ID: 1084603647

View in Genome Browser
Species Human (GRCh38)
Location 11:70160676-70160698
Sequence GGACATCCTCAGGTGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 162}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084603647_1084603658 0 Left 1084603647 11:70160676-70160698 CCCTGCACCACCTGAGGATGTCC 0: 1
1: 0
2: 3
3: 13
4: 162
Right 1084603658 11:70160699-70160721 CTGAGCTCACCATGGGTTGGGGG 0: 1
1: 0
2: 3
3: 19
4: 186
1084603647_1084603651 -8 Left 1084603647 11:70160676-70160698 CCCTGCACCACCTGAGGATGTCC 0: 1
1: 0
2: 3
3: 13
4: 162
Right 1084603651 11:70160691-70160713 GGATGTCCCTGAGCTCACCATGG 0: 1
1: 0
2: 3
3: 16
4: 184
1084603647_1084603652 -7 Left 1084603647 11:70160676-70160698 CCCTGCACCACCTGAGGATGTCC 0: 1
1: 0
2: 3
3: 13
4: 162
Right 1084603652 11:70160692-70160714 GATGTCCCTGAGCTCACCATGGG 0: 1
1: 0
2: 2
3: 14
4: 114
1084603647_1084603657 -1 Left 1084603647 11:70160676-70160698 CCCTGCACCACCTGAGGATGTCC 0: 1
1: 0
2: 3
3: 13
4: 162
Right 1084603657 11:70160698-70160720 CCTGAGCTCACCATGGGTTGGGG 0: 1
1: 1
2: 2
3: 12
4: 213
1084603647_1084603655 -2 Left 1084603647 11:70160676-70160698 CCCTGCACCACCTGAGGATGTCC 0: 1
1: 0
2: 3
3: 13
4: 162
Right 1084603655 11:70160697-70160719 CCCTGAGCTCACCATGGGTTGGG 0: 1
1: 0
2: 1
3: 23
4: 178
1084603647_1084603653 -3 Left 1084603647 11:70160676-70160698 CCCTGCACCACCTGAGGATGTCC 0: 1
1: 0
2: 3
3: 13
4: 162
Right 1084603653 11:70160696-70160718 TCCCTGAGCTCACCATGGGTTGG 0: 1
1: 0
2: 1
3: 11
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084603647 Original CRISPR GGACATCCTCAGGTGGTGCA GGG (reversed) Intronic
900813225 1:4824108-4824130 GGACATCTTGAAGTGGGGCAGGG + Intergenic
901676734 1:10889742-10889764 GGCCATCCTCAGGCGCTGCTAGG + Intergenic
904810711 1:33161716-33161738 GGGCAGCTCCAGGTGGTGCAGGG - Intronic
906242513 1:44250718-44250740 GCACTTCCTCAGGGGGGGCATGG + Intronic
907778443 1:57541970-57541992 GGACATCCTAGGGTGGGGGAGGG + Intronic
908569357 1:65392603-65392625 CCACATCCTCAGGGGGTGGAGGG - Exonic
909076393 1:71054462-71054484 GGACAGCCTCAGGAGGTAGATGG + Intergenic
909194988 1:72607841-72607863 GGACCTCCTCAGGTTGTGTCAGG + Intergenic
912016641 1:105046117-105046139 GTACATACTCATGGGGTGCATGG + Intergenic
914901711 1:151714670-151714692 GCACATCCTGAGGAGGGGCAGGG + Exonic
915100251 1:153494198-153494220 GGACATATTCGGGGGGTGCAGGG - Intergenic
920502502 1:206494150-206494172 TGACATCCTCAGGAGGTGTAGGG + Intronic
922057499 1:222055366-222055388 GGACAACTCCAAGTGGTGCAAGG - Intergenic
923108899 1:230875489-230875511 GGATATGATGAGGTGGTGCAGGG - Intergenic
1063027143 10:2191567-2191589 GGACATCCTCAGGTAGTTTCTGG + Intergenic
1063937861 10:11097777-11097799 GGACATCCCCAAATGGTGGATGG + Intronic
1065012047 10:21429511-21429533 GGACATTCTCATGTAGTGTACGG + Intergenic
1065275744 10:24083930-24083952 AGACATCTTCAGGTGTTCCAAGG - Intronic
1065321008 10:24510209-24510231 GGACATGCTCAGGGTGTGCTCGG - Intronic
1067328090 10:45288826-45288848 GGACTTCCTGAGGCTGTGCATGG + Intergenic
1074431953 10:113401813-113401835 CTGCATCCTCAGGTGGTGAAAGG + Intergenic
1076917776 10:133433080-133433102 GGCCAGCCTCAGGAGATGCATGG + Intergenic
1076937770 10:133577155-133577177 GGCCAGCCTCAGGAGATGCATGG + Intergenic
1079737313 11:24013084-24013106 CAACCTCCTGAGGTGGTGCAGGG - Intergenic
1083853399 11:65380399-65380421 GTGCATCCTCAGGTGGGGCCTGG - Intronic
1084603647 11:70160676-70160698 GGACATCCTCAGGTGGTGCAGGG - Intronic
1085046008 11:73354114-73354136 GGACATTCTAAGATGGTTCAAGG - Intronic
1085831892 11:79910425-79910447 GGACAATCTCAGGGGGAGCATGG - Intergenic
1089612962 11:119679826-119679848 GGCCATCCACAGGTGGAGAAGGG - Intronic
1091226957 11:133963246-133963268 GGGCATACTCAGGTGGGCCAGGG - Intergenic
1091974770 12:4815501-4815523 GGAGAACCTGAGGTGGTCCAGGG - Intronic
1096406242 12:51346280-51346302 GGACTTCCTCAGCAGGTGCCTGG - Intronic
1096773452 12:53950567-53950589 GGAGATCCTCTGCTGGTGGAGGG + Intergenic
1098826661 12:75305879-75305901 GGACAGCCTCAGGTGCAGCCTGG - Intronic
1099037186 12:77603105-77603127 GGACATCATCAGAAGGTTCAGGG - Intergenic
1099403295 12:82226812-82226834 GGACATCCTCAAGGGATGTAAGG - Intronic
1102180854 12:110911320-110911342 GGACTTCCCCAGCTGCTGCAGGG + Intronic
1102525340 12:113508743-113508765 TGACATCCCCAGGAGGTGCCAGG + Intergenic
1107320646 13:39183609-39183631 GGACCTCCTGATGTGCTGCATGG + Intergenic
1107343226 13:39432087-39432109 AGATGTCCTCACGTGGTGCAAGG - Intronic
1107410471 13:40153362-40153384 AGACATCCTCAGTTGGGGTACGG + Intergenic
1107458092 13:40573501-40573523 GGGGACCCTCAGGTGGTTCAGGG - Intronic
1109751174 13:66694449-66694471 GGACACCCTCAGGTGATGTCAGG + Intronic
1113368761 13:109704215-109704237 TGACAACCTCAGGGGGTCCATGG - Intergenic
1114490627 14:23099438-23099460 GGACAGCCTTAGGTGGGTCATGG + Exonic
1115434849 14:33360803-33360825 GGAAATCCTCAAGAGATGCAAGG - Intronic
1115712469 14:36066054-36066076 CCACATCCTCACGTGGTGGAAGG - Intergenic
1116796881 14:49400866-49400888 GGACATAGCCAGGTGATGCATGG - Intergenic
1119818710 14:77595035-77595057 GGACATGCTCAGGGGGAGAAGGG + Intronic
1122769189 14:104090309-104090331 GGACATGCTCACGTTGTGCAAGG - Intronic
1122983949 14:105203667-105203689 GGGCATCCTCAGGGGCTGCCCGG + Intergenic
1123168038 14:106344997-106345019 GGGAATCCTGAGGAGGTGCAGGG + Intergenic
1123971489 15:25511856-25511878 GGTCATCCTCACATGGTGGAAGG - Intergenic
1124061080 15:26294192-26294214 GGGCACCCCCAGCTGGTGCAGGG - Intergenic
1127839164 15:62815541-62815563 GGTCATTTTCAGGTGGTACATGG + Intronic
1129671781 15:77611717-77611739 GGACAGCCTTAGGTGGTGGTTGG + Intergenic
1130319566 15:82829375-82829397 GGGCATCCTTGGGTGGTTCAGGG + Intronic
1131943232 15:97590516-97590538 TGACATCCTCAGTGGATGCAAGG - Intergenic
1133602614 16:7354468-7354490 GGACAGTCTCAGCTGGTGCTAGG - Intronic
1136156778 16:28388394-28388416 AGACTTCCGCAGGTGGAGCAGGG - Intronic
1136206308 16:28726887-28726909 AGACTTCCGCAGGTGGAGCAGGG + Intronic
1137037233 16:35577308-35577330 GGACCTCCTGAGGTGGAGCAGGG - Intergenic
1138133075 16:54498833-54498855 ATAAATCCTCAGATGGTGCAAGG + Intergenic
1138683647 16:58705894-58705916 GGACATTCCAAGGTGGTGAAAGG - Intergenic
1139911093 16:70398191-70398213 GGACGTCCAGAGGTGGTGGATGG - Exonic
1140515540 16:75538773-75538795 CCACATCCTCAGGAGGTGAATGG + Exonic
1141555920 16:84836727-84836749 GGGCATCCTCGGGTGGGGCCGGG - Intronic
1142245996 16:88970294-88970316 GGGCTTCCTCAGGTGAAGCAAGG + Intronic
1142319447 16:89371670-89371692 AGTCATCCTGAGGGGGTGCAGGG - Intronic
1145891093 17:28416280-28416302 GGACAGCCTCAAGTGAGGCAGGG - Intergenic
1147234120 17:39044640-39044662 GAACAGCCTCACATGGTGCAGGG + Intergenic
1147493963 17:40898159-40898181 GGGCATGCTCAGGGGGTCCATGG - Intergenic
1148080541 17:44965723-44965745 GGACTTCCTGAGGTGGTGCAGGG + Intronic
1149526495 17:57359982-57360004 GGAAATCCTCAGGTGTCCCAGGG + Intronic
1150460463 17:65346085-65346107 GGAAAGCCTCAGGTCGTGAAAGG - Intergenic
1151399885 17:73849107-73849129 GGACATGCTCAGGGGGTGCTGGG - Intergenic
1151712107 17:75812899-75812921 GGACAGCCCCAGGTGCAGCAAGG - Intronic
1152691713 17:81721074-81721096 GGTCCTCCTTAGGGGGTGCAGGG - Intergenic
1152718069 17:81909356-81909378 GGCCATCCTCAGCTGGGGCTGGG + Intronic
1160215012 18:76921088-76921110 GGACAGCAGCAGGTGCTGCAGGG + Intronic
1167002615 19:46755214-46755236 GGACACCCAGAGTTGGTGCATGG + Intronic
925019929 2:560399-560421 GGACATCCTCAGGTCCTGAATGG - Intergenic
927742225 2:25581874-25581896 GCACACACTCAGGAGGTGCATGG + Intronic
929049914 2:37827722-37827744 GGCCAGGCTCAGGTGGTTCAAGG - Intergenic
931248909 2:60513397-60513419 GGACAGCCTCAAGTGGGGCGTGG - Intronic
931986957 2:67751429-67751451 GGACATGCGCAGGTGGTGCAAGG + Intergenic
932790702 2:74652544-74652566 GGACTTCACCAGGTGGTACAGGG - Intergenic
933894398 2:86797493-86797515 GGACATCCTCATGTGGGTCAGGG - Intronic
935007138 2:99089792-99089814 GAAGACCCTCAGGTGGGGCAGGG - Intronic
935131285 2:100263017-100263039 GGACATCCTCCAGTACTGCAGGG - Intergenic
935499103 2:103816497-103816519 TGAAATCCTCAAGTGGTGCCTGG + Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
937627567 2:124060564-124060586 GGACCTCCTTAGGTGGAGAAGGG + Intronic
941197224 2:162467899-162467921 TTGCATCCTCAGGTGGTGGAAGG + Intronic
943845075 2:192635015-192635037 GGACATACTCAGGTCCTGAAGGG + Intergenic
945196741 2:207243870-207243892 GGACATGGTCAGGTGTTACAAGG + Intergenic
945738155 2:213627083-213627105 TGCCATCCACAGATGGTGCATGG - Intronic
1170559104 20:17540610-17540632 GGAGATCCTCAGGTGGACAATGG - Intronic
1171210897 20:23316171-23316193 GGACATCCCTAGGTGGTGTAAGG - Intergenic
1172477928 20:35252813-35252835 GGACAGGCTCAGGTGGGGCTGGG + Intronic
1172989985 20:39028226-39028248 GGACCTCCTTAGATGGTGCTGGG + Intronic
1173036459 20:39415927-39415949 GGACATCTTCAGGTGTTTCTTGG + Intergenic
1173870380 20:46338022-46338044 CGACATCCACAGCTGATGCAGGG + Intergenic
1173895371 20:46546564-46546586 TCACATCCTCAGGTACTGCATGG - Intronic
1174050726 20:47765564-47765586 GGGCCTCCTCAGGTGGTCCAGGG + Intronic
1183452068 22:37902012-37902034 GGAGAACCTCAGGTGGTGACTGG - Intergenic
1183741461 22:39670786-39670808 GGGCCTCTGCAGGTGGTGCAGGG - Exonic
1184861569 22:47175861-47175883 GCAGCTGCTCAGGTGGTGCAGGG + Intergenic
952754873 3:36857335-36857357 GGACATGCTCAGGTGGGCCTTGG - Exonic
954801077 3:53187209-53187231 GATCATGCTCAGGTGGTCCATGG + Intronic
955944801 3:64182588-64182610 CTGCATCCTCAGGTGGTGAAAGG - Intronic
957137164 3:76303890-76303912 GGTGATACTCAGGTGCTGCAGGG + Intronic
960430830 3:117566703-117566725 GGTCATCCTCAGGTCGAGGAAGG - Intergenic
961346305 3:126265698-126265720 GGACTTCCTGAGGCTGTGCACGG + Intergenic
961413763 3:126742704-126742726 AGAAGTCCTGAGGTGGTGCATGG - Intronic
962254238 3:133859616-133859638 GCACATTCTCAGGTGGCCCAGGG - Intronic
963119585 3:141764811-141764833 GGAAATCCTCTGGAGGAGCAGGG - Intergenic
963600296 3:147372702-147372724 GGATATCCTCAGGTATTCCAGGG - Intergenic
963840197 3:150096909-150096931 GGACATCCCCAGCTGGGCCAGGG + Intergenic
965404629 3:168254021-168254043 GTTTGTCCTCAGGTGGTGCAAGG + Intergenic
965823588 3:172709101-172709123 GTATACCCTCAGGTGGTGCTTGG - Intronic
969207240 4:5656138-5656160 GGACATCCTCTGGTGCTTCCTGG - Intronic
970968469 4:21954131-21954153 CAACATCCTCAGGTGGTTCCAGG + Intergenic
974806121 4:66882908-66882930 GGAGAACCTCTGGTGGGGCAGGG + Intergenic
975521902 4:75310749-75310771 CAACATCCTGAGGTCGTGCAGGG - Intergenic
979206697 4:118046590-118046612 GAACATAATCAGGTGGAGCAAGG - Intronic
984777314 4:183493043-183493065 GGACAACCACAGGTGGTGTATGG - Intergenic
985692087 5:1319184-1319206 GGACAACCTCAGGCTCTGCAGGG + Intronic
987001011 5:13659692-13659714 GGACACCCTCTGGTTGTGCTAGG + Intergenic
992701156 5:79343116-79343138 GCACTTCCCCAGGTGCTGCAGGG - Intergenic
992943187 5:81783288-81783310 AAACAGCCTCAGGTGTTGCATGG + Intergenic
997262069 5:132473066-132473088 GGACATCCTGTGGGGCTGCATGG + Intronic
998965242 5:147532521-147532543 GGAGTTTCTAAGGTGGTGCAAGG + Intergenic
1001097407 5:168786467-168786489 GGTCATCTCCAGATGGTGCAGGG + Intronic
1001476555 5:172054817-172054839 GCACAGCCTGAGGTGGTGCTGGG - Intronic
1002655442 5:180743037-180743059 GGGGATCATCAGATGGTGCAAGG - Intergenic
1003172769 6:3733227-3733249 GGACAGTCTCAGGTGATGCCAGG + Intronic
1007493067 6:42239549-42239571 GAACATGCTCAGGTGGTTCAGGG - Intronic
1009279958 6:61736437-61736459 GGACATCCACAGGTGCTCCAAGG + Intronic
1009735786 6:67674625-67674647 GAACTGCCTCAGGGGGTGCATGG + Intergenic
1010562046 6:77362604-77362626 CAGCATCCTGAGGTGGTGCAGGG + Intergenic
1011657715 6:89566584-89566606 GGACATCCTCCGGAGGAGTATGG - Intronic
1011926089 6:92646384-92646406 GGACTTTCTCACATGGTGCAAGG - Intergenic
1022230478 7:28408867-28408889 GGACATCCTCCGGTGGGGGAGGG + Intronic
1026149131 7:67773247-67773269 GCACATCCTCTGCTGGTGCCCGG + Intergenic
1029675191 7:102063924-102063946 GGACAGCCCCAGGTGGTGGTGGG + Intronic
1030905348 7:115174439-115174461 GGAACTCCACAGGTGGTGGAGGG + Intergenic
1032467524 7:132155609-132155631 GGACAGCCTCACGTGTAGCAGGG + Intronic
1038475312 8:27862170-27862192 GGGTATCCTGAGGGGGTGCAGGG + Intergenic
1039488701 8:37931435-37931457 AGCCATCCTCAGGGGATGCAAGG + Intergenic
1043094362 8:75947751-75947773 AGTCATACTGAGGTGGTGCAGGG - Intergenic
1045269467 8:100649658-100649680 GGACATCTACAGGTGGGGCCGGG + Exonic
1046751731 8:117933908-117933930 GGGCATCTTCACGTGGAGCAAGG - Intronic
1046924110 8:119768061-119768083 GGACTCCCTCAGCTGGAGCAAGG - Intronic
1047284195 8:123472453-123472475 GGACAACTTCAGATGGAGCATGG - Intergenic
1048365165 8:133732147-133732169 GGACATTATCAGGTGGTGCAAGG - Intergenic
1048864047 8:138746277-138746299 GCACATGCTCAGGCTGTGCAAGG - Intronic
1049619713 8:143592545-143592567 GGCCATGCGCAGGTGGTGCTGGG + Intronic
1049668250 8:143858404-143858426 CGACAGCCTCAGGTTGCGCACGG + Exonic
1049668666 8:143860003-143860025 CGACAGCCTCAGGTTGCGCACGG + Exonic
1049669081 8:143861605-143861627 CGACAGCCTCAGGTTGCGCACGG + Exonic
1049669496 8:143863207-143863229 CGACAGCCTCAGGTTGCGCACGG + Exonic
1049669906 8:143864800-143864822 CGACAGCCTCAGGTTGCGCACGG + Exonic
1049670323 8:143866408-143866430 CGACAGCCTCAGGTTGCGCACGG + Exonic
1051162315 9:14222318-14222340 GGATTTCCTCAGTAGGTGCAGGG - Intronic
1051263639 9:15289925-15289947 GGACATCATCAGGGGGGTCAAGG - Intronic
1055686541 9:78781150-78781172 GGACAGCCTCAGGTGGTTGCTGG - Intergenic
1056789491 9:89616436-89616458 GGGCAGCCTCAGGTAGAGCAAGG - Intergenic
1057146036 9:92760176-92760198 GGTCCTGCTCAGGTGGTGCCAGG + Intronic
1061176185 9:128998782-128998804 GGATATCCTGAGATGGAGCAGGG + Intronic
1061223025 9:129263245-129263267 GGACATCCACAGGTGCTGGATGG + Intergenic
1062656520 9:137606637-137606659 CCACAGCCTCAGGCGGTGCAGGG - Intronic
1188442399 X:30225405-30225427 AAACATCATCATGTGGTGCATGG - Intergenic
1189272190 X:39759542-39759564 CGCCATCCTCAGGTGGTTCTTGG - Intergenic
1192239634 X:69319119-69319141 GGAAACCCTCAGGTGGGGGAGGG - Intergenic
1197730279 X:129803920-129803942 GGACAGTCCCAGCTGGTGCATGG + Exonic
1198586594 X:138128730-138128752 GAACATCCTCAGGTACAGCAAGG + Intergenic
1199235527 X:145488048-145488070 CAGCATCTTCAGGTGGTGCAGGG + Intergenic
1199298596 X:146186932-146186954 GGACATAGCCAGGTGGGGCAGGG + Intergenic