCCCTTCTTTCCCCAGAGGG - Intergenic
1190286655 X:48966041-48966063 GGAGGGCTGCTTACCTCTGAGGG + Exonic
1191615016 X:63161311-63161333 GGGGCCCTGCTGACCCTGGAGGG - Intergenic
1191621280 X:63217612-63217634 GGGGCCCTGCTGACCCTGGAGGG + Intergenic
1194296242 X:92129744-92129766 TGAGCCCTCCCTACCCCTGAAGG - Intronic
1194797139 X:98225656-98225678 AGATCCCTGCTACCCCCAGAAGG - Intergenic
1197424108 X:126273462-126273484 GGAGCTCTGCTTGCCCCATGTGG + Intergenic
1200117370 X:153775245-153775267 GCAGCCCAGCTTTTCCCAGAGGG + Exonic
1200613750 Y:5354351-5354373 TGAGCCCTCCCTACCCCTGAAGG - Intronic
1200775674 Y:7168098-7168120 GAAGCCCTGGTAACCACAGATGG + Intergenic
1202381230 Y:24277650-24277672 GCACCCCTTCTTTCCCCAGAGGG - Intergenic
1202489555 Y:25392476-25392498 GCACCCCTTCTTTCCCCAGAGGG + Intergenic