ID: 1084602194

View in Genome Browser
Species Human (GRCh38)
Location 11:70152499-70152521
Sequence GGTCCCTCTCCCAGGGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1000
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 938}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084602194 Original CRISPR GGTCCCTCTCCCAGGGAGAT AGG (reversed) Intronic
903129256 1:21267934-21267956 TGTCTATCTCCCAGGGAGACTGG + Intronic
903260126 1:22127181-22127203 TGTCCCTCTCCAAAGGGGATTGG + Intronic
903623297 1:24713703-24713725 AGTCCCTCTCCCAGGCACAGTGG + Intergenic
903847812 1:26288957-26288979 GGTCCCTTTTCCAGGGAGAGTGG + Intronic
904678364 1:32212320-32212342 GGGCCCTCTCCCAGTGGCATAGG - Intronic
904850780 1:33457748-33457770 GCTTCCTCTGCCAGAGAGATGGG + Intergenic
905142036 1:35854954-35854976 GATTCCACTCACAGGGAGATGGG + Exonic
905210899 1:36373515-36373537 GCACCCTCTCCCCGGGAGCTTGG + Intronic
905979536 1:42211184-42211206 GGGGCCTCTCCCATGGAGCTTGG + Intronic
906211891 1:44016736-44016758 GGCCCGTCTCCCCGGGAGCTAGG + Intronic
906557896 1:46728864-46728886 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
906586815 1:46985387-46985409 GTGCTTTCTCCCAGGGAGATGGG - Intergenic
906753197 1:48285047-48285069 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
906843048 1:49160668-49160690 GTGCTCTTTCCCAGGGAGATAGG + Intronic
907322351 1:53612565-53612587 GGTCAAGATCCCAGGGAGATGGG - Intronic
907565671 1:55431086-55431108 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
907953583 1:59207006-59207028 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
908598238 1:65711164-65711186 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
908611360 1:65864999-65865021 GAGCCATGTCCCAGGGAGATGGG + Intronic
908986017 1:70023137-70023159 GGCCCCTTTCCCAGGGGGCTTGG - Exonic
909040932 1:70650492-70650514 AGTTTCTCTCCCAGGAAGATAGG - Intergenic
909384273 1:75037185-75037207 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
909415708 1:75403218-75403240 GTGCTCTGTCCCAGGGAGATGGG - Intronic
909689174 1:78387256-78387278 GATTCCTGTCCCAGAGAGATTGG - Intronic
909690105 1:78397844-78397866 GTTCTCTGTCCCATGGAGATGGG + Intronic
909874394 1:80784067-80784089 GTTCTCTGTCCCAGGGAGATGGG - Intergenic
910177242 1:84443592-84443614 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
910635669 1:89405073-89405095 GGTCTCTGTCCCAGGGGGATGGG + Intergenic
910805693 1:91188259-91188281 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
910827805 1:91428093-91428115 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
911632695 1:100200428-100200450 GTGCTCTGTCCCAGGGAGATGGG - Intronic
911669535 1:100592411-100592433 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
911872857 1:103121088-103121110 GCTCCCTCTGCCAGGCACATTGG - Intergenic
912087904 1:106033213-106033235 TTTCCCTCTCCCAGGAAGTTAGG + Intergenic
912133319 1:106628353-106628375 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
912235383 1:107844827-107844849 GTGCTCTGTCCCAGGGAGATGGG - Intronic
912270995 1:108209063-108209085 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
912966286 1:114240099-114240121 GTGCTGTCTCCCAGGGAGATGGG - Intergenic
913021406 1:114791959-114791981 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
913108621 1:115639090-115639112 GTGCTCTATCCCAGGGAGATGGG + Intergenic
914458093 1:147855370-147855392 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
914804243 1:150981272-150981294 GGTCCCTCCTCCAGGGATGTAGG + Intergenic
915061332 1:153188323-153188345 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
915758124 1:158282796-158282818 GTACTCTGTCCCAGGGAGATGGG + Intergenic
915766761 1:158371171-158371193 GGTCACTCTGCCAGTGAGAGGGG - Intergenic
915771732 1:158432651-158432673 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
915876558 1:159616894-159616916 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
916180697 1:162081160-162081182 GGCCCCTATCCCATGGGGATAGG + Intronic
916359587 1:163953065-163953087 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
916406320 1:164501000-164501022 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
916614815 1:166429075-166429097 GTGCTCTGTCCCAGGGAGATAGG + Intergenic
916830410 1:168485353-168485375 GTACACTGTCCCAGGGAGATGGG - Intergenic
917009735 1:170457663-170457685 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
917091777 1:171360057-171360079 GCACTCTGTCCCAGGGAGATGGG - Intergenic
917232761 1:172855889-172855911 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
917401333 1:174652915-174652937 GTGCTCTGTCCCAGGGAGATGGG + Intronic
917406001 1:174709196-174709218 GTGCTCTGTCCCAGGGAGATGGG - Intronic
917768544 1:178250195-178250217 GTGCTCTGTCCCAGGGAGATGGG + Intronic
917915255 1:179694872-179694894 GTGCTCTCTCCCAGGGAGATGGG - Intergenic
918167201 1:181961544-181961566 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
918195698 1:182219298-182219320 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
918360357 1:183751180-183751202 GTGCTCTGTCCCAGGGAGATGGG + Intronic
918501455 1:185200868-185200890 GTGCTCTGTCCCAGGGAGATAGG + Intronic
918632043 1:186730214-186730236 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
919146735 1:193645013-193645035 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
919599034 1:199599989-199600011 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
919809961 1:201402768-201402790 AGTCCCTCCAGCAGGGAGATGGG - Intergenic
920971013 1:210743886-210743908 AGTCCCTCCCACAGGGAGAAGGG - Intronic
921461510 1:215432755-215432777 GAGCTCTGTCCCAGGGAGATGGG + Intergenic
921484817 1:215703431-215703453 GTGCTCTGTCCCAGGGAGATGGG + Intronic
921604748 1:217139665-217139687 GGGGCCTCTCCCAGCCAGATTGG - Intergenic
921631387 1:217437756-217437778 GTGCTCTGTCCCAGGGAGATGGG - Intronic
922066249 1:222146297-222146319 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
922666580 1:227474420-227474442 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
922675970 1:227550253-227550275 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
922716049 1:227872710-227872732 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
922717645 1:227885629-227885651 AGCCCCTGCCCCAGGGAGATGGG + Intergenic
923066923 1:230526883-230526905 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
923690866 1:236191944-236191966 GTGCTCTGTCCCAGGGAGATGGG + Intronic
924296062 1:242587472-242587494 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1063421013 10:5912515-5912537 GGTCCCTTCCCCAGGGAGACTGG + Intronic
1064966517 10:21020298-21020320 GGTCCCTCTTCCACTGTGATGGG - Intronic
1065119351 10:22513843-22513865 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1065907687 10:30272619-30272641 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1066215429 10:33281789-33281811 GGTCCCTTTCCAAGTGAGGTTGG + Intronic
1066993451 10:42539331-42539353 GTGCTCTATCCCAGGGAGATGGG + Intergenic
1067162131 10:43836183-43836205 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1067579519 10:47433438-47433460 GTGCTCTATCCCAGGGAGATTGG + Intergenic
1068357066 10:55923125-55923147 GTGCTCTGTCCCAGGGAGATAGG + Intergenic
1068951612 10:62782828-62782850 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1069120794 10:64567091-64567113 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1069348942 10:67502587-67502609 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1069774243 10:70917643-70917665 AGTGCCTCTGCCAGGGAGAGAGG + Intergenic
1070213213 10:74347938-74347960 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1070686862 10:78491349-78491371 GGTCCTTTTCCCAGGGTAATAGG - Intergenic
1071341258 10:84651267-84651289 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1071401747 10:85280002-85280024 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1071844362 10:89506096-89506118 GTTCTCTGTCCCAGGAAGATGGG - Intronic
1072044931 10:91644685-91644707 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1072872336 10:99133260-99133282 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1073536234 10:104279225-104279247 AGTGCCTCTCACAGGGAGCTGGG + Intronic
1073597009 10:104811257-104811279 GGTCCCACTCCCATGAAGCTGGG - Intronic
1073884224 10:108019713-108019735 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1074101284 10:110356605-110356627 GGCCACTGTCCCAGGGAGCTGGG - Intergenic
1074648479 10:115491361-115491383 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1074795467 10:116938783-116938805 GTTCTCTGTCCCAGGGAGATGGG + Intronic
1075230396 10:120671478-120671500 TGCCCCTCTCCCTGGGAGCTTGG - Intergenic
1075569046 10:123525895-123525917 AGGCTCTCTCCCAGGGAGCTTGG + Intergenic
1075577061 10:123585147-123585169 TCTCCCTGTCCCATGGAGATGGG - Intergenic
1075983876 10:126766663-126766685 GTCCTCTGTCCCAGGGAGATGGG + Intergenic
1076328794 10:129649981-129650003 GGTCCCTTTCTCGTGGAGATCGG + Intronic
1076421382 10:130334827-130334849 AGTCCCTCTCAGAGGGAAATGGG - Intergenic
1076461395 10:130649833-130649855 GGTTCTTCTCCCAGGGTGCTGGG - Intergenic
1076944523 10:133637320-133637342 GGGTCCTCTCCCTGGGAGGTGGG + Intergenic
1078336394 11:10466563-10466585 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1078392862 11:10951882-10951904 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1078453541 11:11457773-11457795 TGTCCCTCTCTCAGGCAGAGGGG + Intronic
1078766394 11:14302628-14302650 GCTCCCACTCCCAGGGAGTAGGG + Intronic
1078814081 11:14801752-14801774 GTGCTCTGTCCCAGGGAGATTGG + Intronic
1079262506 11:18897224-18897246 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1079316569 11:19412444-19412466 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1079510533 11:21205230-21205252 GGGCTCTGTCCCAGGGAGATGGG + Intronic
1079696163 11:23484543-23484565 GTCCTCTGTCCCAGGGAGATGGG - Intergenic
1080488002 11:32731146-32731168 GGTCCCACACCCACGGAGCTTGG + Intronic
1081252308 11:40850747-40850769 GTGCCCTGTCCCAGGGAGATGGG + Intronic
1082122703 11:48396456-48396478 GGTGCCTCTACCAGGTAAATGGG + Intergenic
1082127799 11:48453435-48453457 GTTCTCTCTCCCAGGGAGATGGG + Intergenic
1082876287 11:57992311-57992333 GGGTTCTATCCCAGGGAGATGGG + Intergenic
1082924419 11:58530574-58530596 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1083516182 11:63261432-63261454 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1083616495 11:64028989-64029011 GGTCCCTCTCCCAGAGTCCTGGG - Intronic
1084150980 11:67287903-67287925 AGTCTCTCTCCCAGGGATGTGGG + Intergenic
1084602194 11:70152499-70152521 GGTCCCTCTCCCAGGGAGATAGG - Intronic
1085003418 11:73061831-73061853 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1085433899 11:76481769-76481791 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1085683759 11:78603052-78603074 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1085827693 11:79865232-79865254 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1086067832 11:82765173-82765195 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1086085992 11:82956000-82956022 GTGCTCTTTCCCAGGGAGATGGG + Intronic
1086410751 11:86541669-86541691 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1086421952 11:86645572-86645594 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1086505337 11:87498217-87498239 GTGCTCTGTCCCAGGGAGATAGG - Intergenic
1086735615 11:90302260-90302282 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1086907280 11:92432852-92432874 GTGCTCTGTCCCAGGGAGATAGG + Intronic
1087596156 11:100257308-100257330 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1087667826 11:101070844-101070866 GTTCTCTGTCCCAGGGAGATGGG - Intronic
1087925187 11:103911106-103911128 GTTCTCTGTCCCAGGGAGATGGG - Intronic
1088078274 11:105878533-105878555 GTTCTCTGTCACAGGGAGATGGG + Intronic
1088702583 11:112426580-112426602 GCACTCTGTCCCAGGGAGATGGG - Intergenic
1089583975 11:119498301-119498323 GGCCCCTCCCCCAAGGAGCTGGG - Intergenic
1089765989 11:120766070-120766092 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1090688907 11:129156599-129156621 GTACTCTGTCCCAGGGAGATGGG - Intronic
1090928443 11:131273368-131273390 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1091089990 11:132762429-132762451 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1091712195 12:2749965-2749987 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1092320761 12:7472077-7472099 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1092332190 12:7594735-7594757 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1092628920 12:10358144-10358166 GTTCTCTGACCCAGGGAGATGGG + Intergenic
1092638930 12:10482188-10482210 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1092703291 12:11256868-11256890 GTACTCTGTCCCAGGGAGATGGG - Intergenic
1093004461 12:14036298-14036320 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1093402338 12:18761442-18761464 GTGCTCTGTCCCAGGGAGATAGG - Intergenic
1093530852 12:20161217-20161239 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1093545007 12:20336229-20336251 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1093664428 12:21795167-21795189 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1093778141 12:23101128-23101150 AGTGCCTCTTGCAGGGAGATGGG + Intergenic
1094139992 12:27171492-27171514 GTGCTCTGTCCCAGGGAGATAGG + Intergenic
1094453342 12:30604680-30604702 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1094656978 12:32429645-32429667 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1094733071 12:33200472-33200494 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1094782024 12:33802450-33802472 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1095356463 12:41280735-41280757 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1095674279 12:44898130-44898152 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1096499777 12:52057596-52057618 GGGCACTGTCCCAGGGAGTTTGG + Intronic
1097517211 12:60620281-60620303 GTGCACTGTCCCAGGGAGATGGG - Intergenic
1097898762 12:64853107-64853129 GTGCTCTCTCCCAGGGAGATGGG + Intronic
1098151830 12:67555327-67555349 GTACTCTGTCCCAGGGAGATGGG + Intergenic
1098183145 12:67869490-67869512 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1099053426 12:77808793-77808815 GTGCTCTTTCCCAGGGAGATGGG + Intergenic
1099236064 12:80083891-80083913 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1099238887 12:80115666-80115688 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1099435230 12:82634778-82634800 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1099878471 12:88437495-88437517 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1099897583 12:88667978-88668000 GTTCTCTGTTCCAGGGAGATGGG - Intergenic
1099943920 12:89222617-89222639 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1100111090 12:91243074-91243096 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1100136312 12:91557304-91557326 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1101296123 12:103425208-103425230 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1101296214 12:103425720-103425742 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1101487959 12:105184873-105184895 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1101595832 12:106163700-106163722 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1102345537 12:112158811-112158833 GTGCTCTGTCCCAGGGAGATAGG + Intergenic
1102956225 12:117060819-117060841 GGTCCCTTTCTCAGGGATCTGGG - Intronic
1103255610 12:119539308-119539330 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1103601536 12:122057579-122057601 GGTCTTTCTCCCAGGCTGATGGG + Intronic
1103902071 12:124308574-124308596 AGACCCTCTCCCTGGGAGGTGGG - Intronic
1105807137 13:23960059-23960081 GGTCACACTCCCAAGGAGGTTGG - Intergenic
1106025847 13:25954379-25954401 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1106326302 13:28693677-28693699 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1106335982 13:28783798-28783820 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1106336553 13:28788822-28788844 GTACTCTGTCCCAGGGAGATGGG + Intergenic
1106361852 13:29038660-29038682 GTGCCCTGTCCCAGGGAGATGGG + Intronic
1106378768 13:29215996-29216018 GTGCTCTGTCCCAGGGAGATCGG + Intronic
1106426548 13:29636276-29636298 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1106429464 13:29666095-29666117 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1107289785 13:38839580-38839602 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1107473421 13:40712485-40712507 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1107674048 13:42776569-42776591 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1108153820 13:47564442-47564464 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1108383842 13:49879898-49879920 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1108700918 13:52943510-52943532 GGTCCCCTTCCCAGACAGATGGG + Intergenic
1109033888 13:57230467-57230489 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1109187941 13:59292221-59292243 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1109328690 13:60900859-60900881 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1109617304 13:64852223-64852245 ATTCTCTCTTCCAGGGAGATCGG + Intergenic
1109635499 13:65109511-65109533 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1110019988 13:70457827-70457849 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1112165887 13:96919239-96919261 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1112231649 13:97593741-97593763 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1112546478 13:100376467-100376489 GTACTCTGTCCCAGGGAGATAGG + Intronic
1113131479 13:107042235-107042257 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1114133521 14:19820547-19820569 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1114341981 14:21754599-21754621 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1114710104 14:24768971-24768993 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1114817706 14:25979683-25979705 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1114844927 14:26309435-26309457 GTACTCTGTCCCAGGGAGATGGG - Intergenic
1115124229 14:29972843-29972865 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1115277022 14:31620900-31620922 GGGCTCTGTCCCAGGGAGATGGG + Intronic
1115281463 14:31668177-31668199 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1115842701 14:37490068-37490090 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1115867187 14:37760634-37760656 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1115940296 14:38601434-38601456 GTCCTCTGTCCCAGGGAGATGGG + Intergenic
1115974368 14:38980809-38980831 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1116433590 14:44873428-44873450 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1116511849 14:45756216-45756238 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1116771427 14:49131391-49131413 GTGCTCTGTCCCAGGGAGATAGG + Intergenic
1117121105 14:52568816-52568838 GTGCCCTGTCCCAGGGATATGGG - Intronic
1117238009 14:53798736-53798758 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1117466479 14:55999678-55999700 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1117600038 14:57365436-57365458 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1117624270 14:57619063-57619085 GTTCTCTGTCCCAGGGAGATGGG - Intronic
1117655508 14:57951807-57951829 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1117710735 14:58526082-58526104 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1117859398 14:60073983-60074005 GTACTCTGTCCCAGGGAGATGGG - Intergenic
1117985070 14:61379029-61379051 GGTCCTTATCCCAGGGCAATGGG - Intronic
1118544754 14:66873781-66873803 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1119018443 14:71084468-71084490 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1120338586 14:83190229-83190251 GGTCCCACTCCCACGGAGCCCGG - Intergenic
1122545110 14:102517528-102517550 GTCCGCTCTCCTAGGGAGATGGG - Intergenic
1202917921 14_KI270723v1_random:2653-2675 GGGTCCTCTCCCTGGGAGGTGGG + Intergenic
1202926702 14_KI270724v1_random:31930-31952 GGGTCCTCTCCCTGGGAGGTGGG - Intergenic
1123480864 15:20629612-20629634 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1123576593 15:21676116-21676138 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1123613215 15:22118584-22118606 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1123637147 15:22370753-22370775 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1123998213 15:25733577-25733599 GGCCCCTCTCCCAGCCAGACAGG - Intronic
1124084241 15:26531876-26531898 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1124666749 15:31599028-31599050 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1125288555 15:38120245-38120267 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1125354508 15:38803089-38803111 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1125784336 15:42301874-42301896 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1125984766 15:44039194-44039216 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1126554124 15:49966640-49966662 GTGCGCTGTCCCAGGGAGATGGG - Intronic
1127373769 15:58363423-58363445 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1127452547 15:59131155-59131177 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1128519870 15:68368190-68368212 GGTGGGTCTCCCTGGGAGATGGG - Intronic
1128670725 15:69572933-69572955 GCTCCCTATCCCAGGGATGTGGG + Intergenic
1128852481 15:70973601-70973623 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1130441960 15:83963529-83963551 GTACTCTGTCCCAGGGAGATGGG - Intronic
1130724065 15:86419986-86420008 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1130728633 15:86467090-86467112 GGGGTCTCTCCCAGGGAGGTGGG + Intronic
1132096459 15:98988513-98988535 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1202985461 15_KI270727v1_random:410361-410383 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1132756377 16:1487409-1487431 GGCCCCTCTCCAAGGGAGGCGGG - Exonic
1133956945 16:10452711-10452733 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1134767580 16:16774358-16774380 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1135553113 16:23413471-23413493 ACTCCCTCTTCCAGGAAGATTGG - Exonic
1135807592 16:25556663-25556685 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1135991292 16:27220378-27220400 GGTCTCTCTCCCCAGGTGATGGG + Exonic
1136522510 16:30805974-30805996 GGTCCTTCCCCCAGGGAGCTCGG - Intergenic
1136576144 16:31126569-31126591 GGTCCCTCCCACAGGGACAGCGG - Intronic
1136990207 16:35147332-35147354 AGGCCCTCTCCAAGGGAGATGGG - Intergenic
1136999990 16:35221492-35221514 GGGTCCTCTCCCTGGGAGGTGGG + Intergenic
1137033017 16:35543195-35543217 GGGTCCTCTCCCTGGGAGGTGGG + Intergenic
1137223105 16:46474897-46474919 GGGTCATGTCCCAGGGAGATGGG + Intergenic
1137239274 16:46641013-46641035 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1137814030 16:51381194-51381216 GGTACCACCCCCTGGGAGATGGG - Intergenic
1138353775 16:56361885-56361907 GGGCCCTCTCCAAGGCAGGTAGG + Exonic
1138605610 16:58086393-58086415 CTTCCTTCTCCCAGGCAGATTGG - Intergenic
1138799741 16:60013182-60013204 GGTCCCACTCCCATGGAGCCTGG + Intergenic
1138843611 16:60538893-60538915 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1138886952 16:61091292-61091314 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1139436945 16:66941862-66941884 GGTCCCTCGCCAATGGAGACGGG + Intronic
1140594229 16:76390147-76390169 TGTCCATCTCCCAGGGAGGAAGG - Intronic
1140885693 16:79240566-79240588 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1141070127 16:80946640-80946662 GGCCTCTCTCCCAGGGAGCAAGG + Intergenic
1142373213 16:89694352-89694374 CCTCCCACTCCCAGGGAGGTGGG + Intronic
1142774690 17:2127557-2127579 GGGCCGTCACCCAGAGAGATAGG - Intronic
1143427104 17:6848810-6848832 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1144031949 17:11331108-11331130 AGTAACTCTCCCAGGGTGATCGG + Intronic
1144210269 17:13008555-13008577 AGTTCAGCTCCCAGGGAGATGGG - Intronic
1144371808 17:14598289-14598311 GTGCTCTGTCCCAGGGAGATAGG - Intergenic
1145306209 17:21676673-21676695 GGGCCCCCTCCGAGTGAGATAGG + Intergenic
1146607892 17:34277552-34277574 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1146766215 17:35524246-35524268 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1147525302 17:41216690-41216712 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1148209665 17:45800538-45800560 GGTCCATCTCCCAGTGAAGTGGG + Intronic
1148953967 17:51338052-51338074 GGGCACTTTCACAGGGAGATGGG + Intergenic
1148981070 17:51575229-51575251 GTGCTCTCTCCCAGGGAGATGGG - Intergenic
1149093827 17:52817020-52817042 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1150090803 17:62323113-62323135 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1150379467 17:64709390-64709412 GGTGACTCTCCCAGGAAGAATGG - Intergenic
1150545815 17:66155905-66155927 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1151498198 17:74472382-74472404 GGCCCCTGCCCCAGGCAGATGGG - Intronic
1151693690 17:75703144-75703166 GGTCCATCTCCCTGGGAGAGTGG + Intronic
1152266462 17:79297631-79297653 TGTGCCTTTCCCAGGGAGATGGG + Intronic
1152600725 17:81260831-81260853 TGTTCCTCTCCCAGGCAGGTTGG - Intronic
1153313376 18:3699755-3699777 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1153562206 18:6382931-6382953 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1153717816 18:7868816-7868838 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1153764230 18:8360047-8360069 GGGGCCTCTCCCAGGAGGATAGG + Intronic
1155080570 18:22406351-22406373 GTACTCTGTCCCAGGGAGATGGG - Intergenic
1155114268 18:22749152-22749174 GCCCCTTCTCCCAGGGAGATGGG - Intergenic
1155384978 18:25267299-25267321 GTGCTCTCTCCCAGGGAGATGGG - Intronic
1156259522 18:35432026-35432048 GGTTCCTCTCTCAGGAACATGGG + Intergenic
1156582399 18:38393077-38393099 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1156979240 18:43265423-43265445 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1158073038 18:53495978-53496000 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1158659309 18:59371738-59371760 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1159254762 18:65931460-65931482 GAACTCTGTCCCAGGGAGATGGG - Intergenic
1159562232 18:70007779-70007801 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1159570945 18:70111081-70111103 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1159661195 18:71097743-71097765 GTTCTCTGTCCCAGGGAGACGGG + Intergenic
1159901806 18:74053774-74053796 GTGCTCTATCCCAGGGAGATGGG - Intergenic
1160346241 18:78134876-78134898 TGTCCTTCCCCCAGGGAAATGGG + Intergenic
1160346292 18:78135106-78135128 TGTCCTTCCCCCAGGGAAATGGG + Intergenic
1160951928 19:1671969-1671991 TCTCCCTCTCCCTGGGAGGTGGG + Intergenic
1162087446 19:8257159-8257181 GCTCCATCTCCCAGGAAGGTTGG - Intronic
1162817454 19:13204654-13204676 GGTCCCCCTCCCATGGTGCTGGG - Intergenic
1163862537 19:19749794-19749816 AGCCCCTCTGCAAGGGAGATGGG + Intergenic
1163989913 19:20988691-20988713 GTGCTCTTTCCCAGGGAGATGGG - Intergenic
1164047501 19:21555277-21555299 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1164093077 19:21978095-21978117 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1164112779 19:22184889-22184911 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1164849833 19:31472250-31472272 GGGACCTCTCCCTGGCAGATGGG - Intergenic
1165269929 19:34697164-34697186 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1166539246 19:43594712-43594734 GATCCCTCCCCCAGTGAGTTTGG - Intronic
1167974071 19:53209920-53209942 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1168530820 19:57127400-57127422 GTGCTCTGTCCCAGGGAGATGGG + Intronic
925484475 2:4312975-4312997 GTTCTCTGTCCCAGGGAGATGGG + Intergenic
925566339 2:5258309-5258331 GTTCTCTGTCCCAGGGAGATGGG + Intergenic
926943938 2:18167810-18167832 GTGCTCTGTCCCAGGGAGATGGG + Intronic
926970613 2:18463825-18463847 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
927021283 2:19020110-19020132 GAGCTCTGTCCCAGGGAGATGGG + Intergenic
927182828 2:20459128-20459150 GTGCTCTGTCCCAGGGAGATAGG - Intergenic
927191535 2:20520261-20520283 TGTCCCTCTCCCACAGGGATGGG + Intergenic
927600878 2:24439725-24439747 GGTCCTTCTGGCAGGGAGAGGGG + Intergenic
928830583 2:35478093-35478115 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
928864011 2:35895787-35895809 TATCCCTATCCCAGGGGGATAGG + Intergenic
929023776 2:37579282-37579304 AGTCCCTGTGCCAGGGAGCTGGG + Intergenic
929838053 2:45426372-45426394 GTGCTCTGTCCCAGGGAGATGGG - Intronic
930439931 2:51392029-51392051 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
930476765 2:51891837-51891859 GTGCTCTATCCCAGGGAGATGGG - Intergenic
930516088 2:52409765-52409787 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
931030433 2:58168971-58168993 GTGCTCTGTCCCAGGGAGATGGG - Intronic
931566479 2:63620545-63620567 GTGCTCTGTCCCAGGGAGATGGG - Intronic
931907565 2:66858875-66858897 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
932063755 2:68531463-68531485 GGTTCCTCTCTCTGGGAGAGAGG - Intronic
932523395 2:72437516-72437538 GTGCTCTGTCCCAGGGAGATGGG + Intronic
932646752 2:73510832-73510854 GTGCTCTGTCCCAGGGAGATGGG + Intronic
932820727 2:74897572-74897594 GGTGCCTCTCCCAGGCAAAAAGG + Intergenic
932840169 2:75074460-75074482 GCTCATTCTCCCAGGAAGATTGG + Intronic
932913920 2:75834512-75834534 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
932938917 2:76139330-76139352 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
933166597 2:79083376-79083398 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
933413164 2:81950822-81950844 GTACTCTGTCCCAGGGAGATGGG + Intergenic
935010908 2:99135200-99135222 GTGCTCTGTCCCAGGGAGATAGG + Intronic
935325875 2:101936183-101936205 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
936999932 2:118456899-118456921 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
937143173 2:119619109-119619131 GTGCTCTGTCCCAGGGAGATGGG - Intronic
937426598 2:121804972-121804994 TGTCCCTCTCCCAGGAAGAAAGG - Intergenic
937464984 2:122124753-122124775 GTGCTCTATCCCAGGGAGATGGG + Intergenic
937573557 2:123392197-123392219 GTGCTCTGTCCCAGGGAGATCGG - Intergenic
937807322 2:126161294-126161316 GTGCCCTGTCCCAGGAAGATAGG - Intergenic
937893345 2:126957120-126957142 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
937894015 2:126963635-126963657 GGCCCCTCCCCCAAGGAGCTTGG + Intergenic
938244680 2:129767390-129767412 CTTCCATCTCCCAGAGAGATGGG + Intergenic
939382005 2:141448033-141448055 GTGCTCTGTCCCAGGGAGATGGG + Intronic
939640807 2:144638290-144638312 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
939840649 2:147183031-147183053 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
939942038 2:148362508-148362530 GTGCTCTGTCCCAGGGAGATGGG - Intronic
940408051 2:153328421-153328443 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
940417787 2:153442663-153442685 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
940999056 2:160181510-160181532 GTGCTCTGTCCCAGGGAGATGGG - Intronic
941119629 2:161513697-161513719 GTGCTCTGTCCCAGGGAGATGGG - Intronic
941239358 2:163017240-163017262 GTGCTCTGTCCCAGGGAGATAGG + Intergenic
941478082 2:165972297-165972319 GTGCCTTGTCCCAGGGAGATAGG - Intergenic
941682294 2:168412660-168412682 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
942199938 2:173560437-173560459 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
942411080 2:175709631-175709653 GTTCTCTGTCCCAAGGAGATGGG - Intergenic
942431256 2:175913918-175913940 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
942722267 2:178966139-178966161 GTGCTCTATCCCAGGGAGATGGG - Intronic
942732632 2:179076426-179076448 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
943112307 2:183621573-183621595 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
943409833 2:187533087-187533109 GTGCTCTGTCCCAGGGAGATGGG - Intronic
943599105 2:189892851-189892873 GTGCTCTGTCCCAGGGAGATGGG + Intronic
944292075 2:198018753-198018775 GTGCTCTGTCCCAGGGAGATGGG - Intronic
945207266 2:207344979-207345001 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
945210851 2:207380824-207380846 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
945329686 2:208525146-208525168 GTGCTCTGTCCCAGGGAGATGGG + Intronic
945533730 2:210986828-210986850 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
945927446 2:215819847-215819869 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
945945236 2:215988915-215988937 GTGCTCTGTCCCAGGGAGATGGG - Intronic
945973600 2:216253808-216253830 GGGCCCTCTCCCACAGAGAGGGG - Intergenic
946913034 2:224485632-224485654 GTGCTCTGTCCCAGGGAGATGGG - Intronic
947225809 2:227839305-227839327 GTGCTCTGTCCCAGGGAGATAGG + Intergenic
947364717 2:229381800-229381822 GTGCTCTGTCCCAGGGAGATGGG - Intronic
947541850 2:230985373-230985395 TGACCCACTCACAGGGAGATAGG - Intergenic
947681379 2:232037154-232037176 GTGCTCTGTCCCAGGGAGATGGG + Intronic
949043351 2:241859258-241859280 GGCCCGGCCCCCAGGGAGATGGG - Intergenic
1168861967 20:1052041-1052063 GGTCTCACTCCCAGGCATATGGG - Intergenic
1168922010 20:1546237-1546259 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1169605907 20:7319157-7319179 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1169960308 20:11152393-11152415 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1170133950 20:13052915-13052937 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1170167855 20:13380694-13380716 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1171147427 20:22797632-22797654 GGTCCATATCCCAGGGGGAGAGG - Intergenic
1171847088 20:30283872-30283894 TGGCCCCCTCCCAGTGAGATAGG - Intergenic
1173751122 20:45477778-45477800 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1174082523 20:47980666-47980688 TGTCCCTGTCCAAGGAAGATAGG + Intergenic
1174121733 20:48271028-48271050 GGGCCATCTCCCAGGGAACTGGG - Intergenic
1175040989 20:56050403-56050425 GTGCTCTATCCCAGGGAGATGGG - Intergenic
1177050313 21:16225125-16225147 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1177511421 21:22092058-22092080 CGCCCCTCCCCCTGGGAGATTGG + Intergenic
1177694612 21:24555358-24555380 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1178836860 21:36105516-36105538 GGTCCCTCCCCTAGGGAAAGGGG + Intergenic
1179519516 21:41932915-41932937 GGTCCCTCTCCCAATGAAACTGG - Intronic
1180801871 22:18635775-18635797 GGTTCCTCTCAGAGGGAGAAGGG - Intergenic
1180842757 22:18966937-18966959 GGTCCCGGTGCCAGGGAGCTGGG - Intergenic
1180853109 22:19031316-19031338 GGTTCCTCTCAGAGGGAGAAGGG - Intergenic
1181058691 22:20271797-20271819 GGTCCCAGTGCCAGGGAGCTGGG + Intronic
1181219849 22:21359486-21359508 GGTTCCTCTCAGAGGGAGAAGGG + Intergenic
1182022339 22:27091400-27091422 GGACCATCTGCCAGGGACATGGG + Intergenic
1182518783 22:30873534-30873556 GCTCCCTCTCACTGTGAGATCGG - Intronic
1182952454 22:34390432-34390454 GTACTCTGTCCCAGGGAGATGGG + Intergenic
1183021458 22:35030561-35030583 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1183806849 22:40219145-40219167 AGTTCCTCTCCCTGGGAGACCGG + Intronic
1183943556 22:41310553-41310575 GCTCCTGCTCCCAGGGAGCTTGG - Intronic
1184527780 22:45035689-45035711 GGTTCCCCTCCCAGTGAGGTGGG + Intergenic
1184953740 22:47865374-47865396 GCTCCCTCTCTCCTGGAGATGGG - Intergenic
949801157 3:7905966-7905988 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
949846131 3:8372422-8372444 GTGCTCTGTCCCAGGGAGATAGG - Intergenic
949955088 3:9260671-9260693 GTTCTCTGTCCCAGGGAGATGGG - Intronic
949987975 3:9554250-9554272 GTTCCCTCTCCCAGGGGTGTTGG - Intergenic
950597415 3:13996898-13996920 GTGCTCTGTCCCAGGGAGATGGG + Intronic
951140018 3:19148139-19148161 CGTCCCACTCCCGGGGAGACTGG - Intergenic
951183141 3:19682301-19682323 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
951254458 3:20432743-20432765 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
951310951 3:21125378-21125400 GTGCTCTTTCCCAGGGAGATGGG - Intergenic
951434224 3:22643220-22643242 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
951503630 3:23417673-23417695 GTGCTCTGTCCCAGGGAGATGGG + Intronic
951629081 3:24699084-24699106 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
951741716 3:25931992-25932014 GAGCTCTGTCCCAGGGAGATGGG - Intergenic
951777212 3:26323690-26323712 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
952098578 3:29985016-29985038 GTGCTCTGTCCCAGGGAGATGGG + Intronic
953315901 3:41925871-41925893 GTGCTCTGTCCCAGGGAGATGGG - Intronic
953526114 3:43691211-43691233 GGAGCCTCTCCCAGGCAGAGCGG - Intronic
953555748 3:43945698-43945720 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
953770251 3:45774198-45774220 GGTACTTTTCCCAGGGAGAAGGG + Intronic
954490583 3:50901093-50901115 GTGCTCTGTCCCAGGGAGATGGG + Intronic
954507683 3:51092534-51092556 GTGCTCTGTCCCAGGGAGATGGG - Intronic
954508157 3:51097224-51097246 GTGCTCTGTCCCAGGGAGATGGG + Intronic
954510462 3:51120583-51120605 GTGCTCTGTCCCAGGGAGATGGG + Intronic
954531122 3:51320848-51320870 GTGCTCTGTCCCAGGGAGATGGG - Intronic
954922521 3:54203949-54203971 GGTCCCACTCCCAGGGACCTAGG - Intronic
955414258 3:58678219-58678241 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
956005853 3:64777310-64777332 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
956242092 3:67142034-67142056 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
956279398 3:67540569-67540591 GTGCTCTATCCCAGGGAGATGGG - Intronic
956355759 3:68390377-68390399 GTGCTCTGTCCCAGGGAGATGGG - Intronic
956383025 3:68686072-68686094 TTGCCCTGTCCCAGGGAGATGGG + Intergenic
956711583 3:72042740-72042762 TGTCTCTCTCCCAGGGATAGGGG + Intergenic
957083626 3:75659085-75659107 GGGTCCTCTCCCTGGGAGGTGGG - Intergenic
957596580 3:82274021-82274043 GTGCTCTATCCCAGGGAGATGGG + Intergenic
957747648 3:84365883-84365905 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
957811553 3:85228940-85228962 GTACTCTGTCCCAGGGAGATGGG + Intronic
958694529 3:97510805-97510827 GTGCTCTGTCCCAGGGAGATAGG + Intronic
959093037 3:101924661-101924683 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
959120071 3:102222711-102222733 GTGCTCTGTCCCAGGGAGATGGG + Intronic
959291930 3:104485475-104485497 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
959453801 3:106534570-106534592 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
959534650 3:107470884-107470906 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
959848119 3:111057181-111057203 GTGCTCTTTCCCAGGGAGATGGG - Intergenic
960076005 3:113485600-113485622 GTGCTCTGTCCCAGGGAGATGGG - Intronic
960177319 3:114532510-114532532 GTGCTCTGTCCCAGGGAGATGGG - Intronic
960579872 3:119267690-119267712 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
960776554 3:121262840-121262862 GTGCTCTGTCCCAGGGAGATGGG - Intronic
960827922 3:121811793-121811815 GTGCGCTGTCCCAGGGAGATGGG - Intronic
961033522 3:123626615-123626637 AGTCCCTTTCTCAAGGAGATGGG - Intronic
961499680 3:127323446-127323468 ACTCCCTCTCCCTGGGAGAATGG - Intergenic
961977554 3:131042633-131042655 GTGCTCTGTCCCAGGGAGATGGG - Intronic
961998208 3:131268885-131268907 TGGCTCTGTCCCAGGGAGATTGG + Intronic
962124870 3:132606652-132606674 GTCCTCTGTCCCAGGGAGATGGG - Intronic
962640097 3:137376917-137376939 GTGCTCTGTCCCAGGGAGATAGG + Intergenic
962765753 3:138560892-138560914 GTGCTCTGTCCCAGGGAGATGGG - Intronic
963027484 3:140933911-140933933 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
963629261 3:147712778-147712800 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
963980284 3:151529228-151529250 GGGCTCTGTCCCAGGGAGATGGG - Intergenic
964010410 3:151885664-151885686 GGTGTCTGTCCCAAGGAGATGGG - Intergenic
964264194 3:154875494-154875516 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
964332626 3:155620783-155620805 GTGCTCTGTCCCAGGGAGATGGG - Intronic
964543342 3:157804146-157804168 GTGCTCTGTCCCAGGGAGATCGG + Intergenic
964904877 3:161707598-161707620 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
965618692 3:170621270-170621292 GTGCTCTGTCCCAGGGAGATGGG + Intronic
966251110 3:177866225-177866247 GGGCTCTGTCCCAGGGAGATGGG - Intergenic
966493765 3:180556814-180556836 GTGCTCTGTCCCAGGGAGATTGG - Intergenic
966561417 3:181324855-181324877 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
966637877 3:182156325-182156347 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
967181456 3:186909154-186909176 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
967562628 3:190934629-190934651 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
967715630 3:192758565-192758587 GTGCTCTGTCCCAGGGAGATGGG - Intronic
968829059 4:2922755-2922777 GTGCTCTGTCCCAGGGAGATGGG + Intronic
969132472 4:5001983-5002005 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
969659730 4:8519505-8519527 GATCCCTCACTCTGGGAGATGGG + Intergenic
969890549 4:10255904-10255926 GTTTCCTCTCCCAGAGAGAGGGG - Intergenic
970304757 4:14719464-14719486 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
970685278 4:18559940-18559962 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
971186485 4:24382759-24382781 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
971430027 4:26556139-26556161 TGTCCCAGTCCCAGGGAGATGGG + Intergenic
971679073 4:29673665-29673687 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
972372420 4:38437833-38437855 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
972784745 4:42315789-42315811 GGTCCCTCCCCTAGGGAAAGGGG + Intergenic
972962786 4:44474234-44474256 GTGCTCTGTCCCAGGGAGATAGG - Intergenic
973081816 4:46002892-46002914 GTTGTCTGTCCCAGGGAGATGGG + Intergenic
973273044 4:48280436-48280458 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
973321848 4:48817927-48817949 GTGCTCTATCCCAGGGAGATGGG - Intronic
973715187 4:53669435-53669457 GTGCTCTGTCCCAGGGAGATAGG + Intronic
973798432 4:54451718-54451740 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
974307059 4:60155981-60156003 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
974326264 4:60418978-60419000 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
974851743 4:67412340-67412362 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
974946589 4:68536020-68536042 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
974975412 4:68885817-68885839 GCTCTCTGTCCCAGGGAGATGGG - Intergenic
975104154 4:70549117-70549139 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
975307765 4:72868390-72868412 GTGCTCTCTCCTAGGGAGATAGG - Intergenic
975458237 4:74618684-74618706 GCTCTCACTCTCAGGGAGATAGG - Intergenic
975484139 4:74915810-74915832 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
975511226 4:75195193-75195215 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
975513739 4:75221838-75221860 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
975620298 4:76290272-76290294 GTGCTCTGTCCCAGGGAGATGGG + Intronic
975638826 4:76478500-76478522 GTGCTCTGTCCCAGGGAGATGGG - Intronic
976006836 4:80440074-80440096 GTGCTCTGTCCCAGGGAGATGGG - Intronic
976439320 4:85055290-85055312 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
976445936 4:85129742-85129764 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
976534295 4:86193370-86193392 GTACTCTGTCCCAGGGAGATAGG + Intronic
977039819 4:92002158-92002180 GGGCCTTGTTCCAGGGAGATTGG - Intergenic
977046940 4:92079508-92079530 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
977154516 4:93555628-93555650 GTGCTCTGTCCCAGGGAGATGGG - Intronic
977438933 4:97037710-97037732 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
977986219 4:103385916-103385938 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
977994498 4:103485283-103485305 GTTCTCTGTTCCAGGGAGATGGG - Intergenic
978009294 4:103659217-103659239 GGTCCCTAACCCAGGGAACTGGG + Intronic
978108310 4:104931082-104931104 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
978139102 4:105297483-105297505 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
978179497 4:105775964-105775986 GTGCTCTGTCCCAGGGAGATGGG + Intronic
978236877 4:106471176-106471198 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
978313316 4:107409812-107409834 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
978664332 4:111164553-111164575 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
978699732 4:111628070-111628092 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
979022838 4:115524917-115524939 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
979043723 4:115834781-115834803 TTTCTCTGTCCCAGGGAGATGGG - Intergenic
979417495 4:120461178-120461200 GTACTCTGTCCCAGGGAGATGGG - Intergenic
979457639 4:120944596-120944618 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
979581401 4:122365344-122365366 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
979998671 4:127463769-127463791 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
980157597 4:129126139-129126161 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
980200624 4:129652028-129652050 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
980633882 4:135473565-135473587 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
980687886 4:136253878-136253900 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
981131618 4:141163325-141163347 GTGCTCTGTCCCAGGGAGATGGG - Intronic
981202141 4:141992630-141992652 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
981273210 4:142868239-142868261 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
981662550 4:147184404-147184426 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
981885374 4:149666949-149666971 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
981940009 4:150271882-150271904 GTGCTCTGTCCCAGGGAGATGGG - Intronic
982060239 4:151597647-151597669 GTGCTCTTTCCCAGGGAGATGGG + Intronic
982298919 4:153859349-153859371 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
982733236 4:158978987-158979009 GTGCTCTGTCCCAGGGAGATAGG + Intronic
982794506 4:159629331-159629353 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
983298994 4:165901862-165901884 GTGCTCTGTCCCAGGGAGATGGG + Intronic
983331351 4:166333358-166333380 GTGCTCTGTCCCAGGGAGATAGG + Intergenic
983840897 4:172455720-172455742 GCGCTCTGTCCCAGGGAGATGGG - Intronic
983958768 4:173727565-173727587 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
984009037 4:174348231-174348253 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
984526017 4:180860353-180860375 GTACTCTGTCCCAGGGAGATGGG + Intergenic
984618687 4:181927545-181927567 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
985447910 4:190037831-190037853 GGGTCCTCTCCCTGGGAGGTGGG + Intergenic
986005974 5:3669540-3669562 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
986378790 5:7162421-7162443 GTCCTCTGTCCCAGGGAGATGGG + Intergenic
986511943 5:8517084-8517106 AGTCCCACTCCCAGGGAGCCCGG - Intergenic
986879630 5:12154024-12154046 GTGCTCTGTCCCAGGGAGATAGG - Intergenic
988289847 5:29270859-29270881 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
988772548 5:34447409-34447431 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
988775017 5:34469599-34469621 GCTACCTGTCCCAGGGAGATGGG - Intergenic
989194205 5:38700159-38700181 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
989363986 5:40634983-40635005 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
989619007 5:43366764-43366786 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
990098895 5:52157165-52157187 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
990405344 5:55484622-55484644 AGTCTCTCTCCCAGGGACAAAGG - Intronic
990745815 5:58958703-58958725 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
990803542 5:59632265-59632287 GTGCTCTGTCCCAGGGAGATGGG - Intronic
990837840 5:60042319-60042341 GTGCTCTGTCCCAGGGAGATGGG - Intronic
991026634 5:62037265-62037287 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
991151510 5:63376336-63376358 GTTCTGTGTCCCAGGGAGATGGG - Intergenic
991283194 5:64939734-64939756 GTGCTCTGTCCCAGGGAGATGGG + Intronic
991417188 5:66405154-66405176 GTACTCTGTCCCAGGGAGATGGG + Intergenic
992038837 5:72808646-72808668 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
992077905 5:73207590-73207612 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
992254837 5:74911384-74911406 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
992287320 5:75248648-75248670 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
993381821 5:87217485-87217507 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
993402724 5:87473097-87473119 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
993513389 5:88799262-88799284 GTGCTCTGTCCCAGGGAGATGGG + Intronic
993609049 5:90032032-90032054 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
994233500 5:97336007-97336029 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
994378117 5:99038127-99038149 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
994642000 5:102421643-102421665 GTGCTCTGTCCCAGGGAGATGGG - Intronic
994721526 5:103385786-103385808 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
994991270 5:106999875-106999897 GTCCTCTGTCCCAGGGAGATAGG + Intergenic
995252238 5:110006615-110006637 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
995612403 5:113924127-113924149 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
995695778 5:114876742-114876764 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
995790617 5:115882818-115882840 GTGCTCTGTCCCAGGGAGATGGG + Intronic
995811112 5:116108292-116108314 GTGCTCTGTCCCAGGGAGATGGG + Intronic
996426579 5:123319948-123319970 GCACTCTGTCCCAGGGAGATGGG + Intergenic
996648094 5:125841216-125841238 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
997004573 5:129803344-129803366 GTACTCTGTCCCAGGGAGATGGG + Intergenic
997171770 5:131729302-131729324 GTGCTCTGTCCCAGGGAGATGGG + Intronic
997216693 5:132117283-132117305 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
997517905 5:134503911-134503933 GGTCCTTCTCCCAGGCAGGCAGG - Intergenic
997646725 5:135487016-135487038 GTTCTTTCTCCCAGGGACATGGG - Intergenic
997786402 5:136717839-136717861 GTTCCCTCTCCCAGGAGGAAAGG - Intergenic
997800221 5:136853371-136853393 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
997809494 5:136953663-136953685 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
997858917 5:137398331-137398353 GGCCCATCTCCCAGGGTGATGGG - Intronic
998691583 5:144594358-144594380 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
998780108 5:145647136-145647158 GTGCTCTGTCCCAGGGAGATGGG + Intronic
998788774 5:145743800-145743822 TGTCCCTCCCCCTGGGAGCTGGG - Intronic
998934232 5:147216886-147216908 GTACTCTGTCCCAGGGAGATGGG - Intergenic
998965261 5:147532834-147532856 TCTCTCTCTCCCTGGGAGATGGG - Intergenic
999502340 5:152159925-152159947 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
999608160 5:153339074-153339096 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
999983965 5:156984965-156984987 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1000277412 5:159750532-159750554 GGTCCCACTCCCAGCTAGAGAGG - Intergenic
1000355064 5:160386440-160386462 GGTCCCTCTCTTAAGGAGACAGG - Intergenic
1000582179 5:163048258-163048280 GAGCTCTGTCCCAGGGAGATGGG + Intergenic
1000590074 5:163147253-163147275 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1000798342 5:165693029-165693051 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1001362632 5:171103218-171103240 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1001412349 5:171520296-171520318 GGGCCATCTCCTGGGGAGATGGG + Intergenic
1002677203 5:180926844-180926866 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1002709214 5:181184159-181184181 GGTCCCTCGCCCCGGGATCTCGG - Intergenic
1002758580 6:184166-184188 GGTCCATCTCCCAGAGTGCTCGG - Intergenic
1002926985 6:1610473-1610495 GGCACCACTCCCAGGGAGTTGGG - Exonic
1002996157 6:2287048-2287070 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1003316779 6:5020147-5020169 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1003416853 6:5917463-5917485 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1004021167 6:11776762-11776784 GTTCCCTCTCCCTGGGAGGCTGG - Intronic
1004028028 6:11837716-11837738 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1004271695 6:14201553-14201575 GCCCCCTTGCCCAGGGAGATAGG - Intergenic
1004460285 6:15828812-15828834 GGTCCCTAACCCAGGTAGAGAGG - Intergenic
1004944439 6:20596280-20596302 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1005274228 6:24199031-24199053 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1005778328 6:29161653-29161675 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1006580998 6:35078037-35078059 CGTCCTTGTCCCAGGGAGAAGGG - Intronic
1006712178 6:36083697-36083719 GGGCTCCATCCCAGGGAGATTGG - Intronic
1007195566 6:40056898-40056920 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1008407558 6:51136062-51136084 GTTCTCTGTCCTAGGGAGATGGG + Intergenic
1008425191 6:51348925-51348947 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1008785148 6:55158827-55158849 GTGCCCTGTCCCAGGGAGATGGG - Intronic
1008865461 6:56204503-56204525 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1008896804 6:56565816-56565838 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1008993938 6:57636781-57636803 GTGCCCCATCCCAGGGAGATGGG - Intronic
1009186368 6:60579345-60579367 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1009240823 6:61183990-61184012 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1009455301 6:63849209-63849231 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1009458793 6:63888161-63888183 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1009512287 6:64568504-64568526 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1009536721 6:64896978-64897000 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1009652099 6:66489587-66489609 GGTGTCTGTCCCAGGGAAATGGG - Intergenic
1009709578 6:67300252-67300274 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1009718224 6:67428069-67428091 GGTCTCAGTCCCAGGGAGATGGG + Intergenic
1009740204 6:67734184-67734206 GGCCTCTGTCCCAGGGAGATTGG + Intergenic
1009797880 6:68495246-68495268 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1009959471 6:70501116-70501138 GGGCTCTGTCCCAGGGAGATGGG + Intronic
1010276377 6:73972622-73972644 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1010459504 6:76098069-76098091 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1010668275 6:78655447-78655469 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1010822642 6:80433280-80433302 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1010936621 6:81870117-81870139 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1011086523 6:83546991-83547013 GTGCTCTTTCCCAGGGAGATGGG - Intergenic
1011120125 6:83942984-83943006 GCACTCTGTCCCAGGGAGATGGG - Intronic
1011318654 6:86065405-86065427 GTCCTCTGTCCCAGGGAGATGGG + Intergenic
1011578238 6:88827911-88827933 GTACTCTGTCCCAGGGAGATGGG - Intronic
1011776750 6:90739376-90739398 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1011884415 6:92076261-92076283 GTTTCCTATCCCAGGGAGCTTGG - Intergenic
1012043448 6:94239205-94239227 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1012083033 6:94785058-94785080 GTACTCTGTCCCAGGGAGATGGG + Intergenic
1012127895 6:95453866-95453888 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1012207431 6:96478522-96478544 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1012562364 6:100598638-100598660 GGTCCCACACACAGGGAGCTGGG - Intronic
1013038030 6:106405406-106405428 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1013320207 6:108980619-108980641 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1013390284 6:109679476-109679498 GTGCTCTGTCCCAGGGAGATAGG - Intronic
1013625625 6:111934584-111934606 GTGCTCTCTCCCAGGGGGATGGG + Intergenic
1013682635 6:112541856-112541878 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1013901870 6:115166266-115166288 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1013964251 6:115935863-115935885 GTGCTCTGTCCCAGGGAGATGGG - Exonic
1014176993 6:118342161-118342183 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1014278883 6:119418482-119418504 GGGCTCTGTCCCAGGGAGATGGG - Intergenic
1014836515 6:126166729-126166751 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1015387007 6:132635648-132635670 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1015676277 6:135753547-135753569 TGTCTCTGTCCCAGGGACATGGG - Intergenic
1016111510 6:140230652-140230674 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1016241904 6:141940619-141940641 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1016638515 6:146322512-146322534 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1016691496 6:146943226-146943248 GTACTCTGTCCCAGGGAGATGGG + Intergenic
1016855980 6:148671193-148671215 CCTCCTTCCCCCAGGGAGATGGG + Intergenic
1017197376 6:151716449-151716471 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1017571447 6:155749110-155749132 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1018094480 6:160373625-160373647 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1018507792 6:164490578-164490600 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1019203628 6:170341124-170341146 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1020519550 7:9168987-9169009 GTGCCCTGTCCCAGGGAAATGGG + Intergenic
1020608565 7:10367354-10367376 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1020874231 7:13673637-13673659 GTGCTCTATCCCAGGGAGATAGG + Intergenic
1020884390 7:13803929-13803951 GTCCTCTGTCCCAGGGAGATGGG - Intergenic
1021071694 7:16249250-16249272 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1021207909 7:17807487-17807509 GTGCTCTGTCCCAGGGAGATTGG - Intronic
1021322346 7:19227402-19227424 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1021556784 7:21927838-21927860 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1021782271 7:24117944-24117966 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1021805672 7:24352660-24352682 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1022058810 7:26770070-26770092 GTGCTCTATCCCAGGGAGATGGG + Intronic
1022126438 7:27361922-27361944 GTTCCCTCTTCCATGGAGCTTGG + Intergenic
1022615658 7:31927318-31927340 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1023051715 7:36258444-36258466 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1023061629 7:36333029-36333051 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1023511587 7:40959285-40959307 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1023697730 7:42865049-42865071 GTGCTCTCTCCCAGGGAGACGGG + Intergenic
1023770679 7:43554012-43554034 GGTCCCTCTCACAGTAAGCTGGG - Intronic
1023894336 7:44419354-44419376 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1024495484 7:50041180-50041202 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1024563505 7:50663482-50663504 GGTCCTTCTCACAGGGATAATGG + Intronic
1024664867 7:51536379-51536401 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1024998483 7:55294531-55294553 GTGCTCTGTCCCAGGGAGATAGG + Intergenic
1025149830 7:56539464-56539486 AGACCCTCTCCAAGGGGGATGGG - Intergenic
1025637900 7:63339747-63339769 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1025644797 7:63408352-63408374 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1025712787 7:63927477-63927499 AGACCCTCTCCAAGGGGGATGGG - Intergenic
1026667555 7:72356588-72356610 GTTCCATCTTTCAGGGAGATTGG - Intronic
1027446031 7:78274556-78274578 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1027637120 7:80689538-80689560 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1027864530 7:83629409-83629431 GTCCTCTGTCCCAGGGAGATGGG + Intronic
1027910680 7:84245972-84245994 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1028144339 7:87304879-87304901 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1028337357 7:89674060-89674082 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1028648296 7:93121853-93121875 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1028806000 7:95026701-95026723 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1028945570 7:96575585-96575607 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1029324714 7:99796331-99796353 GGGCTCTGTCCCAGGGAGATGGG + Intergenic
1029845216 7:103405796-103405818 GTTCTCTGTCCCAGGGAGATGGG + Intronic
1029995184 7:105000930-105000952 AGTCCCTGTCCCAGGGATAGGGG - Intergenic
1030140998 7:106304104-106304126 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1030245201 7:107377819-107377841 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1030482340 7:110120204-110120226 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1030500780 7:110356400-110356422 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1030612595 7:111705821-111705843 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1030705599 7:112689783-112689805 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1030958885 7:115889644-115889666 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1031902675 7:127428379-127428401 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1032295888 7:130638343-130638365 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1032321374 7:130889206-130889228 GATCTCTCTTCCAGGGAGCTAGG - Intergenic
1032659706 7:133969962-133969984 GTGCCCTGTCCCAGGGAGATGGG + Intronic
1032838276 7:135693750-135693772 GTTATCACTCCCAGGGAGATGGG - Intronic
1032911114 7:136431738-136431760 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1032957074 7:136984057-136984079 GTTCTCTGTCCCAGGGATATGGG + Intronic
1033525652 7:142210711-142210733 GGTGTCTGTCCCAGAGAGATGGG - Intronic
1033617696 7:143032534-143032556 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1034115782 7:148582661-148582683 GGTACCTATCCCAGGAAGACAGG - Intergenic
1034338514 7:150338368-150338390 GGTTCCTCTCCCTGGGGGCTGGG + Exonic
1034365532 7:150543154-150543176 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1034689115 7:152999843-152999865 GTGCTCTATCCCAGGGAGATGGG + Intergenic
1034715076 7:153234610-153234632 GTGCACTGTCCCAGGGAGATGGG + Intergenic
1035155496 7:156908938-156908960 GGTCTCTCTCCCGGGGACAAGGG + Intergenic
1037258246 8:16979435-16979457 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1037719692 8:21431876-21431898 GTGCTCTCTCCCAGGGAGATGGG - Intergenic
1037808021 8:22069237-22069259 GGTGCCTGGCCCAGGGAGAAAGG - Intronic
1038211618 8:25523563-25523585 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1038643807 8:29347957-29347979 GGCCCCGCTCCCGGGGAGAGAGG - Intronic
1039133884 8:34298093-34298115 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1039754800 8:40512056-40512078 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1039800474 8:40950249-40950271 CTTCCCTGGCCCAGGGAGATGGG - Intergenic
1040316854 8:46266613-46266635 GGTGCCTTTCCCAGGCAAATAGG + Intergenic
1040520055 8:48168985-48169007 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1040968770 8:53112101-53112123 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1041617499 8:59925048-59925070 CTTCCCTCTCCCATGGAGTTAGG - Intergenic
1041630530 8:60082552-60082574 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1041944360 8:63424708-63424730 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1042627118 8:70770531-70770553 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1042812871 8:72845556-72845578 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1042969271 8:74390800-74390822 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1043253624 8:78106228-78106250 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1043379918 8:79691601-79691623 GGTCAGTCTCCCACCGAGATGGG - Intergenic
1043532476 8:81166182-81166204 GTGCCCTCTCCCAGGGAAATGGG - Intergenic
1043703652 8:83322309-83322331 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1044131131 8:88525710-88525732 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1044503608 8:92991275-92991297 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1044509434 8:93058116-93058138 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1045185139 8:99830217-99830239 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1045212158 8:100109189-100109211 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1045783719 8:105897494-105897516 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1045797741 8:106065593-106065615 GTGCTCTTTCCCAGGGAGATGGG - Intergenic
1045839382 8:106561497-106561519 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1045975059 8:108122643-108122665 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1047133712 8:122051885-122051907 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1049450506 8:142659013-142659035 CTTCCCTCTGCCAGGGAGAATGG + Intronic
1050031809 9:1393903-1393925 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1050130111 9:2403288-2403310 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1050300467 9:4253231-4253253 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1051321907 9:15914264-15914286 GTACTCTGTCCCAGGGAGATGGG + Intronic
1051353960 9:16223900-16223922 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1051571450 9:18563630-18563652 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1051611608 9:18967364-18967386 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1051814356 9:21087731-21087753 GTGCTCTATCCCAGGGAGATGGG - Intergenic
1051863352 9:21651471-21651493 GTGCCCTGTCCCAGGGAGATGGG + Intergenic
1051940184 9:22496067-22496089 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1052052683 9:23866221-23866243 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1052281182 9:26735189-26735211 GTGCTCTCTCCCAGGGAGATTGG + Intergenic
1052329429 9:27252018-27252040 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1052382299 9:27784824-27784846 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1052628358 9:31005240-31005262 TGCTCTTCTCCCAGGGAGATGGG - Intergenic
1052746631 9:32448161-32448183 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1052752783 9:32509122-32509144 GTGCCCTCTCCCAGGGAAATGGG - Intronic
1053491264 9:38505537-38505559 GATACCTGTCCCAGGGAGAAAGG + Intergenic
1053608128 9:39681006-39681028 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1053865969 9:42437366-42437388 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1054245403 9:62661403-62661425 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1054447901 9:65386668-65386690 TGGCCCCCTCCCAGTGAGATAGG - Intergenic
1054559532 9:66695934-66695956 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1054719843 9:68593765-68593787 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1054884887 9:70185516-70185538 GGGCTCTGTCCCAGGGAGATGGG + Intronic
1054889167 9:70233021-70233043 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1055345012 9:75326764-75326786 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1055494609 9:76841820-76841842 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1055571817 9:77624292-77624314 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1056003487 9:82242618-82242640 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1056123768 9:83514485-83514507 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1056176745 9:84043699-84043721 GTTCTCTGTCCCAGGGAGATGGG + Intergenic
1056997738 9:91479263-91479285 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1057263490 9:93599124-93599146 GGACCCTCTGCCAGGGAGATGGG + Intronic
1058072834 9:100619229-100619251 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1058093241 9:100829376-100829398 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1058265827 9:102897940-102897962 GTGCTCTCTCCCAGGGAGATGGG - Intergenic
1058492385 9:105516213-105516235 GGGCTCTGTCCCAGGGAGATAGG - Intronic
1059088891 9:111334814-111334836 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1059486050 9:114627592-114627614 GGTCCCACTTCTAGGGAGAAGGG + Intronic
1059513393 9:114870230-114870252 GGGCTCTGTCCCAGGGAGATGGG - Intergenic
1060473946 9:123971180-123971202 AGTCCCTCTCCCAGGCAGTCAGG + Intergenic
1060826674 9:126691847-126691869 GGTCCTTCACCCTGGGAAATGGG - Intronic
1061108381 9:128550024-128550046 GGGGTCTCTCCCAGGGAGAGTGG + Intergenic
1061168864 9:128940534-128940556 GGTCCCTCTCCCTAGGGGGTGGG - Intronic
1061316042 9:129796405-129796427 GGCCTCTCACCCAGGGAGAGAGG + Intergenic
1061961980 9:133993023-133993045 GGTCGCTCCCCCAGGGAGAAGGG - Intergenic
1062006064 9:134239204-134239226 AGACTCTCTCCCAGGGTGATAGG + Intergenic
1062039937 9:134399893-134399915 GCTTCCTCTCCCAGGGAGGAAGG - Intronic
1062297646 9:135841372-135841394 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1062532293 9:137007281-137007303 GGCCCGGCTCCCAGGGAGGTGGG + Exonic
1186354247 X:8773462-8773484 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1186369975 X:8937009-8937031 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1186773274 X:12838975-12838997 GTGCTCTGTCCCAGGGAGATAGG + Intergenic
1187207149 X:17193616-17193638 TGTCCCTCTCCTAAGCAGATGGG + Intergenic
1187509555 X:19905364-19905386 GGTCCAACTCCCATGGAGAAGGG + Intergenic
1187660898 X:21545441-21545463 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1187784357 X:22867203-22867225 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1188193257 X:27197507-27197529 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1188296398 X:28455706-28455728 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1188561205 X:31470767-31470789 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1188921889 X:35987224-35987246 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1189210775 X:39280322-39280344 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1189575063 X:42342989-42343011 GTGCTCTATCCCAGGGAGATGGG + Intergenic
1189590680 X:42507553-42507575 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1189721823 X:43927410-43927432 GTGCTCTGTCCCAGGGAGATAGG + Intergenic
1189937800 X:46087643-46087665 GTGCTCTCTCCCAGGGAGATGGG - Intergenic
1189947541 X:46194554-46194576 GGTCCCTCTAAGAGGGAGATAGG + Intergenic
1190277251 X:48906806-48906828 GGGCTCTCTGCCAGGGAGGTAGG - Intronic
1190420349 X:50223884-50223906 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1190495047 X:51020690-51020712 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1190505920 X:51125747-51125769 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1190594300 X:52037672-52037694 GGTCCTTCTCCAAGGGAAACTGG + Intergenic
1190595748 X:52051706-52051728 GGTCCTTCTCCAAGGGAAACTGG + Exonic
1190613076 X:52202367-52202389 GGTCCTTCTCCAAGGGAAACTGG - Exonic
1190879971 X:54485002-54485024 GGGCCCTCCCCCAGGGACAGAGG + Intronic
1190959720 X:55234435-55234457 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1190995651 X:55606115-55606137 GTGCTCTATCCCAGGGAGATGGG + Intergenic
1191071989 X:56410645-56410667 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1191098935 X:56704549-56704571 GTGCTCTCTCCCAGGGAGATGGG + Intergenic
1191113902 X:56832201-56832223 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1191168497 X:57417848-57417870 GTTCTCTATCTCAGGGAGATGGG + Intronic
1191186717 X:57621010-57621032 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1191606289 X:63066156-63066178 GCGCTCTGTCCCAGGGAGATGGG - Intergenic
1191631989 X:63331550-63331572 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1191657490 X:63613991-63614013 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1191762588 X:64661817-64661839 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1191785038 X:64908106-64908128 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1191787784 X:64935345-64935367 GTGCTCTGTCCCAGGGAGATAGG - Intronic
1191793819 X:64999963-64999985 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1191809756 X:65174495-65174517 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1191824887 X:65353986-65354008 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1191848556 X:65568937-65568959 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1191962531 X:66719131-66719153 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1191966697 X:66766748-66766770 GTTCTCTATCCCAGGGAGATTGG + Intergenic
1191984881 X:66968996-66969018 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1192009296 X:67250719-67250741 GTGCTCTATCCCAGGGAGATGGG - Intergenic
1192403736 X:70863077-70863099 GTGCTCTCTCCCAGGGTGATGGG - Intronic
1192637147 X:72830746-72830768 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1192644567 X:72890068-72890090 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1192686061 X:73306274-73306296 GCGCTCTGTCCCAGGGAGATGGG - Intergenic
1192707453 X:73541406-73541428 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1192741062 X:73893054-73893076 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1192953137 X:76039236-76039258 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1192958138 X:76095463-76095485 GTGCTCTCTCCTAGGGAGATGGG + Intergenic
1192966505 X:76182897-76182919 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1193003612 X:76591045-76591067 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1193043806 X:77031654-77031676 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1193062321 X:77220049-77220071 TGTCCCTCTCCCTGGGAGATTGG - Intergenic
1193071925 X:77315188-77315210 GTTCTCTGTCCCAGGGAGATGGG - Intergenic
1193079388 X:77390723-77390745 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1193081545 X:77411657-77411679 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1193161328 X:78232680-78232702 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1193228388 X:79013009-79013031 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1193266887 X:79482535-79482557 GTGCTCTCTCCCAGAGAGATGGG - Intergenic
1193352002 X:80474771-80474793 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1193361663 X:80586492-80586514 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1193382129 X:80827805-80827827 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1193510054 X:82388600-82388622 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1193514429 X:82446098-82446120 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1193793669 X:85847022-85847044 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1193830040 X:86279065-86279087 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1193878772 X:86896376-86896398 GTCCTCTGTCCCAGGGAGATGGG - Intergenic
1193897307 X:87129128-87129150 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1194021293 X:88695037-88695059 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1194203094 X:90978749-90978771 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1194242605 X:91470310-91470332 GTGCTCTTTCCCAGGGAGATGGG - Intergenic
1194391212 X:93319957-93319979 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1194419969 X:93661231-93661253 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1194515293 X:94844809-94844831 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1194559586 X:95403922-95403944 GGTGCCTGTCCCAGGGAGATGGG - Intergenic
1194624816 X:96215051-96215073 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1194753867 X:97714316-97714338 GGTCCCACTCCCAGGCTTATTGG - Intergenic
1194798354 X:98240456-98240478 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1194837431 X:98698729-98698751 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1194957977 X:100203301-100203323 GTTCCCTTTCTCAGGTAGATTGG - Intergenic
1195102340 X:101567379-101567401 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1195331753 X:103808688-103808710 GGGCCCACTCTCAGGGAGACAGG + Intergenic
1195414263 X:104602849-104602871 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1195469076 X:105212483-105212505 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1195580246 X:106493437-106493459 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1195774781 X:108391313-108391335 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1195833693 X:109088877-109088899 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1195882183 X:109603908-109603930 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1195948227 X:110238570-110238592 GTGCTCTGTCCCAGGGAGATAGG - Intronic
1195985609 X:110626839-110626861 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1196312422 X:114184005-114184027 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1196545684 X:116962194-116962216 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1196571315 X:117268870-117268892 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1196602908 X:117622704-117622726 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1196960182 X:120992669-120992691 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1197071242 X:122300202-122300224 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1197395557 X:125922951-125922973 GTGCTCTCTCCCAGGGAGATGGG + Intergenic
1197614264 X:128674641-128674663 GTGCCCTGTCCCAGGGAGACTGG + Intergenic
1197880716 X:131164028-131164050 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1197906294 X:131428787-131428809 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1198002230 X:132451287-132451309 GTGCTCTGTCCCAGGGAGATGGG + Intronic
1198085665 X:133279454-133279476 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1198223749 X:134626528-134626550 GCTGTCTCTCCCAGAGAGATGGG - Intronic
1198489978 X:137129958-137129980 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1198555851 X:137792555-137792577 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1198663514 X:138996701-138996723 GTGCTCTGTCCCAGGGAGATGGG - Intronic
1198758054 X:140001403-140001425 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1199012146 X:142770392-142770414 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1199436645 X:147819895-147819917 GTGCTCTGTCCCAGGGAGATGGG - Intergenic
1199881048 X:151974507-151974529 GCTCCCTCTCCCCGGGAGCCGGG - Intronic
1200504892 Y:3999914-3999936 GTGCTCTTTCCCAGGGAGATGGG - Intergenic
1200548926 Y:4554175-4554197 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1200732544 Y:6758257-6758279 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1201422254 Y:13812326-13812348 GTACTCTTTCCCAGGGAGATGGG + Intergenic
1201688756 Y:16737694-16737716 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1201848516 Y:18450853-18450875 GTGCTCTGTCCCAGGGAGATGGG + Intergenic
1201884800 Y:18869522-18869544 GTGCTCTGTCCCAGGGAGATGGG - Intergenic