ID: 1084603136

View in Genome Browser
Species Human (GRCh38)
Location 11:70158459-70158481
Sequence CTGTATCAGCAGGAGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 335}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084603136_1084603144 24 Left 1084603136 11:70158459-70158481 CCATCCCCCTCCTGCTGATACAG 0: 1
1: 0
2: 3
3: 20
4: 335
Right 1084603144 11:70158506-70158528 TCTCCTCCAGTGCCAGCCAGAGG 0: 1
1: 0
2: 2
3: 22
4: 298
1084603136_1084603148 30 Left 1084603136 11:70158459-70158481 CCATCCCCCTCCTGCTGATACAG 0: 1
1: 0
2: 3
3: 20
4: 335
Right 1084603148 11:70158512-70158534 CCAGTGCCAGCCAGAGGTGGTGG 0: 1
1: 0
2: 4
3: 58
4: 468
1084603136_1084603142 -6 Left 1084603136 11:70158459-70158481 CCATCCCCCTCCTGCTGATACAG 0: 1
1: 0
2: 3
3: 20
4: 335
Right 1084603142 11:70158476-70158498 ATACAGAAACTAAAGCCAGAAGG 0: 1
1: 0
2: 2
3: 34
4: 873
1084603136_1084603146 27 Left 1084603136 11:70158459-70158481 CCATCCCCCTCCTGCTGATACAG 0: 1
1: 0
2: 3
3: 20
4: 335
Right 1084603146 11:70158509-70158531 CCTCCAGTGCCAGCCAGAGGTGG 0: 1
1: 1
2: 0
3: 43
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084603136 Original CRISPR CTGTATCAGCAGGAGGGGGA TGG (reversed) Intronic
900499847 1:2998652-2998674 CTGGAGCAGGAGGAGGGGCAGGG + Intergenic
901826911 1:11868071-11868093 CAGTATCAAGAGGAGGGAGAAGG - Intergenic
902571062 1:17347436-17347458 CTGGAGCAGCAGGAGGAGCACGG - Intronic
903266796 1:22162712-22162734 CAGTGTCCGCAGGAAGGGGATGG + Intergenic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
905205600 1:36341261-36341283 CTGGATCAGAAAGAGAGGGACGG + Exonic
905228063 1:36492869-36492891 CTGTGGCAGGAGGATGGGGATGG + Intergenic
907182921 1:52586588-52586610 CTCAATCAGAAGGTGGGGGAAGG + Intergenic
907330069 1:53664939-53664961 CTGTGGCAGGAGGAGGGGGAGGG + Intronic
909162549 1:72172081-72172103 ATGAATCAGCAGTAGGTGGAAGG + Intronic
909288699 1:73854686-73854708 CTGTATCTGCAGGTGGTGGTGGG - Intergenic
910120330 1:83781616-83781638 GAGTATCAGCAGGATGGGGTGGG + Intergenic
910436548 1:87211430-87211452 CTGTATCCTCAGCTGGGGGAAGG + Intergenic
910746472 1:90580319-90580341 CTGCAGCAGCTGCAGGGGGAGGG - Intergenic
911904806 1:103553383-103553405 CTGGATCAACAGGTGGGGGAAGG - Exonic
912671246 1:111628300-111628322 CAGTGGCAGCAGGAGGGGAATGG + Intronic
914988399 1:152478688-152478710 CTCTAACAGGAGGAGGGGGTGGG + Intergenic
915553817 1:156650237-156650259 CTGGATCATGAGGAGGGGCAGGG + Intronic
915804187 1:158827813-158827835 CTTTATCAGCAGGATGAAGATGG - Intergenic
916217703 1:162411643-162411665 CTGCAGCAGCAGGAGGGACATGG - Intronic
916220599 1:162440948-162440970 CTGTAGCAGCAGGAGGGATGTGG - Intergenic
917489212 1:175483390-175483412 CTGTAAGAGCAGGTGGGGCAGGG + Intronic
921266194 1:213422726-213422748 CTGTATTAGAAGGAAGGAGAAGG + Intergenic
921540306 1:216406028-216406050 CTGTGGCAGCAGTAGGGGAAGGG + Intronic
922247727 1:223817193-223817215 CTGCATGTGGAGGAGGGGGAGGG + Intronic
922773929 1:228206533-228206555 CTCAATCAGAAGGAGGGTGAGGG - Intronic
922994249 1:229943595-229943617 CTGCATCACCAGGGGAGGGAGGG + Intergenic
924955045 1:248917947-248917969 CTGTATCAGGAGAAGGTGGGTGG + Exonic
1063099313 10:2935720-2935742 CAGCATCAGCAGGTTGGGGAAGG + Intergenic
1063182183 10:3613796-3613818 CTGTACCAGAAGGGAGGGGAGGG + Intergenic
1063802285 10:9594057-9594079 CTGTATCTTCACAAGGGGGAAGG + Intergenic
1066676348 10:37891504-37891526 CTGTATCTGCAGGTGTGGCAGGG + Intergenic
1066964306 10:42247398-42247420 CAGTGCCAGCAGGAGTGGGATGG + Intergenic
1067206590 10:44221068-44221090 CTGCACCAGCAGGGGTGGGAAGG - Intergenic
1068798172 10:61107474-61107496 CCTTACCAGCAGGAGGGGAAAGG + Intergenic
1071239675 10:83691857-83691879 CTGTCACTGCAGAAGGGGGAGGG - Intergenic
1071712383 10:88062337-88062359 CTGTGTGAGGAGGTGGGGGATGG - Intergenic
1072039064 10:91590482-91590504 CTGGACCCGCAGGATGGGGAGGG + Intergenic
1072251777 10:93587371-93587393 CTGGATCAGGATGAGGAGGATGG - Exonic
1072463988 10:95646335-95646357 CTGTATCAGGAGAAGAGGGTGGG + Intronic
1072619148 10:97068273-97068295 ATGTATGGCCAGGAGGGGGAGGG - Intronic
1072764411 10:98083992-98084014 CTGTCTCTTCAGGAGGTGGAAGG + Intergenic
1073143170 10:101262231-101262253 CTGAAGCATCAGGAGGGAGAGGG - Intergenic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1076822411 10:132945978-132946000 GAGTGTCAGCAGGAGGGGGTGGG + Intergenic
1077134926 11:993744-993766 CTGGATCAGCGGGCTGGGGACGG - Exonic
1077581282 11:3418826-3418848 CTGCTGCAGCAGGAGGGGGGCGG + Intergenic
1080394208 11:31875063-31875085 CAGGAGCAGCAGGAGGGGGAAGG - Intronic
1082674154 11:56075112-56075134 CTGTGGCAGGAGGATGGGGAGGG - Intergenic
1082796306 11:57380523-57380545 CTGTATCAGCTAAAGAGGGAAGG + Intronic
1083744940 11:64730166-64730188 CTGCATCAGCAGGGAGGAGATGG - Exonic
1084399883 11:68937347-68937369 CTGCAGCAGCAGGAGGGGCCTGG + Intronic
1084412627 11:69013282-69013304 CTGGCCCGGCAGGAGGGGGAGGG + Exonic
1084603136 11:70158459-70158481 CTGTATCAGCAGGAGGGGGATGG - Intronic
1084621042 11:70270578-70270600 CTGTCTCCTCAGGAGGGGGCGGG - Intergenic
1084953584 11:72679773-72679795 CTGTCTCAGTTGGAGGAGGAAGG - Intergenic
1085842071 11:80023587-80023609 GTGTGTCATCAGGAGGAGGATGG - Intergenic
1087225203 11:95591555-95591577 CTGTCTCTGCAGGAGAGAGAGGG + Intergenic
1087231559 11:95671781-95671803 CTGTATCAGAAGGAAGAAGAAGG + Intergenic
1089677050 11:120097127-120097149 CCCTCGCAGCAGGAGGGGGAAGG + Intergenic
1089749996 11:120644607-120644629 ATGTCTCAGGAGGAGGAGGAAGG + Intronic
1090391774 11:126393460-126393482 ATGGCTCAGGAGGAGGGGGATGG + Intronic
1090402847 11:126460103-126460125 CGGGAGCAGGAGGAGGGGGAAGG + Intronic
1091590377 12:1839171-1839193 CTCTCGCAGCAGGATGGGGACGG - Intronic
1091605632 12:1949164-1949186 CTGTATGGGCAGGAGGAGGCTGG + Exonic
1091784797 12:3236770-3236792 CAGGTTCAGCAGGAGGGAGAGGG + Intronic
1093243134 12:16702094-16702116 CTGGGACAGCAGGAGGGAGAGGG + Intergenic
1094214253 12:27923563-27923585 AAGTATCAGCTGGAGGGAGAAGG - Intergenic
1096112546 12:49038037-49038059 AGGCATCAGCAGCAGGGGGAGGG + Exonic
1096868408 12:54578495-54578517 CTGTATCAGAAAGGGAGGGAAGG - Exonic
1097301726 12:58026294-58026316 CTGATTCAGCAGGACTGGGATGG + Intergenic
1097797674 12:63880973-63880995 CCGGATCAGGAGTAGGGGGAGGG + Intronic
1098568227 12:71959078-71959100 CAGTATAAGCAGGAAGAGGAGGG - Intronic
1099464441 12:82965772-82965794 CTGGATCAGAACAAGGGGGAGGG - Intronic
1099978541 12:89571649-89571671 CTGACTCAGAGGGAGGGGGAGGG + Intergenic
1099998191 12:89802692-89802714 CTGGATAACCAGGAGAGGGATGG - Intergenic
1100179071 12:92064291-92064313 CTGTATGATCAGGAAGGGAATGG + Intronic
1100562078 12:95757276-95757298 CTGTATCTGAAAGAGGGGAATGG - Intronic
1102205000 12:111084192-111084214 CTGAATCAGCAGGAGTGGAGTGG + Intronic
1104923353 12:132302794-132302816 CTGTGGCAGCAGAAAGGGGACGG + Intronic
1107719076 13:43229272-43229294 CTTTATCAGCAGCATGGGAATGG + Intronic
1108046253 13:46387234-46387256 CGGTAACAGCAGAAAGGGGAGGG + Exonic
1109351989 13:61194617-61194639 TTGTTTCAGCAGTAGGGAGAAGG - Intergenic
1110098260 13:71559956-71559978 CTGCACCAGCAAGAGAGGGAAGG + Intronic
1111777321 13:92681038-92681060 CTGGATCAGCAACAGGGGAAAGG - Intronic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1114992275 14:28301298-28301320 CGGCACCAGCAGGAGGTGGAAGG - Intergenic
1118256422 14:64209707-64209729 CTGTCTCAGCAGCTGGGGGCAGG - Intronic
1118753557 14:68822899-68822921 CTGTGACAGCAGCAGGGGGTGGG - Intergenic
1119764054 14:77177245-77177267 CTTTATCAGCAGCATGAGGACGG - Intronic
1120169452 14:81234282-81234304 TTGCTTCAGCTGGAGGGGGAGGG + Intergenic
1120631991 14:86902818-86902840 CAGTAGAAGCGGGAGGGGGAGGG + Intergenic
1121793926 14:96720240-96720262 CTGCACCAGCAGGAATGGGAGGG + Intergenic
1121950591 14:98167791-98167813 CTGGATCGGAAGGAGGGGTAGGG - Intergenic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1124368757 15:29091415-29091437 CTGTCTGAGCAGGTGAGGGAGGG + Intronic
1124723244 15:32131973-32131995 CTGAAACAGCAGGAGGCGGCTGG + Intronic
1124811601 15:32944661-32944683 CTGTCTCGTCAGGATGGGGATGG - Intronic
1124848776 15:33315755-33315777 CCGCATCAGCAGTAGGGGGGTGG + Intronic
1125501028 15:40240386-40240408 GTGTGTCAGGAGGAGGGGGGAGG + Intronic
1125594959 15:40878938-40878960 TTTTGTCAGCAAGAGGGGGAGGG + Intergenic
1127674474 15:61227425-61227447 CGGTTTCAGCGGGAGGGGGGCGG - Intronic
1128727098 15:69996278-69996300 CTGTGTCAGCATTTGGGGGAAGG + Intergenic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129709999 15:77816098-77816120 CTGTTTCAGAAGGAGGGGACTGG - Intronic
1130441601 15:83960354-83960376 CTGGACCAGAATGAGGGGGAAGG + Intronic
1131017857 15:89072512-89072534 AAGGATGAGCAGGAGGGGGAGGG + Intergenic
1131365196 15:91833198-91833220 CCCTTTCAGCAGAAGGGGGATGG - Intergenic
1131809220 15:96154993-96155015 GTGTATATGCAGGAGGGGAAGGG + Intergenic
1131933100 15:97467975-97467997 ATGTATCTGCAGGAGGGGGATGG + Intergenic
1132931816 16:2462544-2462566 CTGTATCAGGAGGAGTGTGGAGG + Intronic
1133234845 16:4382950-4382972 GTGTGGCAGCAGGAGGGGGCTGG - Exonic
1138194874 16:55044656-55044678 CTGGCTCTGCAGGAGAGGGAGGG - Intergenic
1138202744 16:55102118-55102140 CTGGATCAGCAGGAGGGAAGGGG - Intergenic
1138395676 16:56702702-56702724 CTTTAGCAGCAGGAAGGGTAGGG - Intronic
1139582189 16:67880292-67880314 CAGGATCAGCAGCAGGGGGCTGG - Intronic
1139649360 16:68354713-68354735 CCGTATCAGCAAGAGGGGACAGG - Intronic
1140854709 16:78967881-78967903 CAGTAGCTGCAGGAGGAGGAGGG + Intronic
1141777521 16:86134258-86134280 CTGTATCAGCAGGATGTGCCTGG - Intergenic
1141824307 16:86468330-86468352 CTGACTCTGCAGGATGGGGAGGG - Intergenic
1142107851 16:88315864-88315886 GTGACTCAGCAGGAGGGGGAGGG - Intergenic
1142748460 17:1972950-1972972 CTGGAGCAGCAGGTGGGGGTCGG - Intronic
1143003699 17:3812930-3812952 CTGTGTGAGCAGGAGCGAGAGGG + Exonic
1143315933 17:6033480-6033502 CTGAACCTGCAGGTGGGGGATGG + Intronic
1145089918 17:19977888-19977910 CTGCACCCGCGGGAGGGGGATGG - Intronic
1145865981 17:28241928-28241950 CTGTATGAGGAGCCGGGGGATGG - Intergenic
1145975004 17:28978810-28978832 CTGCATCATCAGGGGAGGGATGG + Intronic
1146286314 17:31576383-31576405 CTGTATCTGCAGGGTGGGGCTGG - Intergenic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1147243411 17:39105495-39105517 CTTTATCACCTGGAGTGGGAAGG + Intronic
1148159826 17:45443605-45443627 CTCTCTCAGCAGGGTGGGGATGG + Intronic
1148698775 17:49576139-49576161 CTGAAGGAGCAGGAAGGGGAAGG + Exonic
1148799375 17:50213751-50213773 CTGGGTCAGGAGGAGGGGGCAGG - Intergenic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1148912083 17:50948282-50948304 CAATATTTGCAGGAGGGGGAAGG - Intergenic
1150229923 17:63544232-63544254 CTGCATCTGCAGGAGGGAAAGGG - Exonic
1151297493 17:73196102-73196124 CTGTATCCTCACGTGGGGGAAGG + Intronic
1151549700 17:74815021-74815043 CTTTGCCAGCAGGAGGGTGAAGG + Intronic
1151743567 17:76000230-76000252 CTGTACAAGCAGGAGCGGGGCGG + Exonic
1152011541 17:77721874-77721896 CTGGCTCAGGAGGAGGGGAAGGG + Intergenic
1152176692 17:78792572-78792594 CTGAATCAGAATGCGGGGGAAGG + Intronic
1152407489 17:80105909-80105931 CTGTGCCAGCATGATGGGGAGGG + Intergenic
1152643225 17:81457769-81457791 CTGGGTAATCAGGAGGGGGAGGG + Intronic
1152643250 17:81457830-81457852 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152643321 17:81458010-81458032 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152989582 18:350410-350432 CTTTATCAGCAGCATGGGAACGG + Intronic
1154162295 18:11989619-11989641 CTGTCTCAGAAGAAGGGGGAGGG + Intronic
1155086887 18:22467603-22467625 CAGGAGCAGCAGGAGGGGGCTGG + Intergenic
1156832960 18:41516872-41516894 CTGTATAAGCAGGAGAAGAATGG - Intergenic
1156858403 18:41809732-41809754 ATGGATCAGCAGGAGTGTGAAGG - Intergenic
1157441777 18:47717158-47717180 ATGGATCAGCTGCAGGGGGAAGG + Intergenic
1157485367 18:48083459-48083481 CTGTATGAGGAGGTGTGGGATGG - Intronic
1157776934 18:50403202-50403224 CTCTCTCAGCAGGAGGAGGGGGG - Intergenic
1158894601 18:61901173-61901195 CTGGAGCAGCAGGAGGGGAGGGG - Intergenic
1159967738 18:74612278-74612300 CTGTATAAGAAGGAAGGTGATGG + Intronic
1160099910 18:75910798-75910820 CTGTATTATCATGTGGGGGAGGG - Intergenic
1161486121 19:4536801-4536823 CTGTATCAGCAGGTGGGCCCGGG + Exonic
1161663554 19:5561400-5561422 CTGGAACAACAGGAGGGGAAGGG + Intergenic
1161730787 19:5959358-5959380 CTGCGTCTGCAGGAGTGGGATGG - Intronic
1161737528 19:6000774-6000796 CTGTATCAGCAGCATGAGAATGG + Intronic
1161915408 19:7224613-7224635 CTGTCTCTGCCGGAGGGCGATGG + Intronic
1162387474 19:10368521-10368543 CTGAAGCTGCAGGTGGGGGAGGG - Intronic
1165272772 19:34724775-34724797 CTCTCTCAGCAGGAGGAGGGGGG - Intergenic
1165773201 19:38389971-38389993 AGGGATAAGCAGGAGGGGGAGGG + Intronic
1166472519 19:43091336-43091358 GTATATCAGCTGGAGGGGAAGGG + Intronic
1166545805 19:43634523-43634545 CTGACTCCTCAGGAGGGGGAGGG - Intronic
1166911148 19:46158858-46158880 TTGTGGCAGCAGGTGGGGGATGG + Intronic
1167146103 19:47681375-47681397 CTGTGGCAGCTGGGGGGGGAAGG + Intronic
1167593708 19:50417083-50417105 CTGTATCAGAAGGAGGTGAGAGG + Exonic
926318786 2:11733187-11733209 TTGGATCAGCTGCAGGGGGAAGG - Intronic
927619165 2:24634200-24634222 CTCTATCAAGGGGAGGGGGAAGG + Intronic
929376977 2:41299298-41299320 GTGTATGTGCAGGAGGTGGAGGG - Intergenic
929828943 2:45332073-45332095 CTGTAACACCAGGAGGAGGAAGG + Intergenic
930468473 2:51783167-51783189 CTGGAGCAGCTGGAGAGGGAGGG - Intergenic
931991785 2:67797475-67797497 CTGATGCAGCAGGAGGGGGTGGG + Intergenic
933296844 2:80500684-80500706 TTCTGTCAGCAAGAGGGGGAGGG - Intronic
935443951 2:103136999-103137021 CTACTTCAGCAGGATGGGGATGG + Intergenic
936489358 2:112957135-112957157 CAGTAAGAGCAGGAGGGTGAAGG - Intergenic
937971404 2:127552048-127552070 CAGTATTCGCAGGAGGGTGACGG + Intronic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
938389918 2:130896984-130897006 CTGGATCACCAGGCTGGGGAAGG + Intronic
940733172 2:157418343-157418365 CTGTATTTGGAGGAGGGGTAAGG - Intronic
941733818 2:168949807-168949829 TTGAATCAGCAGTATGGGGAAGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942306393 2:174611499-174611521 TGGTATCAGGAGGAGGAGGAGGG + Intronic
943635377 2:190301233-190301255 CTTTATCTGCAGGGAGGGGAAGG + Intronic
944684886 2:202109552-202109574 CAGAATCAGCAGGAAGGAGAAGG - Intronic
945056405 2:205873052-205873074 ATGTACCAGCAGGACTGGGAGGG + Intergenic
947718390 2:232352939-232352961 CTGGATCAGGAGCTGGGGGAAGG - Intergenic
947887733 2:233588150-233588172 CTGTAACTGAAGGAGGGTGAAGG - Intergenic
1169447930 20:5688052-5688074 TTGCATGAGCAGGAAGGGGAAGG - Intergenic
1170506505 20:17031170-17031192 CTGTATGAGTAGGGGTGGGAGGG + Intergenic
1170532997 20:17313381-17313403 CAGGAGCAGCAGGAGTGGGAGGG - Intronic
1171087434 20:22250622-22250644 CTGGAGCAGGAGGAGGGAGAGGG + Intergenic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1172583584 20:36066530-36066552 CTGTACCAGAATAAGGGGGAAGG + Intergenic
1173810855 20:45954213-45954235 TTATCACAGCAGGAGGGGGATGG + Intronic
1174105749 20:48161162-48161184 CTGGATGAGCAGGAGGGTAAAGG - Intergenic
1175073392 20:56353616-56353638 CAGGAGCAGCAGGAGGGGGTGGG - Intergenic
1175709110 20:61205169-61205191 CTGTTTCATCAGGAGGATGAGGG + Intergenic
1175959238 20:62626635-62626657 CTGGAAGAGCAGGAGGGGGAGGG - Intergenic
1175979139 20:62728229-62728251 CTTGATCAACAGGAGGGAGATGG + Intronic
1175992821 20:62797853-62797875 CTGTGGCAGCAGGAGGTGGTGGG + Intronic
1176233775 20:64044905-64044927 CTGACTCAGCAGGAGGAGGGTGG + Intronic
1179080555 21:38166704-38166726 CTGCACCTGCAGGAGGAGGAGGG + Intronic
1179162412 21:38909309-38909331 CTATCTCAGCAGGAGGGAAAAGG + Intergenic
1179163648 21:38918095-38918117 CTATATTAGCAGGAGGGAGGAGG + Intergenic
1179479929 21:41670532-41670554 CTGCAGCAACAGGAGGTGGAGGG + Intergenic
1180974360 22:19839120-19839142 ATGGATCAGAAGGAGGGGGAGGG + Intronic
1181323029 22:22023185-22023207 CGGAATGAGCAGGAGGGCGATGG + Intergenic
1181570454 22:23765436-23765458 TTGCATCAGCAAGAGGGGCAAGG + Intronic
1181683744 22:24514479-24514501 CAGGATCAGGAGGAGGTGGAAGG + Intronic
1183438121 22:37807093-37807115 TTGTAGCTGCGGGAGGGGGAGGG + Exonic
1184591017 22:45483367-45483389 ATGTAGCAGCAGCAGTGGGAAGG - Intergenic
1185375263 22:50479912-50479934 GTGTGTCAGCAGGAGGGTTACGG + Intergenic
950748051 3:15106388-15106410 CTGTAACAGCAGGCCGGGCACGG - Intergenic
950963827 3:17132196-17132218 CAGTGTCAGCAGGAAGCGGAGGG - Intergenic
951008479 3:17647633-17647655 CTGTGACTGCAGTAGGGGGAAGG + Intronic
952840728 3:37643148-37643170 TTGGCTCAGCAGGAGGGGAAAGG + Intronic
952860118 3:37806160-37806182 CTGTCTCAGCAGGAAGGAGTTGG - Intronic
953158669 3:40398105-40398127 CTATATCAGCAGGTGCCGGAGGG + Intronic
953768590 3:45762129-45762151 CTGATTCAGCAGGATGGGGTGGG + Intronic
954588019 3:51753739-51753761 TTGCTTCAGCTGGAGGGGGAGGG + Intergenic
954806454 3:53223676-53223698 CTTTACCAGCAGGGGTGGGAGGG + Intergenic
955348299 3:58176902-58176924 CAGTATCAGTAGGAGTGGGTGGG + Intergenic
955748259 3:62161702-62161724 CTGTAGCCACAGGAGGGGCATGG + Intronic
955988575 3:64601008-64601030 ATGGAACTGCAGGAGGGGGAGGG - Intronic
957041272 3:75337241-75337263 CTGAACCAGGAGGAGGGGAAGGG + Intergenic
957385049 3:79485661-79485683 CTGTATCTGCAAAATGGGGATGG - Intronic
959894949 3:111594943-111594965 CTGTTTCAGCAGGAGGAGCTGGG + Exonic
961046080 3:123708896-123708918 CTGAACCAGGAGGAGGGGAAGGG + Intronic
961225530 3:125241957-125241979 TTATCTCAGCAGGAGGTGGATGG + Intronic
962827051 3:139107901-139107923 CTGCATTAGAAGGCGGGGGATGG - Intronic
963367910 3:144362554-144362576 CTGAATCAGTAGGTGGGGGTGGG - Intergenic
964385109 3:156138917-156138939 CTCCATCAGCAGGACGGGGCAGG + Intronic
965994400 3:174862292-174862314 CTGTAACAGGAGTAGAGGGAGGG + Intronic
966912674 3:184568343-184568365 ATGTATCTGCAGGAGGCAGAGGG - Intronic
967381434 3:188863516-188863538 CAGTGTCAGGAGGAGGGGGCTGG - Intronic
967805520 3:193711616-193711638 CTGCATCAGCTGGACAGGGAGGG - Intergenic
968297799 3:197591085-197591107 CTGTTAGAGCAGGAAGGGGAGGG - Intergenic
968707512 4:2087077-2087099 CTTTGTCAGCAAGAGTGGGAAGG + Intronic
968930331 4:3575559-3575581 CTGTTCCAGCGGGAGGGGTATGG - Intergenic
969457458 4:7308299-7308321 CTGGAGCAGCAGAAGGGGCAGGG - Intronic
969497611 4:7535027-7535049 GTGTGTCAGCAGGAGGAGGAGGG - Intronic
971054539 4:22897689-22897711 CTGCATCACCACTAGGGGGAGGG + Intergenic
971464057 4:26935609-26935631 CTGAATCAGCAGCTTGGGGATGG + Intronic
971899969 4:32646695-32646717 CTGAAACAACAGGAGGGTGAGGG - Intergenic
973323292 4:48831485-48831507 CTGTAACGGCAGGTGGGAGACGG + Exonic
973673650 4:53241749-53241771 GTGCAGCAGGAGGAGGGGGAGGG - Intronic
974483513 4:62476116-62476138 CTATAGCAGTGGGAGGGGGAAGG - Intergenic
974694768 4:65352015-65352037 CTGTAACAGCAGATGGGAGACGG + Intronic
976795342 4:88925890-88925912 CTGTACCTGGAGGATGGGGAGGG + Intronic
978745986 4:112194890-112194912 CTGTCTCAGCAGGAGTGGTTGGG + Exonic
982463738 4:155704495-155704517 CTGCATCAGGAGGAGGTAGAAGG + Intronic
982884654 4:160763411-160763433 GTTTATTAGCAGGAAGGGGAGGG + Intergenic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
984764591 4:183390052-183390074 CTGAATCTGCAAGAGGGGGCAGG + Intergenic
985190837 4:187370926-187370948 ATGTGTCAGCTGGAGGGGAATGG + Intergenic
985998362 5:3610524-3610546 CTGTTTCAGCAGGAGTGGAGTGG + Intergenic
986468506 5:8050689-8050711 CTGTATAAGAAGGAGAAGGAAGG + Intergenic
987137890 5:14916879-14916901 CTTTATCAGCAGCAGGAGAATGG + Intergenic
988006492 5:25418476-25418498 CTGGAGCAGGAGGAAGGGGAGGG + Intergenic
993224732 5:85153304-85153326 CTGCCTGAGCAGGATGGGGAAGG - Intergenic
994497794 5:100535577-100535599 CAGCAACAGCAGGAGGAGGACGG - Exonic
995300167 5:110570913-110570935 GTGTATTAGCAAGAGGGGGTGGG - Intronic
997419087 5:133751644-133751666 CGGTAGCAGATGGAGGGGGAGGG + Intergenic
998565795 5:143214805-143214827 CTGGGTCAGCAGGAGTGGGAGGG + Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
1000658812 5:163914994-163915016 CTGTTTCAGCAGGGTGTGGAGGG - Intergenic
1001565150 5:172695291-172695313 CATTGTCAGGAGGAGGGGGAGGG + Intergenic
1001852500 5:174981700-174981722 CTTTAGCAGCAGGAGGAAGAGGG - Intergenic
1002578714 5:180194152-180194174 CTGTGTGAGCCGGACGGGGAGGG + Intronic
1003110380 6:3247991-3248013 CCGTTTCAGCAGGAGAGAGACGG + Intronic
1003644519 6:7903749-7903771 CTGTTTCTGAAGGAGGTGGAGGG - Intronic
1004653477 6:17634840-17634862 CTGTATCAGCAGGGGAGGCGGGG + Intronic
1004698564 6:18057248-18057270 CAGGAACAGCAGGAGGGGGATGG - Intergenic
1005654429 6:27919534-27919556 CAGTATCAGGAGGAGAAGGAGGG + Intergenic
1006430448 6:33992731-33992753 CTCAATGAGCAGGAGGGTGAGGG - Intergenic
1006516058 6:34546363-34546385 CTGGGACAGCAGGAGGGGAAGGG + Intronic
1007118628 6:39362297-39362319 CTAGAACAGCAGGAGGAGGAGGG - Intronic
1007521958 6:42456911-42456933 CTGCATCAGAAGGAGTGGCATGG + Intergenic
1008379787 6:50827989-50828011 CAGCATCAGCAGGACTGGGAGGG + Intronic
1009491868 6:64301700-64301722 GTTTATCAGCAGGAAGGGCAAGG - Intronic
1011921797 6:92586658-92586680 CTGTAAGGGCAGGAGTGGGAGGG + Intergenic
1014734494 6:125076634-125076656 CTGTATCAGCAAGAGAGGGAAGG - Intronic
1016075336 6:139788794-139788816 GTGTACCAGCAGGAGAGGGTAGG + Intergenic
1016648226 6:146434539-146434561 GTGTATGAGCACGAGCGGGAAGG + Exonic
1017446338 6:154510298-154510320 CTGTGGCAGCTGGAGGGAGAGGG - Exonic
1017929551 6:158939825-158939847 CTGTTCGAGCAGGAGGGCGATGG - Intergenic
1018792856 6:167162688-167162710 ATGTATGGGCAGGAGGGGTATGG + Intronic
1019100646 6:169626464-169626486 CTGCACCAGCAGGAGGGGCCTGG - Intronic
1019135440 6:169904868-169904890 CTGGAGCTGCAGGAGGGGCAGGG + Intergenic
1019625689 7:2014632-2014654 CTGTGTCCACAGGAGCGGGACGG - Exonic
1022232003 7:28423391-28423413 GTGTTTCAGGAGGAGGGTGAGGG + Intronic
1022320413 7:29282941-29282963 CAATATCAGCAGGTGGTGGATGG + Intronic
1022626810 7:32045077-32045099 ATGTATCAGCAGGAGTCGGTGGG - Intronic
1023055578 7:36287299-36287321 CTATATAAGAAGGAGGTGGAAGG - Intronic
1024041454 7:45559215-45559237 CAGTTTCAGCAGGAGAGGGTTGG - Intergenic
1024903330 7:54347386-54347408 CTGTGTGAGCCGGTGGGGGAGGG + Intergenic
1024997105 7:55280237-55280259 CTGGGTCTGCAGGAGGGGGTTGG - Intergenic
1029375300 7:100173859-100173881 CTGTCTCAGCAGCAGGGGACTGG - Exonic
1029855778 7:103515407-103515429 CTTTAGCATCAGGAGGGAGAAGG + Exonic
1030322927 7:108188073-108188095 CTGTAACAGGAAGTGGGGGAGGG + Intronic
1031417581 7:121511246-121511268 CTGTAAGAGGAGGAGGGGGTAGG + Intergenic
1032370658 7:131347539-131347561 CTGTGTCAGTAAGAGGGGGCAGG - Intronic
1034421297 7:150992458-150992480 CTGTCTCAGGAGGAGGGAGATGG - Intronic
1035901396 8:3461580-3461602 CTCCATCAGCAGGAAGAGGAAGG + Intronic
1036584116 8:10107074-10107096 CTGTATCATCAGCTGGGTGATGG - Intronic
1036796868 8:11762522-11762544 CTGTGTCAGAGGGAGGGAGAGGG - Exonic
1037908095 8:22727298-22727320 CTCTCTCTGCAGGAGGAGGATGG + Intronic
1038016127 8:23516732-23516754 CAATATCAGCAGGAAGGGGGTGG - Intergenic
1039213325 8:35239749-35239771 AGGTATCAGAAGGAGGAGGAAGG - Intronic
1040552703 8:48450748-48450770 CTGTGTCTGGATGAGGGGGAAGG + Intergenic
1040552740 8:48450920-48450942 CTCTGTCAGCAGGTGGGGGCTGG + Intergenic
1040984555 8:53279634-53279656 CTGTGTCTTCAGGTGGGGGAAGG - Intergenic
1041021650 8:53644085-53644107 CTGTCTCAGCAGGTGAAGGAAGG - Intergenic
1041324395 8:56649637-56649659 CTAAATCAGTATGAGGGGGATGG - Intergenic
1041455666 8:58056828-58056850 CTGTTACAGCAGGGGTGGGATGG - Intronic
1041643718 8:60229790-60229812 ATGTCTAGGCAGGAGGGGGAAGG - Intronic
1041739741 8:61145563-61145585 CTGATGCAGCAGGAGGGGGAAGG - Intronic
1042882902 8:73513883-73513905 CTGAGTCTGCAGGTGGGGGATGG + Intronic
1043493332 8:80772566-80772588 CTCTAACAGCACTAGGGGGATGG + Intronic
1044618640 8:94167384-94167406 CTGTGTCAGCTGATGGGGGAGGG - Intronic
1047062540 8:121244073-121244095 CTTTATCAGCAGGATGAGAACGG + Intergenic
1048412086 8:134185696-134185718 CTGTACAAGTAGGTGGGGGAAGG + Intergenic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1049792729 8:144479386-144479408 CTCGAGCACCAGGAGGGGGAAGG - Intronic
1051325277 9:15960065-15960087 TTGTATGAGCAGGACAGGGAAGG + Intronic
1051372862 9:16373117-16373139 CTGTAACAGCTGGATGGGGGTGG + Intergenic
1054459773 9:65456355-65456377 CTGTTCCAGCGGGAGGGGTATGG + Intergenic
1055413509 9:76057519-76057541 ATGTATCAGCAGCAGAGTGAAGG + Intronic
1055928835 9:81539013-81539035 CTGAATCAGCAGAAGGTGGGAGG + Intergenic
1056141769 9:83688298-83688320 CTGTATCAGTGTGAGGGGAAGGG - Intronic
1057477963 9:95420676-95420698 CTGTGACAGAAGGAGAGGGAGGG - Intergenic
1059786752 9:117594439-117594461 CTGTATCAGCAGGAGAAGAAAGG + Intergenic
1060949730 9:127594074-127594096 ATGTATCAACAGGTAGGGGAAGG + Intergenic
1062035643 9:134381428-134381450 CTGTCTGAGCGGGAGAGGGAAGG + Intronic
1062364466 9:136202303-136202325 CTGGAGCCGCAGGATGGGGAAGG - Intronic
1185948902 X:4408427-4408449 CAGTATCAGCGGGTCGGGGAGGG + Intergenic
1186410397 X:9341131-9341153 ATGTGTCTGTAGGAGGGGGAAGG - Intergenic
1186908589 X:14137547-14137569 CTGAATCAGCAGGTGTGGAATGG + Intergenic
1189143920 X:38636633-38636655 CAGAATCAGCATGAGGGGTAGGG + Intronic
1189664861 X:43343333-43343355 CTATACCAGGAGGAGAGGGAAGG + Intergenic
1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG + Exonic
1195741424 X:108068555-108068577 CTGGAACAGGAGGAAGGGGAGGG + Intronic
1195935998 X:110126271-110126293 CTGGATCAGGAGGAGAGGGGTGG - Intronic
1197415585 X:126167696-126167718 CTGTATCAAGAGGAGGGTGAGGG + Intergenic
1198019811 X:132646733-132646755 CTTTATCAGCAGCATGGGAATGG - Intronic
1198321508 X:135521929-135521951 CGCTCTCAGCAGGAAGGGGAGGG - Intronic
1198393932 X:136204674-136204696 GTGTGTCAGCAGGAGGCAGAAGG + Intronic
1198694747 X:139324231-139324253 CTGCTGCAGCAGGTGGGGGAGGG - Intergenic
1198889245 X:141374363-141374385 CTTTATCAGCAGCATGGGAACGG + Intergenic
1199053930 X:143270145-143270167 CTGATTCAGCAGGTTGGGGACGG - Intergenic
1199737469 X:150696984-150697006 CTTTATCAGAAGAAGGGGGAAGG + Intronic
1199800742 X:151248365-151248387 CTGGAGCAGAGGGAGGGGGAGGG + Intergenic
1199850952 X:151724676-151724698 CTGAAGCTGCAGGAAGGGGAGGG - Intergenic
1200124399 X:153806444-153806466 GTGTATCCCCAGGAGGGGGATGG - Intronic
1200951208 Y:8901862-8901884 CTGGATCAGCGGGAGGGGTCAGG - Intergenic