ID: 1084602347

View in Genome Browser
Species Human (GRCh38)
Location 11:70153510-70153532
Sequence TGCTCGGCATAGAACAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084602347_1084602354 21 Left 1084602347 11:70153510-70153532 CCCCTCCTGTTCTATGCCGAGCA 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1084602354 11:70153554-70153576 AACCAGCACCCCTGAGCAAATGG 0: 1
1: 0
2: 0
3: 17
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084602347 Original CRISPR TGCTCGGCATAGAACAGGAG GGG (reversed) Intronic
900503900 1:3019693-3019715 TGCACGCTATCGAACAGGAGCGG + Intergenic
902046425 1:13528098-13528120 TGCCTGGGATAGAACAGGACAGG + Intergenic
904769997 1:32875847-32875869 TGGATGGCAGAGAACAGGAGTGG + Intergenic
904814021 1:33181911-33181933 TGACCGGCAGAGAAGAGGAGGGG + Intronic
905848991 1:41258866-41258888 TTCTAGGCATAGAAAATGAGGGG + Intergenic
906185114 1:43856691-43856713 TGGTGGGCAGAGAAAAGGAGAGG - Intronic
912382142 1:109253505-109253527 TGCCTGGCACAGAGCAGGAGGGG + Intronic
915544999 1:156592050-156592072 TGCGCGACAGAGAACACGAGGGG + Intronic
918217062 1:182400959-182400981 TGCTCGGAGTAGAAAAAGAGAGG + Intergenic
1063971850 10:11386642-11386664 TGCTCTGCATAAAAGAAGAGAGG + Intergenic
1065042621 10:21712871-21712893 TGCTCAGCATAGAGAAGGAGAGG - Intronic
1066669501 10:37821906-37821928 TTCTGGGCAGAGAACTGGAGAGG - Intronic
1067261813 10:44699592-44699614 TGCTCGGTATAAAAAAGGAGAGG + Intergenic
1073139975 10:101240791-101240813 TGGTCAGCATGGAACAGGAGAGG - Intergenic
1074868557 10:117559534-117559556 TGCTCTACATAGAACTGGAGGGG - Intergenic
1075569464 10:123529320-123529342 TGCTGGGCATAGGACAGGACAGG + Intergenic
1078656803 11:13248048-13248070 TACTATTCATAGAACAGGAGTGG - Intergenic
1079743608 11:24096765-24096787 TGCTCGGCAAAGATGAGGATTGG + Intergenic
1084602347 11:70153510-70153532 TGCTCGGCATAGAACAGGAGGGG - Intronic
1085549957 11:77359868-77359890 TGATCAGCAAAGAACTGGAGAGG + Intronic
1085735465 11:79035103-79035125 TGCTTGGCTCAGAACAGCAGAGG - Intronic
1088851399 11:113706274-113706296 TGCTGGCCTGAGAACAGGAGCGG - Exonic
1089333458 11:117706321-117706343 CTCTCAGCATAGAACAGGAGAGG - Intronic
1091155127 11:133365110-133365132 TGGTCGGCATTGCACAGCAGTGG - Intronic
1100541466 12:95561370-95561392 AGATCGGAATAGAACAGGACAGG + Intergenic
1104451239 12:128869756-128869778 AGCTCTGCACCGAACAGGAGGGG - Intronic
1105844948 13:24286170-24286192 CGCTCAGCATAGAGCACGAGTGG - Intronic
1105845994 13:24294269-24294291 TGTTCGGGAAAGGACAGGAGAGG - Intronic
1107897065 13:44975733-44975755 TGCTCAGCATATAAGAGGAAGGG - Intronic
1108591934 13:51920348-51920370 TGCCTGGCACAGAGCAGGAGTGG - Intergenic
1110136383 13:72072345-72072367 AGCTTGCCATAAAACAGGAGAGG + Intergenic
1111495235 13:89039442-89039464 TGCTTCACATAGAAGAGGAGAGG - Intergenic
1116756471 14:48954917-48954939 TGCTTGTCATACAACAGGATGGG + Intergenic
1117294677 14:54368397-54368419 TGTTGGGTATATAACAGGAGTGG - Intergenic
1121852671 14:97236466-97236488 TGCACCGCATAGGACAGCAGTGG - Intergenic
1123220511 14:106851266-106851288 TGCCCGGGAAAGAACTGGAGTGG - Intergenic
1125724605 15:41861916-41861938 AGCTCGGCCTGGAACAGGACTGG + Exonic
1127609014 15:60618917-60618939 TGCTCAGCATAAAAAGGGAGTGG + Intronic
1128236479 15:66071064-66071086 TGCTTGGCACAGAACAGGCGTGG - Intronic
1130361629 15:83192966-83192988 TACATGGAATAGAACAGGAGAGG - Intronic
1131704154 15:94974636-94974658 TGCTAGGGACAGAACAGGGGAGG - Intergenic
1134611015 16:15607747-15607769 TGCTCTGCCTAGGACAGGAAGGG + Intronic
1141571163 16:84934379-84934401 GGCTTGGCACAGAACAGCAGGGG - Intergenic
1142521408 17:507435-507457 TCCCCGCCATAGAAGAGGAGCGG - Intergenic
1144362407 17:14507879-14507901 TGCAAGGCATAGATCTGGAGGGG + Intergenic
1149096365 17:52845903-52845925 TGCTGGGGACAGAGCAGGAGAGG - Intergenic
1149339811 17:55673648-55673670 TGCTTGGGATAGAACAGAATTGG + Intergenic
1160265929 18:77340914-77340936 TGCTGGGCACAGAGCAGGATGGG - Intergenic
1161399458 19:4060924-4060946 TGCTCTGCACAGCACATGAGGGG - Intronic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
925628817 2:5868348-5868370 TGCTCTGCAGAAAACAGGGGAGG + Intergenic
926884899 2:17588029-17588051 TGCTAGGCACAAAACAGGACTGG - Intronic
931170451 2:59797940-59797962 TGCACGGCACAGGACAGCAGAGG + Intergenic
931665678 2:64608423-64608445 TGCTGGGGATAGAACACGGGTGG + Intergenic
938764545 2:134451518-134451540 TGCCCTGCATGGAAGAGGAGAGG + Exonic
940692841 2:156941017-156941039 TGCTGGGGATAGAAAAGGAAGGG - Intergenic
941252205 2:163179578-163179600 TGCTTGGTATAGGACAGGTGCGG - Intergenic
946414640 2:219533705-219533727 TGCAGGGCAGAGAACAGGGGAGG + Intronic
946629893 2:221655758-221655780 TGCCTGGAATAAAACAGGAGGGG + Intergenic
949005709 2:241645960-241645982 TGCTTGGCAGTGAACAGGAGTGG - Intronic
1168749354 20:271161-271183 TGCTGGGAAGAGAGCAGGAGGGG + Exonic
1174453336 20:50632930-50632952 GGCTCAGCACAGCACAGGAGGGG - Intronic
1175563748 20:59955478-59955500 TGCTCAGAATAGAAAGGGAGTGG + Intergenic
1178386055 21:32151560-32151582 TGCTGGGCATGGAGCAGGCGGGG - Intergenic
1183256766 22:36767353-36767375 TCCTCGGCAGACAACAGGAATGG - Exonic
1184768993 22:46587145-46587167 TGCTCAGCTGACAACAGGAGTGG + Intronic
953772351 3:45787513-45787535 TGCTCTGCTTAGAACAGCACTGG + Intronic
956804418 3:72794897-72794919 TTCTGGGAATTGAACAGGAGAGG - Intronic
959565141 3:107826035-107826057 TGCCCCGCATAGAGGAGGAGAGG + Intergenic
965080149 3:164023399-164023421 TCCTCGGCCTAGAACGGGGGTGG + Intergenic
969912945 4:10461777-10461799 TGCGCGGCACAGAACAGGCTTGG + Intergenic
994541583 5:101105607-101105629 TGCTAGGCATAAATCAGGACAGG + Intergenic
1000760519 5:165218067-165218089 AGGTCGGAATAGAACAGGACAGG + Intergenic
1001132078 5:169072677-169072699 GGGTCAGCATAGAACAGTAGGGG + Intronic
1016569937 6:145500526-145500548 TGATGGGGATAGATCAGGAGGGG - Intergenic
1017043447 6:150325827-150325849 TCCTGAGAATAGAACAGGAGGGG + Intergenic
1022288321 7:28976501-28976523 TTCTCGTCAGAGAGCAGGAGAGG - Intergenic
1038649581 8:29390394-29390416 TGCTGGGAATACAACAGGAAAGG - Intergenic
1043420127 8:80089169-80089191 TGCCCTGCATGGAACAGAAGCGG + Intronic
1044430284 8:92101074-92101096 TCCTTTGCATAGAACAGGAGTGG - Intronic
1045892236 8:107170561-107170583 TGCTGGGGTTAGAAGAGGAGAGG - Intergenic
1052472983 9:28923604-28923626 TACTTGGCATACAACAGGATGGG + Intergenic
1052978202 9:34427594-34427616 TGCTTGGCATAGAAAATGAAAGG + Intronic
1057702996 9:97376997-97377019 TGCCCGGCACAGAGCAGGGGTGG - Intronic
1062272803 9:135717530-135717552 GGCTGGGCACAGTACAGGAGTGG + Intronic
1198025420 X:132701287-132701309 TTCTTGACATAGAAAAGGAGTGG - Intronic
1199534638 X:148888713-148888735 TGCCTGGCATAGAGCAAGAGTGG - Intronic
1199679741 X:150216333-150216355 TGCTGGGCATTGGACAGGATGGG - Intergenic
1199695490 X:150340716-150340738 TGCTGGGCATTGGACAGGATGGG + Intergenic
1199871245 X:151900803-151900825 TGCTTGGCACAGAGGAGGAGTGG - Intergenic