ID: 1084604098

View in Genome Browser
Species Human (GRCh38)
Location 11:70162450-70162472
Sequence GTGGGGACAAGGAGAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1674
Summary {0: 1, 1: 0, 2: 8, 3: 176, 4: 1489}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084604085_1084604098 22 Left 1084604085 11:70162405-70162427 CCCACGGCAGGTAGGGAGGAGTC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1084604098 11:70162450-70162472 GTGGGGACAAGGAGAGAGGAGGG 0: 1
1: 0
2: 8
3: 176
4: 1489
1084604090_1084604098 0 Left 1084604090 11:70162427-70162449 CCACGTAGGGAGGAGTCCACAAA 0: 1
1: 0
2: 0
3: 1
4: 62
Right 1084604098 11:70162450-70162472 GTGGGGACAAGGAGAGAGGAGGG 0: 1
1: 0
2: 8
3: 176
4: 1489
1084604086_1084604098 21 Left 1084604086 11:70162406-70162428 CCACGGCAGGTAGGGAGGAGTCC 0: 1
1: 0
2: 3
3: 16
4: 194
Right 1084604098 11:70162450-70162472 GTGGGGACAAGGAGAGAGGAGGG 0: 1
1: 0
2: 8
3: 176
4: 1489

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084604098 Original CRISPR GTGGGGACAAGGAGAGAGGA GGG Intronic
900264039 1:1748309-1748331 CTGGGGAGAGGAAGAGAGGAAGG - Intergenic
900367037 1:2315538-2315560 GTGGGCTCACGGAGAGAGGGCGG - Intergenic
900503211 1:3016654-3016676 GAGGGAGAAAGGAGAGAGGAAGG + Intergenic
900552060 1:3261772-3261794 GTGGGGACCAGGACGGAGGGCGG - Intronic
900597842 1:3490590-3490612 CTGGGGAAAAGGAGAAAAGAGGG + Intronic
901013307 1:6213041-6213063 GTGGGGCCAAGGCCAGAGCATGG - Intronic
901291827 1:8130197-8130219 GGGAGGCCAAGGCGAGAGGATGG - Intergenic
901554509 1:10020949-10020971 GGGGGGAAAAAGGGAGAGGAAGG + Intergenic
901746119 1:11374853-11374875 GGGAGGACAAGGAGGGAGCAGGG + Intergenic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
901915772 1:12498774-12498796 GTGGGGACACAGTGAGAAGAGGG - Intronic
902333519 1:15742461-15742483 GTGGAGGGAAGGAGAGAGGCTGG - Exonic
902678209 1:18023755-18023777 TTGGGGAAAAGGTGGGAGGAAGG + Intergenic
902728039 1:18350274-18350296 GTGGGGAGCAGGAGTGAGGGTGG + Intronic
902778194 1:18687899-18687921 GGAGGGACAAGGAGACAGGAAGG + Intronic
902987923 1:20166708-20166730 GAGGGGGCAGGGAGAAAGGAAGG - Intronic
903081180 1:20814778-20814800 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
903350516 1:22713728-22713750 GAGGAGACAAGGAAGGAGGAAGG - Intronic
903396187 1:23003479-23003501 GTAGAGACACGGAGAGAGGGGGG + Intergenic
903560720 1:24225021-24225043 GTGGGGGAAGGGAGATAGGAGGG - Intergenic
903588053 1:24432025-24432047 GTGAGGACAAGGACAGGGCATGG + Intronic
903828189 1:26159862-26159884 GCTGGGGCAAGGAGCGAGGAGGG - Intronic
903925365 1:26827388-26827410 GTGGGGTCAGGGAGAATGGAGGG - Intronic
904077164 1:27852156-27852178 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
904354671 1:29931141-29931163 GTGGGGTGAGGGAGAGAAGATGG - Intergenic
904368487 1:30033779-30033801 GTGGGGAATAAGACAGAGGAGGG + Intergenic
904425181 1:30418176-30418198 GTGGGGTCAGGGAGTGGGGATGG + Intergenic
904534042 1:31187549-31187571 GTGGGCGCAAGGACACAGGAGGG - Intronic
904603351 1:31685573-31685595 GCGGGGCTAAGGAGAGGGGAGGG - Intronic
904696421 1:32334310-32334332 GTGGGGACAGGGAAGGAGGTAGG + Exonic
904909298 1:33922094-33922116 GTGGGGAAGAGCAGGGAGGAAGG - Intronic
904969564 1:34408584-34408606 GAGGGGGCAAGAAGAAAGGAAGG - Intergenic
905266328 1:36756529-36756551 GAGGGGAGAAGGAGAGGGAAAGG + Intergenic
905399741 1:37692610-37692632 GTAGGGACGAGGAGGGCGGACGG - Exonic
905560027 1:38919112-38919134 GAGGAGAAAATGAGAGAGGATGG - Exonic
905703232 1:40035149-40035171 TAAGGGACAAGGAAAGAGGAAGG - Intergenic
906144695 1:43552973-43552995 GTGGGGGCTGGGAGAGAGGGAGG + Intronic
906224146 1:44107047-44107069 GTGGGGAGGAGGAGAGAGGTGGG + Intergenic
906254658 1:44338990-44339012 GGGGGGGCAAGGAGGGAGGGAGG - Intronic
906331951 1:44892979-44893001 GTGGAGATAAGCAGAGATGAGGG - Intronic
906418117 1:45638698-45638720 GTGAGGTCAAGGTGGGAGGATGG + Intronic
906522367 1:46475010-46475032 GGGGGGACATGGGGATAGGAGGG + Intergenic
906567395 1:46810944-46810966 GTGGGGGTGAGGAGAGAGGATGG + Exonic
906640177 1:47436998-47437020 CTGGGGCCAGGGAGAGGGGAGGG + Exonic
906681963 1:47733232-47733254 GTGGGAGTCAGGAGAGAGGATGG - Intergenic
906700110 1:47851464-47851486 GTGAGGAAAAAGAGGGAGGAAGG + Intronic
906722730 1:48020992-48021014 GTGGGGTGAAGGAGACAGGCAGG + Intergenic
906942016 1:50263834-50263856 GTGGGGAGAGGGAGACAGGTGGG - Intergenic
907074623 1:51567005-51567027 GTGGGAGCATGGAGAGAGGCAGG - Intergenic
907249118 1:53126268-53126290 GTGAGGGCCACGAGAGAGGAGGG - Intronic
907303537 1:53502213-53502235 GGAGGGACAGGGAAAGAGGAGGG + Intergenic
907303787 1:53502976-53502998 GGAGGGACAGGGAGAGAGGAGGG + Intergenic
907308204 1:53525282-53525304 ATGGGGAGGAGGAGAGGGGAAGG + Intronic
907696029 1:56730296-56730318 GGGGTGAGAAGGAGAGGGGAGGG + Intronic
908582839 1:65535470-65535492 GTGGGGACACTGAGGCAGGAGGG - Intronic
908787369 1:67748518-67748540 GGGGGGATAAGAAGAGAGGGTGG + Intronic
909040570 1:70644765-70644787 GTGGGGAGAAGGAAAGGAGAGGG - Intergenic
909183690 1:72457785-72457807 GAGGGGAGAGGGAGGGAGGAAGG - Intergenic
909482888 1:76144265-76144287 CTGAGGCCAAGGAAAGAGGATGG + Intronic
909878035 1:80835835-80835857 GGGGAGACAGGGAGAGAGCATGG - Intergenic
909988561 1:82192912-82192934 GTGGGGACAAGGACTGAGTGGGG - Intergenic
910480246 1:87650830-87650852 GTAGGGAAAAGGAGAAAGGAAGG - Intergenic
910758088 1:90712112-90712134 GTGGGGAGATGGAGAGCAGAGGG + Exonic
910846797 1:91611922-91611944 ATGGGGGCAAGGAGGGAGGAGGG + Intergenic
911056826 1:93715930-93715952 GTGGTGACAGGGAGCAAGGATGG + Intronic
911090608 1:94014248-94014270 GAGGGCAGAAGGAAAGAGGAAGG + Intronic
911227626 1:95324474-95324496 GAGGGGACCAGGAGAAAAGATGG - Intergenic
911313583 1:96328048-96328070 GTAGAGAGAAGGAGAGATGAGGG + Intergenic
911538150 1:99125230-99125252 GTGGGAAGAGGGAGAGAGGAAGG - Intergenic
911736671 1:101343861-101343883 GTGAAGACACGGAGAGAAGATGG + Intergenic
911966725 1:104381017-104381039 GTAGAGACACGGAGAGAGGGGGG - Intergenic
912309285 1:108603338-108603360 CTGGGGACAACCAAAGAGGAGGG + Intronic
912481299 1:109984169-109984191 GTGGAGACCAGGAGAGCTGATGG - Intergenic
912757069 1:112333388-112333410 TTGGGGAGAAGGAAAGTGGAAGG - Intergenic
912956518 1:114157432-114157454 CTGGGGACTTGGAGGGAGGAGGG - Intergenic
913130774 1:115837490-115837512 CTGGGAAGGAGGAGAGAGGAGGG - Exonic
913181698 1:116328774-116328796 ATGGGGACAAAGGAAGAGGAAGG + Intergenic
913216871 1:116628100-116628122 GTGGGCAGAAGTGGAGAGGATGG + Intronic
913322937 1:117602061-117602083 GGTGGGACAGGAAGAGAGGAAGG - Intergenic
913528295 1:119713858-119713880 GTGGGGATAGGGAGGGATGAGGG + Intronic
914000365 1:143689559-143689581 ATGGGGAACTGGAGAGAGGAAGG + Intergenic
914217472 1:145645313-145645335 GTGGGAAAAATCAGAGAGGAGGG + Intronic
914470041 1:147967998-147968020 GTGGGAAAAATCAGAGAGGAGGG + Intronic
914756307 1:150563339-150563361 CTGGGGACAAGGGGAGAGCAAGG - Intergenic
914825504 1:151135942-151135964 GTTGGGTCAAAGAAAGAGGAGGG + Intronic
915205786 1:154269558-154269580 GAGGGGAGGAGGAGAGAGGAAGG - Intronic
915218220 1:154353870-154353892 GTGGGAAGAAGAACAGAGGAAGG - Intergenic
915388475 1:155518795-155518817 GAGGGGAGACGGGGAGAGGAAGG + Intronic
915691558 1:157695906-157695928 GTGGGGACAGAGAGAGAGAGAGG - Intronic
915736808 1:158090371-158090393 GTGGGGGAGAGGAGAAAGGAGGG - Intronic
915755348 1:158254434-158254456 TTGGTGACAAGGAGAGAAGCTGG + Exonic
915762782 1:158331656-158331678 GTGAGGACAGGGAGAGCGGCTGG - Intergenic
915931012 1:160061087-160061109 GTGGGGGCATGGTGAGGGGAAGG - Intronic
916017943 1:160766900-160766922 ATGAGGACAGGGAGAGATGAAGG + Intergenic
916087899 1:161284521-161284543 GTGTGGAGAAGGGGAGAGAAGGG - Exonic
916131804 1:161617377-161617399 GTGGGGAGAGGGGGAGGGGAGGG + Intronic
916149331 1:161771125-161771147 GAAGAGAGAAGGAGAGAGGAGGG - Intronic
916265788 1:162888626-162888648 GGGAGGACAAGGAGGGAGGCAGG + Intergenic
916296954 1:163229587-163229609 GTGAGGACAGAGTGAGAGGAAGG - Intronic
916447012 1:164881645-164881667 GTGGGGAAAAAGAGGAAGGAAGG + Intronic
916460961 1:165023788-165023810 GTAGGGAGAGAGAGAGAGGAAGG + Intergenic
916794000 1:168148685-168148707 GTGGGCACAAAGAGAGGGCAAGG + Intergenic
916989445 1:170226612-170226634 ATGGAAAGAAGGAGAGAGGAAGG - Intergenic
917105008 1:171483330-171483352 GAGGGGAGAAGGAGGGAGGGAGG + Intergenic
917188516 1:172388662-172388684 GTGGGGGCCAGGAGAGGGAATGG - Exonic
917193657 1:172444295-172444317 GAGAGGACAAGGAAAGAGGCTGG + Intronic
917737624 1:177934967-177934989 GTGGGGAGCAGTAGGGAGGAGGG - Intronic
918025431 1:180740229-180740251 ATGGGAACAAGGAGAAAGAATGG - Intronic
918062367 1:181073041-181073063 ATGGGGACAAGGGGAGAGCTGGG - Intergenic
918110208 1:181449026-181449048 GAGGGTGCAAGGAGATAGGATGG + Intronic
918125612 1:181580790-181580812 GTGGGGACCTGGAAGGAGGAGGG + Intronic
918147739 1:181772342-181772364 GTGGGGGTGTGGAGAGAGGAGGG - Intronic
918188141 1:182145593-182145615 GTGGGGAGACAGAAAGAGGAAGG + Intergenic
918352326 1:183670134-183670156 GTGGGGAGATGGAGAGAGATAGG - Intronic
918368172 1:183831386-183831408 GTGAGGTCAAGGAGATAGGTAGG + Intronic
918407191 1:184222919-184222941 CTGGGGACATGGAAAGAGAAAGG - Intergenic
918434271 1:184495320-184495342 GTGGGTACAAGTGAAGAGGATGG - Intronic
918447521 1:184630029-184630051 GTGGTGAGAAGGAGGGAGGGAGG + Intergenic
918469910 1:184861515-184861537 GGGGGGAAGAGGAGGGAGGAAGG + Intronic
918707283 1:187681126-187681148 GTGGGGAGAAAGAGAGAGTAGGG - Intergenic
918887745 1:190218732-190218754 GAGGGGACAAGGAGGGTGGGGGG - Intronic
919162793 1:193853386-193853408 GAGGGGAGCAGGAAAGAGGATGG - Intergenic
919595745 1:199559991-199560013 GTGGGGGGATGGAGAGAGGTTGG + Intergenic
919814679 1:201429936-201429958 GTGGGGCCATCGAGTGAGGAGGG - Intergenic
920073717 1:203321771-203321793 GAGGGGAGAAGAAGAGGGGAAGG - Intergenic
920207507 1:204303277-204303299 GTGGGGAGAGGGTGAGAGGGTGG - Intronic
920363000 1:205432184-205432206 GAAGGGAAAAGGAGGGAGGAGGG + Intronic
920438596 1:205963898-205963920 GCAGTGACCAGGAGAGAGGAAGG + Intergenic
920585183 1:207152244-207152266 GAGAGGACAAAGGGAGAGGATGG + Intergenic
920622937 1:207566272-207566294 AAGGGGAGAAGGAGAGAAGAAGG - Intronic
920662762 1:207931555-207931577 TTGGGGAGAGGGAGAGAGAAGGG + Intergenic
920839548 1:209542730-209542752 GTGGTGGGAGGGAGAGAGGAGGG - Intergenic
921132225 1:212229689-212229711 GTGGGGAGAGGAAGGGAGGAGGG - Intergenic
921278683 1:213544294-213544316 GTGAGGTCAAGGATAGAGTAAGG + Intergenic
921290333 1:213650996-213651018 GTGGGGAGAAAGGGAGAGGCTGG + Intergenic
922022125 1:221716014-221716036 GCAGGGACAGGGAGAGAAGAGGG - Intronic
922319427 1:224472630-224472652 CTGGGGAAAAGGATTGAGGATGG + Intronic
922996135 1:229963092-229963114 GTGTAAACAAGGAGAGAGGTGGG + Intergenic
923006221 1:230052186-230052208 GTGAGGACACAGAGAGAAGATGG + Intergenic
923087291 1:230711296-230711318 GTGGGGACACAGAGAGAAGACGG + Intronic
923362653 1:233226800-233226822 GTGTGGGCATGGGGAGAGGAGGG - Intronic
923462626 1:234220391-234220413 GTGGTGACAAGGAGACATGTTGG + Intronic
923523764 1:234756873-234756895 GTGAGACCAAGGAGAGGGGAAGG + Intergenic
923772925 1:236953155-236953177 CTGTGAACAAGGACAGAGGATGG - Intergenic
924662821 1:246037598-246037620 GCAGGGACAAAGAGAGAGAACGG - Intronic
924695140 1:246391472-246391494 AGGGAGAGAAGGAGAGAGGAGGG + Intronic
924732545 1:246724726-246724748 GTGAGGACAAGAAGAGGAGAGGG + Intronic
924794726 1:247285079-247285101 GTGGGGAAAAAGGGAGAAGATGG - Intergenic
1062873256 10:925073-925095 GGGGAGACAAGGAGAGTGCAGGG + Intronic
1062942045 10:1429843-1429865 GGAGGAAAAAGGAGAGAGGAGGG - Intronic
1063090075 10:2857078-2857100 GGGAGGGAAAGGAGAGAGGAGGG + Intergenic
1063220921 10:3967056-3967078 CTGGGGCGAAGGAGAGAGGGTGG - Intergenic
1063222046 10:3978062-3978084 GACTGGAGAAGGAGAGAGGAAGG - Intergenic
1063243418 10:4194139-4194161 GGGAGGCCAAGGAGGGAGGACGG - Intergenic
1063300691 10:4846335-4846357 GTGGGGACAACAAAAGGGGAGGG + Intronic
1063607955 10:7539554-7539576 GTGGTGAGAAAGAGAGAAGATGG + Intergenic
1063812800 10:9733124-9733146 GTGGGGGAGAGAAGAGAGGATGG + Intergenic
1064134867 10:12741852-12741874 TTTGGGACAAGGAGGGAGGATGG + Intronic
1064504016 10:16009857-16009879 TTAGGAAGAAGGAGAGAGGATGG + Intergenic
1064648263 10:17482303-17482325 GAGGGGAGAGGAAGAGAGGAAGG + Intergenic
1065495137 10:26319801-26319823 ATGGGGACCAGAAGTGAGGAGGG + Intergenic
1066103494 10:32137745-32137767 CTGGGGAGAAGGGGAGAGGTCGG + Intergenic
1066473662 10:35724078-35724100 GTGGGGACCAGGGTAGGGGATGG - Intergenic
1067359310 10:45563018-45563040 GGGAGGGGAAGGAGAGAGGAAGG - Intronic
1067543393 10:47174279-47174301 GTGAGGACATAGAGAGAGGGTGG + Intergenic
1067544329 10:47181892-47181914 GAGAGGACAGGGAGCGAGGAAGG - Intergenic
1067581481 10:47449379-47449401 GTGGGGCCAAGGTGAGCTGAGGG - Intergenic
1067706125 10:48607570-48607592 GTGGGGACAAGGGCAGGGCAAGG + Intronic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1067922378 10:50472911-50472933 GTGGGGAGCAGGATAGAGGAAGG - Intronic
1068242616 10:54323709-54323731 GCTGGGGCAAGGAGAGAGAATGG + Intronic
1068558240 10:58482140-58482162 GTGGAAAGAAGGAGGGAGGAAGG - Intergenic
1068711597 10:60141064-60141086 GAGGGGAAAAAGAGAGAGGGAGG + Intronic
1069248324 10:66236873-66236895 AGGAGGTCAAGGAGAGAGGACGG + Intronic
1069289217 10:66756592-66756614 GTAGGGGTCAGGAGAGAGGAAGG - Intronic
1069544822 10:69320335-69320357 GTGGGGACCGGGAGTGAGGTAGG + Intronic
1069547463 10:69338987-69339009 GTGGGTTGAAGGAGAGAGGGAGG - Intronic
1069746334 10:70717274-70717296 GTGGGGTTGTGGAGAGAGGAGGG + Intronic
1069772011 10:70906097-70906119 GTGGGAGCACAGAGAGAGGAGGG + Intergenic
1069893730 10:71667752-71667774 AAGGGGACAAAGAGACAGGAGGG + Intronic
1070065269 10:73027645-73027667 GAGGGGGGAGGGAGAGAGGAAGG + Intronic
1070346104 10:75543471-75543493 GTGGGGAGGAGGAGAGAGGAAGG + Intronic
1070408037 10:76113877-76113899 AAAGGGACAAGAAGAGAGGAGGG - Intronic
1070426986 10:76298409-76298431 TAAAGGACAAGGAGAGAGGATGG - Intronic
1070457456 10:76631511-76631533 GTGGGGTGAAGGAGGGAGGCTGG - Intergenic
1070465859 10:76723107-76723129 GTGGAGACAAGGAAAGAGATGGG - Intergenic
1070701013 10:78601852-78601874 ATGGGGACAGGAAGAGAGAAGGG - Intergenic
1071028595 10:81144559-81144581 CTAGGGCCAAGGAGAGAGAAAGG - Intergenic
1071073973 10:81729588-81729610 GGGGGGGGAAAGAGAGAGGAAGG + Intergenic
1071249025 10:83796938-83796960 GAGGGGACAGGGAGGGAGGAGGG + Intergenic
1071424714 10:85537559-85537581 GGTGGGAAAAGCAGAGAGGAGGG + Intergenic
1071526600 10:86363125-86363147 GGAGGGACTAGCAGAGAGGAGGG + Intronic
1071594419 10:86908855-86908877 ATGCCCACAAGGAGAGAGGAAGG + Intronic
1071790164 10:88945100-88945122 GTGGGGACGAAGAGAGAGAGAGG - Intronic
1071876247 10:89846366-89846388 GAAGGGAGAAGGAGGGAGGAAGG + Intergenic
1072044125 10:91637671-91637693 GTGAGGAAAAGGAGAGGGGAGGG + Intergenic
1072079251 10:92012181-92012203 GAGGGGAGAAGGGGAGGGGAGGG - Intronic
1072630209 10:97140382-97140404 GAGGGGAACAGGAGAGAGGGAGG - Intronic
1072652647 10:97307657-97307679 GTGGGAAGAAGGAGAGTGGGAGG + Intergenic
1072745968 10:97939440-97939462 GTGGGGACTGGGGGAGATGAGGG - Intronic
1072793807 10:98338843-98338865 TGGGGGACAAGGAGAAGGGAGGG - Intergenic
1072916757 10:99541423-99541445 GTAGTGACAAGAAGAGAGCATGG - Intergenic
1072956301 10:99891173-99891195 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1073041680 10:100612152-100612174 GTTGGACCCAGGAGAGAGGAAGG + Intergenic
1073061586 10:100736703-100736725 GTGGGGACAAGGCCCTAGGAGGG - Intronic
1073071711 10:100798578-100798600 ATAGGAAAAAGGAGAGAGGAGGG - Intronic
1073240672 10:102055930-102055952 GAGGGGAGAGGGAGGGAGGACGG - Intronic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073391019 10:103176343-103176365 GTGGGGACAGGGAGGGAGGTAGG - Intronic
1073450500 10:103606478-103606500 GTGGGGAGAGGGAGAGGGAAGGG - Intronic
1073465397 10:103692312-103692334 GTGGAGGCAGGGAGAGAGGCGGG - Intronic
1073630289 10:105141397-105141419 GTGGGGACAGAGAGGGTGGAGGG + Intronic
1073633047 10:105167878-105167900 GTGGGTACAAGGAGAAACCAGGG + Intronic
1073911219 10:108347047-108347069 GAGGGGAGAGGGAAAGAGGAGGG + Intergenic
1074122355 10:110502006-110502028 GTGGGGATAAGAAGATAGGGTGG + Intronic
1074296710 10:112195946-112195968 GTGGGGTGAGGGAGAGAAGATGG - Intronic
1074544852 10:114394433-114394455 CTGGGGACCAGGAGAGAGTTGGG + Intronic
1074553387 10:114466098-114466120 GGGGGGCCAAGGTGGGAGGATGG + Intronic
1074678306 10:115878052-115878074 GTGGGGAGAAGGGGAGTGGCAGG - Intronic
1074854949 10:117466689-117466711 GGGGAGGCAACGAGAGAGGAAGG - Intergenic
1074872634 10:117589008-117589030 GTTGGGACATGGAGAGGGCAGGG - Intergenic
1074902718 10:117833027-117833049 GTGGGGAGGGGGAGGGAGGAGGG - Intergenic
1075001562 10:118802495-118802517 GTGGGGAGGAGGACAGAGGGAGG + Intergenic
1075137377 10:119796065-119796087 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
1075291877 10:121238135-121238157 ATGGGGACAAGTGGGGAGGAAGG - Intergenic
1075407468 10:122204170-122204192 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
1075538833 10:123295265-123295287 GTGGGGAGTGGGAGAAAGGAGGG - Intergenic
1075695633 10:124432980-124433002 GGGAGGCCAAGGTGAGAGGATGG + Intergenic
1075805791 10:125187926-125187948 GTGGGGCTAAAGAGGGAGGAGGG - Intergenic
1075842615 10:125517752-125517774 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
1076174676 10:128358925-128358947 GTGGGGATAAGGAGAGCGTCAGG + Intergenic
1076367855 10:129933882-129933904 GTGGGGCTGAGCAGAGAGGAGGG - Intronic
1076572447 10:131441443-131441465 AGGGGGAAAAGGAGAGAGGGAGG + Intergenic
1076580350 10:131504703-131504725 GTGGGGTGGAGGAGAGGGGAGGG - Intergenic
1076680316 10:132168313-132168335 GTGAGAACCAAGAGAGAGGAGGG - Exonic
1076732751 10:132446643-132446665 GTGGGAGGAAGGAGAGATGAGGG + Intronic
1077304744 11:1864050-1864072 GAGGGGAGGAGGGGAGAGGAAGG + Intronic
1077643965 11:3907086-3907108 GTGGGGACAGGGTTAGAGGTTGG + Intronic
1077783087 11:5353479-5353501 GTGGGGAGGAAGGGAGAGGATGG + Intronic
1078389746 11:10926618-10926640 GTGGGGACAAGGTAAGGGCAAGG + Intergenic
1078461300 11:11517061-11517083 GTGAGGACACGGTGAGAAGATGG + Intronic
1078490600 11:11764393-11764415 AAGGGGACAAGGAGAGAAAAAGG - Intergenic
1078605440 11:12771085-12771107 TTGGGGAAAAGGAGAAGGGAAGG + Intronic
1079034934 11:17013548-17013570 GTGGGGAGAGGGAGAGACTAGGG - Intronic
1079036380 11:17024029-17024051 GTTGGAACAAGGACAGAGTAAGG - Intergenic
1079081457 11:17416088-17416110 TTGGGGACAAGGAGGGAGAAAGG + Intronic
1079128629 11:17735267-17735289 GCGGGGAGAAGGAACGAGGAGGG + Exonic
1079220329 11:18555048-18555070 GGGAGGCCAAGGAGAGAGAACGG + Intronic
1079242944 11:18733476-18733498 GTAGGGACAAGGCTGGAGGATGG + Intronic
1079548056 11:21659154-21659176 GTGGGGAAATGGAGAGATGTTGG + Intergenic
1079723678 11:23851550-23851572 GTGTAGACAAGGAAAGAGGATGG - Intergenic
1080254376 11:30272549-30272571 GAAGGGAGAGGGAGAGAGGAAGG + Intergenic
1080321971 11:31020674-31020696 GGGAGGCCAAGGAGGGAGGATGG - Intronic
1080984555 11:37445913-37445935 GCTGGGACAAGGAAAGATGAGGG + Intergenic
1081207583 11:40293326-40293348 GTGGGGGCGGGGACAGAGGAAGG - Exonic
1081716798 11:45256232-45256254 GTGGAGAAGAGGAGGGAGGAAGG - Intronic
1081775243 11:45671800-45671822 ATGGGGACTAGGTGAGAGAAAGG - Intergenic
1081896719 11:46593496-46593518 GGGGGGAAAAGGAGAAAGGAAGG + Intronic
1082801193 11:57416203-57416225 GTTGGGACAATAAGAGAGGGCGG + Intronic
1083025715 11:59549157-59549179 GTGGGGACGAGCAGGGAGGTTGG + Intergenic
1083130527 11:60621360-60621382 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
1083164145 11:60873304-60873326 GTGGGGGCCAGAAGAGAGCAGGG - Intronic
1083186057 11:61018481-61018503 AAGGGGAAAAGGAGAAAGGAAGG + Intronic
1083221306 11:61254564-61254586 CTGGGGACAAGCAGAAAGGCAGG + Intergenic
1083599175 11:63936010-63936032 GTAGGGACAAGGTCAAAGGAAGG - Intergenic
1083800551 11:65044126-65044148 GCGTGGTCGAGGAGAGAGGAAGG + Intronic
1083996145 11:66273682-66273704 GTGTAGACATGGACAGAGGAGGG - Intronic
1084066687 11:66708307-66708329 GTGGGGACAGGGTTAGTGGAAGG + Intronic
1084214421 11:67639820-67639842 GGGAGGACAAGGAGGGAGGAAGG - Intergenic
1084604098 11:70162450-70162472 GTGGGGACAAGGAGAGAGGAGGG + Intronic
1084729564 11:71064660-71064682 GTGGGGACAAGAGGGGTGGAGGG + Intronic
1084732319 11:71081590-71081612 GCGGGGAACAGGAGAGGGGATGG - Intronic
1084742886 11:71150399-71150421 GGAGGGACAGGGAGGGAGGAAGG + Intronic
1084798650 11:71526618-71526640 GTGGGAGCAAGGGGTGAGGAGGG - Intergenic
1084942596 11:72620866-72620888 TGGGGGAGAGGGAGAGAGGAGGG + Intronic
1084972911 11:72781366-72781388 GTGGGGAGCTGGAGAGAGGTAGG + Intronic
1085079765 11:73624534-73624556 GAGGGGAGGAGGGGAGAGGAGGG + Intergenic
1085083719 11:73653024-73653046 GTGGGGAAAGGGGGAGAGAACGG - Intronic
1085318644 11:75561445-75561467 GGGGTGACAAGGATTGAGGAAGG + Intergenic
1085422999 11:76380325-76380347 GTGGTGGCAAGGAGAGGGAAAGG + Intronic
1085478953 11:76806119-76806141 GAGGGGAAAAAGAGAGAGCAGGG - Intergenic
1085542953 11:77289379-77289401 GAGGGGAAAAGGAGGGAAGACGG + Intronic
1085627079 11:78081782-78081804 GTTGAGACATGGAGAGAGGGGGG - Intergenic
1086067948 11:82766045-82766067 GTAGGGACATGGGGAGAGGTTGG + Intergenic
1086124900 11:83340382-83340404 GTGAGGGCAAGGAGTGAAGAGGG - Intergenic
1086341365 11:85852357-85852379 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
1086549554 11:88040286-88040308 GTGAGGACACAGGGAGAGGACGG - Intergenic
1087076458 11:94130572-94130594 CTGGGAAGAAGGTGAGAGGATGG + Intronic
1087124336 11:94608158-94608180 GTGGGGAGTGGGAGAGAGGGAGG - Intronic
1087214578 11:95481801-95481823 GTGGGGAGAGGGAGACAAGAGGG - Intergenic
1088327657 11:108617283-108617305 GAGAGGATAAGGAGGGAGGATGG + Intergenic
1088356027 11:108944660-108944682 GTGGGGGGAAGGAGGGAGGATGG + Intergenic
1088828717 11:113517124-113517146 GTGGCAACAAGAAGAGAGGGAGG + Intergenic
1088972701 11:114787605-114787627 CTGGGGAGTTGGAGAGAGGAGGG + Intergenic
1089128565 11:116194349-116194371 GAAGGGAGGAGGAGAGAGGAAGG - Intergenic
1089169020 11:116499745-116499767 GTGCGCACAGGGAGGGAGGATGG - Intergenic
1089291289 11:117439214-117439236 GTGGGGACAGGGATGGAGAAAGG - Intronic
1089459072 11:118642214-118642236 GAGGGGAAAAGGGGACAGGAGGG - Intronic
1089489731 11:118874956-118874978 GTGAGGCCAAGGTGGGAGGATGG + Intergenic
1089625576 11:119748814-119748836 GTGGTGAGAAGGACAGAGAAGGG + Intergenic
1089655612 11:119944613-119944635 GGGGAGAGGAGGAGAGAGGAAGG + Intergenic
1089708259 11:120296546-120296568 GAGGGTAGAAGGTGAGAGGAGGG - Intronic
1089768219 11:120783991-120784013 GAGGGGACAGGGAGCGAGGCAGG + Intronic
1089792143 11:120953038-120953060 GTGGGGAGGAGGAGAGGGGGAGG + Intronic
1089842734 11:121432386-121432408 GTAGGGTAAAGGTGAGAGGATGG + Intergenic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090062615 11:123477235-123477257 AGGGGGAGAAGGGGAGAGGATGG - Intergenic
1090207531 11:124894130-124894152 GCGGGAGCAGGGAGAGAGGAAGG + Intronic
1090414067 11:126528728-126528750 GAGAGGAGAAGGGGAGAGGAGGG + Intronic
1090423055 11:126588895-126588917 GGGGGGACCAGGGGAGACGAGGG + Intronic
1090465460 11:126929371-126929393 GTGTGGACAGGAAGAGAGGCAGG + Intronic
1090579995 11:128148986-128149008 GTGGGGACAGTGAGGGAGGCTGG + Intergenic
1090760976 11:129836673-129836695 GTGAGGACACTGAGAGAAGATGG + Intronic
1090939663 11:131375922-131375944 GTGGGCAGAAGGAGAGAAGGAGG - Intronic
1091183434 11:133627716-133627738 GTAGAGACAGGGAGAGAAGAGGG - Intergenic
1091183443 11:133627758-133627780 GTAGAGACAGGGAGAGAAGAGGG - Intergenic
1091183452 11:133627800-133627822 GTAGAGACAGGGAGAGAAGAGGG - Intergenic
1091792623 12:3280504-3280526 GTGGGGCCAGGCAGGGAGGAGGG + Intronic
1091916317 12:4273620-4273642 GAGGGGAAAAGGAGGGAGGGAGG + Intergenic
1092033003 12:5305526-5305548 CTGGGGACAAAGGGAGAGGCAGG - Intergenic
1092041900 12:5392788-5392810 ATGGGGAGAAGAGGAGAGGAAGG - Intergenic
1092161873 12:6319507-6319529 GAGGGGAGGAGGAGAGAGGCTGG + Intronic
1092203759 12:6603361-6603383 TTGGGAAGAGGGAGAGAGGAGGG - Intronic
1092915619 12:13186515-13186537 GTGGATGCAAGGAGGGAGGAGGG + Intergenic
1093121113 12:15272864-15272886 CTGGGGACATGGAGTGGGGAAGG - Intronic
1093477806 12:19574251-19574273 GGGGGCAACAGGAGAGAGGATGG + Intronic
1093535285 12:20216189-20216211 TTGGGGACAGGGGGAGATGATGG + Intergenic
1093658226 12:21722340-21722362 AAGAGGACAAGGGGAGAGGAAGG - Intronic
1093927667 12:24925573-24925595 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1094166669 12:27450287-27450309 GTGGGGGCAGGGAGGGAGGAGGG - Intergenic
1094564097 12:31584211-31584233 AAGGGGACAGGGAGAGAGAAAGG - Intronic
1095709777 12:45275976-45275998 GTGCTGTCAAGGAGGGAGGAGGG - Intronic
1096007776 12:48185992-48186014 CTGGAGGCAAGGAGAGAGGAGGG - Intergenic
1096010781 12:48212637-48212659 GTGGGGAGAGAGAGAGAGGGAGG - Intergenic
1096039592 12:48501515-48501537 GTGGGGAGAAGGAGAGGGAGAGG + Intergenic
1096144654 12:49269779-49269801 GGAGGGACAAGGAGCGGGGAGGG - Intronic
1096233340 12:49909703-49909725 GTGAGGCCAAGGAGAGAAGAAGG + Intergenic
1096318992 12:50593905-50593927 GAGAGGAAAAGGAGAGGGGAGGG - Intronic
1096392254 12:51238694-51238716 GTGGGGCCAAGGCGAGTGGGCGG + Intronic
1096483697 12:51961124-51961146 GAGGGGAAAAGCAGAGAGGATGG - Intronic
1096672547 12:53208954-53208976 GAGGGGACAATTGGAGAGGAGGG + Intergenic
1096985737 12:55755530-55755552 GTAGGGAAACGGGGAGAGGAAGG + Exonic
1097028717 12:56076732-56076754 GTGGGGAGAGGGAGAGGGGGAGG + Intergenic
1097232454 12:57520887-57520909 GTGGGGGAGAGGAGAGAGGGCGG + Intronic
1097308187 12:58091613-58091635 GTGGGCAGAAGGAGAGAGAGAGG + Intergenic
1097587379 12:61530868-61530890 GAGAGGAGAAGGAGAGAGAAGGG - Intergenic
1098606104 12:72392056-72392078 GTGAGGACAAAGCAAGAGGATGG + Intronic
1098738002 12:74131877-74131899 GTGGGGAGAAAGGGAGAGGTGGG - Intergenic
1099508528 12:83506963-83506985 GTGGGGTCTAGAAGAGAAGAAGG + Intergenic
1099594454 12:84642117-84642139 GTGGGGAGTAAGAGAGAGCATGG - Intergenic
1099644232 12:85330426-85330448 GTGGAGAAAGGGAGGGAGGAAGG - Intergenic
1099679209 12:85803480-85803502 GACGGGAGAAGGAGAGATGAAGG + Exonic
1100403499 12:94252324-94252346 GGGAGGCCAAGGAGGGAGGACGG + Intronic
1100864439 12:98841794-98841816 GTGGGGACAAAGGGAGAAAAGGG - Intronic
1101000736 12:100355206-100355228 GTGGGGAGAAAGAGGGAGGGAGG + Intergenic
1101565552 12:105901750-105901772 GAGGAGACTAGGTGAGAGGAAGG + Intergenic
1101567599 12:105922944-105922966 CTGGGGACTAGGGGAGATGAGGG + Intergenic
1101708526 12:107243314-107243336 TTGAGGACAAGGAGGCAGGAAGG + Intergenic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1101876205 12:108598184-108598206 GTGGGGACAGGGGGAGGGGAGGG + Intronic
1101885014 12:108655369-108655391 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1102007389 12:109597287-109597309 GAGGGGACAGGGACAGAGGGAGG - Exonic
1102212627 12:111138361-111138383 GTGGGGGTGGGGAGAGAGGAGGG + Intronic
1102451495 12:113045058-113045080 GGGGGGAAAAGGAAGGAGGAGGG + Intergenic
1102495401 12:113315862-113315884 GTTGGCACAAGGAAAGAGGGAGG - Intronic
1102541010 12:113619257-113619279 GCAGGGGCAAGGAGAGAGGGAGG - Intergenic
1102552550 12:113702233-113702255 GGGGAGAGAAGGAGGGAGGAAGG - Intergenic
1102568441 12:113812458-113812480 TTGGGGACCAGGAGAAGGGAGGG + Intergenic
1102631901 12:114288418-114288440 TTGGGGAGAGGGAGAGAGGAGGG + Intergenic
1102691270 12:114763015-114763037 GTGGGGGCAGGGAGGGTGGAAGG - Intergenic
1102768422 12:115452465-115452487 GTGGGGAGTAGGAGACAGAAAGG - Intergenic
1102839530 12:116103355-116103377 GTGGGGCCAAGGCAGGAGGATGG - Intronic
1102851217 12:116246854-116246876 GTGGGGAGGTGGGGAGAGGAGGG + Intronic
1102930794 12:116860601-116860623 TTGGGGTCTAGGAGGGAGGATGG - Exonic
1103004034 12:117407620-117407642 CTTGGTACGAGGAGAGAGGAGGG - Intronic
1103377073 12:120465367-120465389 GTGGTGAGAAGGAAAGATGATGG - Intronic
1103509720 12:121466589-121466611 GTGGGCAGACGGAGACAGGAAGG - Intronic
1103561956 12:121797472-121797494 GGGGGGACAAAGAAAGAAGAGGG + Intronic
1103594924 12:122019080-122019102 ATGAGGAGAAGGAGAGAGGGAGG - Intergenic
1103769114 12:123306611-123306633 AGGTGGACAAGGTGAGAGGATGG + Intronic
1103834450 12:123807825-123807847 GGGGGAAGAGGGAGAGAGGAAGG + Intronic
1103992111 12:124806213-124806235 GTGGGGAGCAAGAGAGAGGAAGG + Intronic
1104223211 12:126806249-126806271 GTGGTCACCAGGAGTGAGGAAGG - Intergenic
1104235788 12:126935234-126935256 GTGGGGAGAAGGGGACAGTAAGG + Intergenic
1104254844 12:127127013-127127035 GTGGGGACACAGGGAGAAGACGG - Intergenic
1104275860 12:127327196-127327218 GTGTGTAGAAGGAAAGAGGAAGG + Intergenic
1104301397 12:127568343-127568365 GAGGGGAGAAGGAGAGAGAAAGG + Intergenic
1104478104 12:129087120-129087142 TGGGTGACATGGAGAGAGGATGG - Intronic
1104615793 12:130267476-130267498 GTGGGGAGATGAAGAGAGGTTGG - Intergenic
1104757662 12:131279158-131279180 GTGGGGAGAGGGAGAGGGGAAGG + Intergenic
1104948715 12:132429177-132429199 GTGTGGTCAGGGAGGGAGGAGGG - Intergenic
1105351930 13:19623692-19623714 GTGGGGAAAAGGAGGCAGGTGGG - Intergenic
1105437070 13:20388601-20388623 GAGGGAAGAAGCAGAGAGGAAGG - Intergenic
1105587275 13:21756847-21756869 CAGGGGGCAGGGAGAGAGGAAGG - Intergenic
1105595166 13:21830632-21830654 CTGGGGACTACTAGAGAGGAGGG - Intergenic
1105683298 13:22752058-22752080 GTGGGGAAAGGGAGTGAGGCGGG - Intergenic
1105923772 13:24988069-24988091 GGAGGGACAGGGAGAGAGAAGGG - Intergenic
1106603535 13:31207808-31207830 GTGGAGAGAAGTAGTGAGGAAGG - Intronic
1107137430 13:36959207-36959229 GTGGGGAGATGGGGAGATGATGG + Intronic
1107167066 13:37295145-37295167 GTGGAGGCAAGGAGACAAGACGG - Intergenic
1107411369 13:40161644-40161666 GTGGTGTAAAGGGGAGAGGATGG - Intergenic
1107710688 13:43147532-43147554 GGGAGGCCAAGGAGGGAGGACGG + Intergenic
1107768055 13:43758471-43758493 GGAGGGACAAGAAGAGAGGAAGG + Intronic
1107802003 13:44117055-44117077 GTGGGGATTGGGAAAGAGGATGG + Intergenic
1107853885 13:44595942-44595964 CTGAGGACAAGGAGAGTGGCAGG + Intergenic
1108299638 13:49061427-49061449 GAGGGGAGAAGGGGAGGGGAGGG - Intronic
1108299687 13:49061527-49061549 GAGGGGAGAAGGGGAGGGGAGGG - Intronic
1108313537 13:49218029-49218051 TTGGGTCTAAGGAGAGAGGAGGG + Intergenic
1108642390 13:52395015-52395037 GCCAGGAGAAGGAGAGAGGAGGG + Intronic
1108991667 13:56666282-56666304 GGTGGGAAAAGGATAGAGGATGG + Intergenic
1110119853 13:71866851-71866873 GGGGGGAGAAGGAGCGAGGGGGG + Intronic
1110345952 13:74448057-74448079 GGGAGGACGAGGAGAGAGGAAGG + Intergenic
1110868155 13:80420467-80420489 GTGGGGAGAAGGGGGGAGAAGGG - Intergenic
1111027136 13:82542796-82542818 GGAGGGAGAAGGAGAGAGGGAGG + Intergenic
1111032532 13:82622706-82622728 GTGGGGAGCAGGAGATAAGATGG + Intergenic
1111086346 13:83380469-83380491 GGGGGGAGGAGGAGAAAGGAAGG - Intergenic
1111182192 13:84684479-84684501 GTGGGGACAGGGAGAGGGAATGG + Intergenic
1111446196 13:88348129-88348151 GAGGGAAGAAGGAGGGAGGAAGG + Intergenic
1111908942 13:94288417-94288439 CTGGGGACATGGAGGGAGGTGGG - Intronic
1111922323 13:94425261-94425283 GTGAGGACAAGGGCAGAGGCAGG + Intergenic
1112118059 13:96379069-96379091 GTGGAGAAATGGAAAGAGGATGG - Intronic
1112217607 13:97449543-97449565 GTGGGGCAAGGGAGAGTGGATGG - Intronic
1112833117 13:103478084-103478106 ATGGGAGGAAGGAGAGAGGAAGG + Intergenic
1113331324 13:109330729-109330751 GGGGGGCCAAGGCAAGAGGATGG - Intergenic
1113536886 13:111075206-111075228 GTGAGGACAAGGCAGGAGGATGG - Intergenic
1113637513 13:111929707-111929729 GGGGGGGCATGGAGGGAGGAAGG + Intergenic
1113662746 13:112118236-112118258 GTGTGGTAGAGGAGAGAGGACGG + Intergenic
1113673205 13:112189010-112189032 CTGTAGACTAGGAGAGAGGAAGG + Intergenic
1113738306 13:112693458-112693480 GTGGGTACGGGGAGAGGGGACGG + Intronic
1113937458 13:114001928-114001950 GTGGGGAGCAGGAGACAGGATGG + Intronic
1113954344 13:114089240-114089262 GTTCGGAGGAGGAGAGAGGAGGG + Intronic
1113986084 13:114316923-114316945 CTGGGGACAAGAAGATAGGTGGG + Intronic
1114492273 14:23110661-23110683 ATGGGGATAAGGAGAGAGGATGG + Intergenic
1114635406 14:24184259-24184281 GAGGGGACAAGGGCAGAGGCAGG + Intronic
1114660022 14:24338132-24338154 GGGGGCACGAGGAGGGAGGAGGG + Intronic
1114730831 14:24990887-24990909 GAGGGGACAGGGAGAGGGAAGGG + Intronic
1114887848 14:26877037-26877059 GAGGGGAAAAGGAGAGAGTTAGG - Intergenic
1115222638 14:31072608-31072630 GGGAGGCCAAGGTGAGAGGATGG - Intronic
1115629376 14:35228449-35228471 GCGGGGAGATGGAGGGAGGAAGG - Intronic
1116909083 14:50438778-50438800 TTGGGGAAATGGAGAAAGGAAGG - Intronic
1117244383 14:53869608-53869630 GAGGGGGGAAGGTGAGAGGAGGG + Intergenic
1117303289 14:54449204-54449226 TGGGGGTCTAGGAGAGAGGAGGG - Intergenic
1117366268 14:55031627-55031649 GTGGGGAGAAAGGGAAAGGAGGG + Intronic
1117617282 14:57546432-57546454 GGGGGGACCAGAAGGGAGGAGGG + Intergenic
1117694111 14:58341026-58341048 ATGGGGAGAGGGAGAGAGAAGGG - Intronic
1118320239 14:64748610-64748632 GGGGGGAGAAGCAGAGAGGAGGG + Exonic
1118348074 14:64954234-64954256 GTGAAGAGAAGGAGGGAGGAAGG + Intronic
1118366448 14:65101703-65101725 GTGGGGGCAAGGGGTGGGGAGGG - Intronic
1118428796 14:65693527-65693549 GTGGGGAGAGGGAGAGAGGGAGG + Intronic
1118489856 14:66248430-66248452 GTGGAGAAAAAGGGAGAGGAAGG + Intergenic
1118517909 14:66546784-66546806 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
1118584532 14:67340682-67340704 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1118907630 14:70034016-70034038 TTGGGGACCAGGAGTAAGGATGG - Intergenic
1118988986 14:70781032-70781054 CTGGGGAAAAGCACAGAGGATGG - Intronic
1119137213 14:72232030-72232052 GGGAGGACAAGGATAGAAGAAGG + Intronic
1119184843 14:72632828-72632850 GAGGGGAAAGGGAGAGGGGAGGG + Intronic
1119487476 14:75000344-75000366 GGGAGGACAAGGTGGGAGGATGG - Intergenic
1119853179 14:77880601-77880623 GTCCAGACAAGGAGTGAGGAGGG + Intronic
1120205320 14:81581327-81581349 GAGAAGACAAGGAGAGAGGATGG + Intergenic
1120252756 14:82079137-82079159 GAGGGGCCAATGAAAGAGGAGGG - Intergenic
1120305494 14:82764449-82764471 GTAGGGAGAAGGAAAGAGTAAGG - Intergenic
1120708079 14:87765284-87765306 GTGGGGAGAGGGACAGAGGGAGG + Intergenic
1120716200 14:87843510-87843532 GAGGGGAGAAGGAGGGAGGAAGG - Intronic
1120912698 14:89682095-89682117 GGGAGGCCAAGGCGAGAGGATGG + Intergenic
1121357779 14:93230278-93230300 GAGGGGACAAGGAGAGGGCGCGG + Intergenic
1121427556 14:93863374-93863396 GTGGAGGCCAGGAGAGAGCAGGG + Intergenic
1121641170 14:95485808-95485830 GTGAGGAGCAGGAGAGATGAGGG - Intergenic
1121660399 14:95631086-95631108 GCTGGGCCAAGGAGAGAGGGTGG + Intergenic
1121835043 14:97084842-97084864 GTGAGGACACGGGGAGAGGATGG - Intergenic
1122020240 14:98831912-98831934 GTGAAGACAGGGAGTGAGGATGG + Intergenic
1122117604 14:99535590-99535612 GTCGGGCCCAGGAGGGAGGAGGG + Intronic
1122153459 14:99736972-99736994 GTGGGGACCAGGGGAGGGGCTGG + Intergenic
1122269639 14:100562791-100562813 GCGGGGACAAAAAGAAAGGAAGG - Intronic
1122302099 14:100737070-100737092 GTGGGGAGAACGGGAGGGGAAGG - Exonic
1122329759 14:100904355-100904377 GTGTGGACGGGGAGAGGGGAGGG + Intergenic
1122375527 14:101254499-101254521 GTGAGGACACAGAGAGAAGACGG - Intergenic
1122440125 14:101726018-101726040 GTGGGGACCAGGAGCTGGGAGGG + Intergenic
1122448163 14:101782954-101782976 GGGGGGAGAGGGAGAGAGGGGGG - Intronic
1122635582 14:103128153-103128175 TAGGGGAGAAGGTGAGAGGAAGG + Intronic
1122672331 14:103382256-103382278 AAGGGGAAAAAGAGAGAGGAAGG + Intergenic
1122914775 14:104853747-104853769 TTGGGGCCAAGGAGATATGAGGG - Intergenic
1202904876 14_GL000194v1_random:63589-63611 GTGGGGAGAGGGAGAGAGAGAGG + Intergenic
1123433597 15:20238659-20238681 GGGAGGCCAAGGTGAGAGGATGG + Intergenic
1123434975 15:20248005-20248027 GGGGAGAGAAGGGGAGAGGAGGG + Intergenic
1123476056 15:20593140-20593162 GTGGGGACAGGGAGAAAAGGGGG + Intergenic
1123587462 15:21772726-21772748 TGGGGGACGGGGAGAGAGGAGGG + Intergenic
1123587472 15:21772747-21772769 GGGGGGATGGGGAGAGAGGAGGG + Intergenic
1123624100 15:22215291-22215313 TGGGGGACGGGGAGAGAGGAGGG + Intergenic
1123624110 15:22215312-22215334 GGGGGGATGGGGAGAGAGGAGGG + Intergenic
1123641956 15:22407224-22407246 GTGGGGACAGGGAGAAAAGGGGG - Intergenic
1124004653 15:25786074-25786096 GTGGGGAGAAGGAGAGCTGAGGG + Intronic
1124365412 15:29067671-29067693 TTGTGGAAAAGGCGAGAGGATGG - Intronic
1124606111 15:31171442-31171464 GTGAGGACATAGGGAGAGGATGG - Intergenic
1124914037 15:33951049-33951071 GTGGGAGGAAGGGGAGAGGAGGG + Intronic
1125036615 15:35132331-35132353 GTAGGGACAGGGAGATAGAAAGG + Intergenic
1125839768 15:42789209-42789231 GGGGGTTCAAGGAGGGAGGAAGG - Intronic
1125898711 15:43325696-43325718 GGGGGGAAAAGAAGGGAGGAGGG - Exonic
1126110896 15:45174122-45174144 GTGGGGAAAAGGAGAAAGGGAGG - Intronic
1126789586 15:52209009-52209031 CAGAGGACGAGGAGAGAGGATGG + Intronic
1126912603 15:53431549-53431571 GTAGAGACAAGGAGAGAAGCGGG + Intergenic
1127121639 15:55777054-55777076 GTGGGGAAGGGGAGAGAGGGAGG + Intergenic
1127488108 15:59437955-59437977 GTGGGAACGAGGAGGGAGGAGGG + Intronic
1127730736 15:61799996-61800018 GTGGTGAAAAGGAGAGAGAGGGG - Intergenic
1128134744 15:65254535-65254557 GTGGGGCACAGTAGAGAGGAGGG + Intronic
1128145795 15:65331895-65331917 GTGAGGACCAGGGGAGAGCAGGG - Intronic
1128239876 15:66094497-66094519 GAGGGGACATGGGGAGAGGGAGG + Intronic
1128579044 15:68796016-68796038 GTGTGGAAAAGGGGAGATGAAGG + Intronic
1128638394 15:69317775-69317797 ATGGGGAGAAGGGGAAAGGAGGG - Intronic
1128729868 15:70013889-70013911 GTGTGGGCAGGGAGAGAGGGAGG + Intergenic
1128792341 15:70442475-70442497 GTGGTGCCCAGGAGAGACGATGG + Intergenic
1128826043 15:70718273-70718295 GGGGAGAGAGGGAGAGAGGAAGG + Intronic
1128957220 15:71960938-71960960 CTGGGGACAAGGAGAAAGTGTGG + Intronic
1129514147 15:76146683-76146705 CTGGGGACAAAGAAAAAGGAGGG + Intronic
1129558402 15:76538565-76538587 GTGGGGTCGGGGAGAGGGGAGGG + Intronic
1129613768 15:77082102-77082124 CTGGGGACAGGGAGAGACGGGGG + Intronic
1129653411 15:77507294-77507316 GTGGGGAGCAGGGAAGAGGAAGG - Intergenic
1130113487 15:80986270-80986292 GGGGAGATAGGGAGAGAGGATGG + Intronic
1130118258 15:81024359-81024381 GTGCTGACAATGAGGGAGGAGGG + Intronic
1130862310 15:87901776-87901798 GGGGAGAAAGGGAGAGAGGAAGG + Intronic
1130973319 15:88752798-88752820 GTGGGGACTGGTAGAGAGCAGGG - Intergenic
1130985439 15:88841917-88841939 GTGGGGAGATGGGGAGGGGAAGG - Intronic
1131075227 15:89491211-89491233 GAGGGGACAGGCAGGGAGGATGG - Intronic
1131357289 15:91757090-91757112 GAGGGAAGAGGGAGAGAGGAGGG - Intergenic
1131467585 15:92668013-92668035 GAGGGGAAGAGGAGAGGGGAAGG + Intronic
1131670770 15:94617311-94617333 GAGGGGGCTTGGAGAGAGGAAGG - Intergenic
1131818326 15:96245879-96245901 GTGGGGAGAGGGAGATAGGCAGG + Intergenic
1131916589 15:97272270-97272292 GAGGTGACAGGGAGAGAAGATGG - Intergenic
1132053021 15:98626250-98626272 GTGGGGACAGGGAGGCAGGATGG - Intergenic
1132299524 15:100767432-100767454 GAGGGGAGATGGAGAGAGGGAGG - Intergenic
1132574619 16:658731-658753 GTGGGGGCAGGGAGAGCAGAAGG + Intronic
1132606094 16:794357-794379 GTGGGGAGCAGGAGCCAGGAGGG + Intronic
1133254173 16:4506416-4506438 GTGGGTCCAAGGTGGGAGGAAGG + Intronic
1133297703 16:4762943-4762965 GTGGTGACAGGGAGAGACCATGG - Intronic
1133873824 16:9714268-9714290 GTGGGGAGAGGGAGATTGGAAGG - Intergenic
1133959463 16:10480400-10480422 GTGGGGAAAAGAAGAGGGGAAGG - Intronic
1134075774 16:11290401-11290423 GTGGGGACAAGGGGGGAACAAGG + Intronic
1134122768 16:11596614-11596636 GGGGAGAGGAGGAGAGAGGAGGG + Intronic
1134311172 16:13076471-13076493 GTGGGGGAAAGGAGGGAGCAGGG - Intronic
1134439106 16:14286932-14286954 GAGGTGACAGGGAGAGAGGGAGG + Intergenic
1134488949 16:14681200-14681222 GGGGGGAGAGAGAGAGAGGAGGG + Intronic
1134586196 16:15413532-15413554 TTGTGGACAAAGAAAGAGGAAGG - Intronic
1134774113 16:16837085-16837107 CTGGGGGAAAGGAGAGGGGAGGG + Intergenic
1135010870 16:18877442-18877464 GTGGGGAGAGGGAACGAGGAAGG + Intronic
1135031841 16:19044857-19044879 GGGGAGAGAAGGAGAGAGGATGG - Intronic
1135122729 16:19780408-19780430 GAGAGGCCAAGGAGGGAGGATGG - Intronic
1135168743 16:20164604-20164626 ATGGGGAGGAGGAGAGAAGAGGG - Intergenic
1135317757 16:21465027-21465049 GTGGGGAGAGGGAACGAGGAAGG + Intergenic
1135331373 16:21562897-21562919 GGGGGGAGAAAGAGAGAGAAAGG - Intergenic
1135370652 16:21896826-21896848 GTGGGGAGAGGGAACGAGGAAGG + Intergenic
1135403315 16:22181101-22181123 GTGGCGTCCAGGTGAGAGGAGGG + Intronic
1135441134 16:22473893-22473915 GTGGGGAGAGGGAACGAGGAAGG - Intergenic
1135558229 16:23454631-23454653 GAGGAGGGAAGGAGAGAGGAGGG + Intergenic
1135591858 16:23710874-23710896 ATGGGCCCAAGGAGGGAGGAGGG + Intronic
1135889200 16:26342117-26342139 GTGGCTTGAAGGAGAGAGGAAGG - Intergenic
1136073532 16:27803146-27803168 GTGAGGACCGGGGGAGAGGAGGG - Intronic
1136122206 16:28145347-28145369 GTGGGGAGAAGAGGAGGGGAAGG - Intronic
1136187725 16:28597848-28597870 GTGAGGACAAAGAACGAGGAGGG - Intergenic
1136234574 16:28905792-28905814 GTGGGGAAAGGGAGAGGGCATGG - Intronic
1136327970 16:29546477-29546499 GTGGGGAGAGGGAACGAGGAAGG + Intergenic
1136367270 16:29814569-29814591 GGGGAGACAAGGAGAGACAAAGG - Exonic
1136655168 16:31705324-31705346 GTCAGGAACAGGAGAGAGGAGGG - Intergenic
1136849661 16:33603029-33603051 GGGGAGAGAAGGGGAGAGGAGGG - Intergenic
1137688482 16:50403164-50403186 ATGGTGAGAAGGAGGGAGGAAGG + Intergenic
1137715887 16:50598097-50598119 TTGGGGACAAGGGGACAGAAGGG + Intronic
1137887915 16:52126519-52126541 GAGGGGATAGTGAGAGAGGAAGG - Intergenic
1137977260 16:53042295-53042317 GAGGGGAGACGGAGGGAGGAAGG - Intergenic
1137979627 16:53058592-53058614 GTGGTGAAAGGGAGAGAGGCTGG + Intronic
1138344141 16:56309510-56309532 GTGGGGACAAGGACAGAGAAGGG + Intronic
1138439878 16:57027717-57027739 TTGGGAACAAGGAAAGAGCATGG + Intronic
1138452773 16:57103654-57103676 GAGGGGACAGTGAGAGAGGCAGG - Intronic
1138478112 16:57284010-57284032 GGGGTGAAAAAGAGAGAGGAGGG + Intronic
1138479124 16:57290175-57290197 GTGGGGATAAGGTCAGAGCAGGG - Intergenic
1138573488 16:57891155-57891177 GTGGGGGCAAGAAGAGAGGGTGG + Intronic
1138627728 16:58265935-58265957 GTGGGAGGAAGGAGAGTGGAGGG - Intronic
1138642762 16:58397819-58397841 GTGGGGAGAGGGAGAGGGAAAGG + Intronic
1138969896 16:62131714-62131736 GTCAGGCAAAGGAGAGAGGAAGG - Intergenic
1139252371 16:65508649-65508671 GTAGGGACAAAAAGAGATGAGGG - Intergenic
1139282645 16:65783907-65783929 GTGGAGGCCCGGAGAGAGGAAGG - Intergenic
1139670138 16:68487277-68487299 CTGGGGACATGGAGAGTGGGTGG - Intergenic
1139764546 16:69216053-69216075 GTGAGGCCGAGGACAGAGGACGG - Intronic
1139889401 16:70238966-70238988 GTGGGGAGAGGGAATGAGGAAGG + Intergenic
1140057801 16:71540745-71540767 CTGGTGACAAGCATAGAGGATGG + Intronic
1140092547 16:71850213-71850235 GTTGGCAGAAGGAGATAGGAGGG - Exonic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140833451 16:78772184-78772206 GAGGGTAGAGGGAGAGAGGAAGG - Intronic
1141028315 16:80568385-80568407 GTGGGGAGAATGGGAGAGGTGGG - Intergenic
1141028337 16:80568453-80568475 GTGGGGAGAATGGGAGAGGTGGG - Intergenic
1141028357 16:80568521-80568543 GTGGGGAGAATGGGAGAGGTGGG - Intergenic
1141219023 16:82051907-82051929 GTGGGGTCTGGGAGAGAGCAGGG - Intronic
1141430948 16:83969883-83969905 GCAGGGAAGAGGAGAGAGGAAGG - Intronic
1141493912 16:84393693-84393715 GAGGGGAGGAGGATAGAGGATGG + Intronic
1141535666 16:84678046-84678068 GTGAGGACACGGGGAGAAGACGG - Intergenic
1141691436 16:85598970-85598992 AGGGGGAGTAGGAGAGAGGAGGG - Intergenic
1141770501 16:86087033-86087055 GTAGGGACAAGGAGGGCGCAGGG + Intergenic
1141775581 16:86120950-86120972 GTGGGGAGAAAGAGAGAGGGAGG - Intergenic
1141909738 16:87050490-87050512 CTGGGGAGAACGAGAAAGGAAGG - Intergenic
1141999903 16:87658341-87658363 GCGGGGAGAAGGAGAGAGAGAGG - Intronic
1142403334 16:89872665-89872687 TTGGGGACATGGGGACAGGAGGG - Intergenic
1142419382 16:89961100-89961122 GTGGTGGCAGGGAGAGAAGAGGG + Intronic
1142889830 17:2936052-2936074 GTGGAGACAGGGAGAGGAGATGG - Intronic
1142906247 17:3044197-3044219 GTGGGGACCAGCAGACAGGAAGG - Intergenic
1143342619 17:6225637-6225659 GTGGGGAGAAGGAGAGGGAGCGG - Intergenic
1143356949 17:6337322-6337344 ATGGGGGCAAGGAGAGAGCCAGG - Intergenic
1143536526 17:7543699-7543721 GTGGGGAGAAGAGGACAGGAGGG + Intergenic
1144045735 17:11452982-11453004 GTGGGGAAAAGGGGAGAATATGG - Intronic
1144054368 17:11525902-11525924 GGGAGGCCAAGGTGAGAGGATGG + Intronic
1144077481 17:11732467-11732489 GTGGAGAGGAGGAGAGGGGAGGG - Intronic
1144278791 17:13703335-13703357 GCGGGGAGAGGGAGTGAGGAAGG + Intergenic
1144311401 17:14017411-14017433 GTGTCGACAAGGAGTGAGGGTGG - Intergenic
1144480482 17:15624957-15624979 CTAGGGAGAATGAGAGAGGACGG + Intronic
1144561031 17:16320402-16320424 GGAGAGAAAAGGAGAGAGGAAGG + Intronic
1144696418 17:17306735-17306757 GCAGGGCCAAGGAGAGAGAAAGG - Intronic
1144750866 17:17647180-17647202 ATGGGGCCAAGGAGTTAGGAAGG + Intergenic
1144871605 17:18375625-18375647 GTGGGGCCCTGGGGAGAGGAAGG - Intergenic
1144917828 17:18738788-18738810 CTAGGGAGAATGAGAGAGGACGG - Intergenic
1145217994 17:21066575-21066597 GTGGTGCAGAGGAGAGAGGAGGG + Intergenic
1145242902 17:21250037-21250059 GTGGGGACCAGGACAGAGCAGGG - Intronic
1145792988 17:27639326-27639348 GGAGGGAGAGGGAGAGAGGAAGG - Intronic
1145958790 17:28873350-28873372 GTGGGGGTAGGGAGTGAGGAGGG - Intergenic
1145984919 17:29039208-29039230 GTGGGGACAGAGATAGAGGAGGG - Intronic
1146320984 17:31846197-31846219 GAGGGCACACGGAGAGAGAAGGG - Intergenic
1146477527 17:33174961-33174983 TAGGGGGCAGGGAGAGAGGAGGG - Intronic
1146487909 17:33259014-33259036 GTGGGGAAGAGCAGAAAGGAAGG + Intronic
1146695246 17:34903926-34903948 GTGGGGTGAAGGAGAGAAGATGG + Intergenic
1146935657 17:36811176-36811198 GTGGGGAGCAGGAGGGAGGGAGG - Intergenic
1146944886 17:36866823-36866845 GGGGGGACCTGGGGAGAGGAAGG + Intergenic
1146957841 17:36947143-36947165 GTAGGGACCAGGACAGAGAAGGG + Intergenic
1146992997 17:37292614-37292636 GGGAGGCCAAGGTGAGAGGATGG + Intronic
1147050403 17:37790082-37790104 GTGGGGAGAAAGAGACAGGGAGG + Intergenic
1147308308 17:39578657-39578679 GTGGGAAGTCGGAGAGAGGAAGG + Intergenic
1147424906 17:40341853-40341875 GAGGGGACAAGGACGGAAGAGGG - Intronic
1147516484 17:41122644-41122666 GGGGAGAGAGGGAGAGAGGAAGG + Intergenic
1147571266 17:41572448-41572470 GTGGGCACAAGGTGGGAGCAAGG - Intergenic
1147588434 17:41666229-41666251 AGGGGGAGCAGGAGAGAGGAAGG - Intergenic
1147610346 17:41798342-41798364 CTGGGGACAGGGAGAGGAGAGGG - Intergenic
1148232766 17:45947221-45947243 GTGGTGGGCAGGAGAGAGGAGGG + Intronic
1148384238 17:47222845-47222867 GTGGGGAGAAGGTGGGTGGAGGG - Intronic
1148467559 17:47874005-47874027 GAGGGAAGAAGGAGGGAGGAAGG - Intergenic
1148482617 17:47970079-47970101 CTGGGGACAAGGAGGCTGGAAGG - Intronic
1148609182 17:48952667-48952689 GGGAGGCCAAGGTGAGAGGATGG - Intergenic
1148638259 17:49165627-49165649 GTGGGGGGAAAGAGAGAGGAAGG - Intronic
1149098208 17:52870672-52870694 GAGGGGGAAAGAAGAGAGGAAGG + Intronic
1149267308 17:54941013-54941035 CTAGGGAAAAGGAGAGAGGGAGG - Intronic
1149418248 17:56482928-56482950 GTGGGGACGGTGAGAGAGAAAGG - Intronic
1149637281 17:58181027-58181049 GGAGGGAAAAGGAGTGAGGAGGG - Intergenic
1149655455 17:58307538-58307560 GTGGAGGAAAGGAGGGAGGAGGG + Intronic
1150004928 17:61463563-61463585 GCAGGGAGAAGGAGAGGGGAAGG + Intronic
1150203738 17:63384309-63384331 GGGAGGCCAAGGAGGGAGGACGG - Intronic
1150711147 17:67531888-67531910 GAGGGGAGGGGGAGAGAGGAAGG - Intronic
1150947682 17:69765588-69765610 GAGGGGGAAGGGAGAGAGGAAGG - Intergenic
1151209890 17:72536669-72536691 GTGGGGACATTGGGGGAGGACGG + Intergenic
1151290839 17:73148705-73148727 AGGGGGAGAAGAAGAGAGGATGG - Intergenic
1151345823 17:73500614-73500636 GAGGGAAGATGGAGAGAGGATGG - Intronic
1151371384 17:73648334-73648356 GTGGGTACAAGGCGTGAGGAGGG - Intergenic
1151448242 17:74181329-74181351 GTGGAGACAAGGGGAGGGGTGGG - Intergenic
1151630813 17:75309622-75309644 GTGGGGTGAAGCAGAGAGAAAGG - Intergenic
1151937331 17:77270607-77270629 GTAGGTGCAAGGAGAGAGCAGGG - Intergenic
1152085005 17:78212641-78212663 TTGGGGAGAGGGAGAGAGAAAGG + Intergenic
1152105134 17:78324313-78324335 GAGGAGGGAAGGAGAGAGGAGGG + Intergenic
1152271160 17:79325695-79325717 GTAGGGAAAGGGAGAGAGGGAGG - Intronic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152598449 17:81249492-81249514 GGAGGGAGAAGGAGGGAGGAGGG + Intronic
1152799577 17:82324520-82324542 GAGGGGACACGGGGAGGGGAGGG - Intronic
1152847956 17:82614096-82614118 TGGGGCACAGGGAGAGAGGAGGG + Intronic
1152928521 17:83098825-83098847 GTGGGGACAAGGAGGGGGGCTGG - Intergenic
1153554531 18:6297174-6297196 GTGGGGACATGGTGAGTTGATGG + Intronic
1153658128 18:7303492-7303514 CTGGGGAGGAGAAGAGAGGATGG - Intergenic
1153756873 18:8293064-8293086 GTGAGGATCAGGTGAGAGGATGG + Intronic
1153779239 18:8479474-8479496 GTGGTGCAAAGGAGAGAGAAAGG - Intergenic
1154031245 18:10756062-10756084 ATGGGGATAAGGATAAAGGATGG + Intronic
1155213667 18:23623543-23623565 GGGGGGCCAAGGCGGGAGGATGG + Intronic
1155364167 18:25033784-25033806 GGGGGGAGAGGGAGAGAGGGGGG + Intergenic
1155385751 18:25275642-25275664 ATGGGGAGAAGGAAAGAGGGAGG - Intronic
1155870380 18:31019846-31019868 ATGAGGACAAAGAGAAAGGATGG + Intronic
1156077089 18:33292431-33292453 GTAGGGACATAGAGAGAGGTTGG + Intronic
1156229103 18:35136743-35136765 TGGGGGCAAAGGAGAGAGGAAGG - Intronic
1156303829 18:35858474-35858496 GTGGGGTCCAGAAGAGAAGAAGG + Intergenic
1156440191 18:37178187-37178209 GTGGGGACATGGGGAGAGAGGGG - Intronic
1156449879 18:37260976-37260998 GAGGGGACAGGGTGAGGGGAGGG - Intronic
1156456209 18:37296048-37296070 TGGGGGACAAGGAGAAAGGAAGG - Intronic
1156568294 18:38221522-38221544 ATGGGGAAAAGGAGAGAAGGGGG + Intergenic
1156637533 18:39049330-39049352 GTGGGGACAGGGAGTGACAAAGG + Intergenic
1156673704 18:39502000-39502022 GTGGAGAAAAGAAGAGTGGAGGG + Intergenic
1156696919 18:39778586-39778608 CTGGGGAGAAGGAGATAGAAGGG + Intergenic
1156843691 18:41638807-41638829 GGGGGGCCGAGGCGAGAGGATGG + Intergenic
1157475223 18:48019732-48019754 CTGGGGACCAGCAGAGAGGAGGG - Intergenic
1157572663 18:48723399-48723421 GTGGGGAGAAGGTGGGAGGGTGG - Intronic
1157595019 18:48859182-48859204 ATGAGGACAGGGAGAGTGGAAGG - Intronic
1157673377 18:49549629-49549651 GAGGGACCAGGGAGAGAGGAGGG + Intergenic
1157724418 18:49952938-49952960 GAGGTGACAGGAAGAGAGGACGG - Intronic
1157732506 18:50016512-50016534 GTTGGGACAAGGGCAGAGGTAGG - Intronic
1157879901 18:51311570-51311592 TTGGGGTAAGGGAGAGAGGATGG + Intergenic
1158058715 18:53312965-53312987 GTGGGGAGAGGAAGGGAGGAGGG + Intronic
1158851057 18:61496090-61496112 GAGGAGAGAAGGAGAGAGGAAGG - Intronic
1158898743 18:61940995-61941017 GTGGTGAGAGAGAGAGAGGAAGG + Intergenic
1159134268 18:64318651-64318673 GGGAGGAGAAAGAGAGAGGAAGG - Intergenic
1159217017 18:65405629-65405651 GAGGGGAGAAGGAGGTAGGAGGG + Intergenic
1159505564 18:69330807-69330829 TTGGGGACTAGGAGAGAGAAAGG - Intergenic
1159624700 18:70679068-70679090 GGGAGGGCAAGGAGAGGGGAGGG - Intergenic
1159879409 18:73844562-73844584 GTGAGGACACAGAGAGAAGATGG - Intergenic
1159915932 18:74187686-74187708 GTGGCAAGGAGGAGAGAGGAAGG - Intergenic
1159994998 18:74955829-74955851 GTGTGTGCAGGGAGAGAGGATGG - Intronic
1160050244 18:75426704-75426726 GTGGGGATCAAGACAGAGGAAGG + Intronic
1160066056 18:75575364-75575386 CTGGGGCCAAGGAGAGTGAAGGG - Intergenic
1160073870 18:75653233-75653255 ATGGGGAAAAGGTGAGAGAAAGG - Intergenic
1160113595 18:76056771-76056793 GAGGGGACGAGGAGGAAGGATGG + Intergenic
1160387539 18:78505619-78505641 TTGGGGGCCAGGAGGGAGGAAGG - Intergenic
1160550898 18:79693202-79693224 GTGGTGACCGGGAGGGAGGATGG + Intronic
1160698778 19:496706-496728 GGGGGGCTCAGGAGAGAGGAGGG + Intronic
1160698787 19:496742-496764 GAGGGGCGCAGGAGAGAGGAGGG + Intronic
1160698804 19:496798-496820 GAGGGGCGCAGGAGAGAGGAGGG + Intronic
1160698892 19:497034-497056 GGGGGGCTCAGGAGAGAGGAGGG + Intronic
1160790143 19:919311-919333 GTGGGGAGACTGGGAGAGGAGGG - Intronic
1160872025 19:1282055-1282077 GTGGGATGAGGGAGAGAGGAAGG + Intergenic
1160970709 19:1766595-1766617 GTGAGGAGGAGGAGAGGGGATGG + Intronic
1161030742 19:2056736-2056758 GGGGGGAGGAGGAGAGGGGAGGG - Intergenic
1161038698 19:2098837-2098859 GGGGGTAAAGGGAGAGAGGAGGG + Intronic
1161226154 19:3146905-3146927 GTGAGGAGGGGGAGAGAGGAAGG - Intronic
1161241364 19:3225392-3225414 GTGGGGTGAGGGAGGGAGGAAGG - Intronic
1161258362 19:3322108-3322130 ATGGGGACATGGAAGGAGGAGGG + Intergenic
1161403970 19:4081693-4081715 GGGGGGAGTAGGAGGGAGGAAGG - Intergenic
1161442606 19:4300816-4300838 GTGAGGACAGGGAGAGAGGGAGG + Intronic
1161505776 19:4642723-4642745 GTGAGGAGGAGGAGAGAGGGAGG + Intronic
1161554496 19:4932982-4933004 GGGGAGGAAAGGAGAGAGGAAGG - Intronic
1161625404 19:5323649-5323671 GTGAGGACGGGGAGAGAGGAAGG + Intronic
1161644304 19:5443848-5443870 GAGGAGAGAAGGGGAGAGGAGGG + Intergenic
1162051482 19:8036532-8036554 GAGGGGACAATGAGGCAGGATGG + Intronic
1162184454 19:8894195-8894217 GTGGGGCCAGGGAGGGATGATGG + Exonic
1162389377 19:10380226-10380248 GTGGGGACGAGAAAGGAGGAAGG - Intronic
1162453027 19:10766130-10766152 GTGAGGAGAGGGAGAGAGGGAGG - Intronic
1162552133 19:11363883-11363905 AGGGGGCCAAGGAGACAGGAAGG + Intronic
1162683065 19:12361691-12361713 GTGGGGACAGCGAGAGGGGGAGG - Intronic
1162967813 19:14164283-14164305 GTGGGGACATGGAGAGGGACAGG + Intronic
1163013570 19:14440415-14440437 TTGGGAACAAGGAGAGGAGATGG + Intronic
1163090273 19:15014657-15014679 GTGGGGAGGAGGGGAGAAGAAGG + Intronic
1163090461 19:15016075-15016097 GTGGGGAGGAGGGGAGAAGAAGG + Intronic
1163115350 19:15185560-15185582 GTGGGGGCAAGGAGCCAGGCGGG + Exonic
1163142874 19:15362366-15362388 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1163287457 19:16357534-16357556 GCGGGAAGCAGGAGAGAGGAGGG + Intronic
1163436524 19:17299168-17299190 GGGAGGCCAAGGAGGGAGGATGG + Intronic
1163507599 19:17717515-17717537 GGAGGGACAAGGATAGAGGAAGG + Intergenic
1163507797 19:17718576-17718598 GAGGGGAGAAGAGGAGAGGAGGG + Intergenic
1163513905 19:17751606-17751628 GGGGGGCCAAGGCGAGATGATGG - Intronic
1163523378 19:17805560-17805582 GTTGGGACAGGGCGAGAGAAAGG - Intronic
1163548541 19:17952680-17952702 GAGGGGACAGAGAGGGAGGAGGG - Intronic
1163582681 19:18147677-18147699 GTGGGCCCCAGGAGGGAGGAAGG + Intronic
1163777689 19:19227657-19227679 TTGGGGTCAAAGAGAGAGGCAGG - Exonic
1163797035 19:19343700-19343722 GTGGGGACTAGGGGAGATGACGG + Intronic
1164441816 19:28284869-28284891 GTGGAGAGAAGGAGGGTGGAGGG + Intergenic
1164520215 19:28973319-28973341 GAGGGCAGAAGGAGAGACGAGGG - Intergenic
1164581626 19:29438695-29438717 GAGGGGAGAGGGAGAGAGGGAGG + Intergenic
1164591527 19:29510244-29510266 GTGGGGACAGTGATAGAGGACGG - Intergenic
1164591867 19:29511875-29511897 GCGGGGATGAGGAGAAAGGAGGG + Intergenic
1164592189 19:29513121-29513143 GGGGGGATAAGGAGGAAGGAGGG + Intergenic
1164592291 19:29513484-29513506 GGGGGTATAAGGAGAAAGGAGGG + Intergenic
1164899474 19:31906179-31906201 GTGGGGCCAAGGAGATAGGAAGG + Intergenic
1165029803 19:32989728-32989750 GGGAGGCCAAGGTGAGAGGATGG + Intronic
1165086694 19:33353942-33353964 GGGAGGCCAAGGAGAGTGGATGG + Intergenic
1165393573 19:35551717-35551739 GTGGGGGGAAGGAGAGAGGCAGG + Intronic
1165462361 19:35951613-35951635 GTGGGGCCATGGAGGGTGGAGGG + Intergenic
1165482079 19:36070033-36070055 GTGGGGAGAAGGAGAGGGAGAGG + Intronic
1165742011 19:38210330-38210352 GGAAGGACCAGGAGAGAGGAAGG - Intergenic
1165792488 19:38500414-38500436 GGGGGAACAAGGAGAGAGGTCGG + Intronic
1165920981 19:39297817-39297839 CTGGGGAGAAGGAGACAGGAGGG - Intronic
1166015178 19:39974215-39974237 GTGGAGATTAGGAGGGAGGAAGG + Intronic
1166179072 19:41094477-41094499 CTGGGGACACAGAGAGAGGCTGG - Intronic
1166191325 19:41178795-41178817 GAGGGGCCAAGGAGGGAAGATGG + Intergenic
1166230368 19:41422931-41422953 GTGGGGGTCAGGAGGGAGGATGG - Intronic
1166301109 19:41912767-41912789 GTGGAGACACGGAGAGAAGGGGG + Intronic
1166374677 19:42320989-42321011 GGGAGGGCAAAGAGAGAGGATGG - Intronic
1166390336 19:42405728-42405750 GGGAGGCCAAGGCGAGAGGATGG + Intronic
1166841760 19:45701769-45701791 GTGGGGGCGATTAGAGAGGAAGG - Intronic
1166901439 19:46067127-46067149 GCAGGCACAAGGAGAGTGGATGG - Intronic
1166916978 19:46202052-46202074 GTGGGGAGGAGGGGAGAGGTCGG + Intergenic
1167022170 19:46885526-46885548 GTAGGGCCAGAGAGAGAGGAGGG - Intergenic
1167042858 19:47032798-47032820 GGTGAGACCAGGAGAGAGGAAGG - Intronic
1167104756 19:47423712-47423734 GTGGCGAGAAGGAGAGAGTGAGG + Intergenic
1167229814 19:48275248-48275270 GGAGGGAAAAAGAGAGAGGAAGG + Intronic
1167396849 19:49235077-49235099 GGGGAGGAAAGGAGAGAGGAAGG + Intergenic
1167427918 19:49439022-49439044 CAGGGGACAAGGACAGAGAAGGG + Intronic
1167435164 19:49474859-49474881 ATGGGGAGATGGACAGAGGAGGG + Intronic
1167435181 19:49474928-49474950 GCGGGGAGATGGACAGAGGAGGG + Intronic
1167435259 19:49475219-49475241 GGGGGGAGATGGACAGAGGAGGG + Intronic
1167448953 19:49556118-49556140 GCGGGGCCTAGGAGAGCGGAGGG + Intronic
1167476586 19:49704984-49705006 CTGGGGACCAGGAGAGGGGATGG - Intronic
1167569253 19:50276729-50276751 TTGGGGGAAAGGAGAGAGGATGG - Intronic
1167665491 19:50820961-50820983 GTGGGGGCAGGTAGGGAGGAGGG + Intronic
1167689884 19:50978780-50978802 GAGGGGGCAAGGAGAGATGAGGG + Intronic
1167742153 19:51330147-51330169 GTGGAGAAAAGGAGAGGGCAAGG + Exonic
1167913431 19:52721672-52721694 GAGGGGAAAGGGAGAGAGGGAGG + Intronic
1167958857 19:53090136-53090158 CTGGTGACAAGGAGAGCAGAGGG - Intronic
1167971758 19:53192313-53192335 CTGGTGACAAGGAGAGCAGAGGG - Intronic
1168141382 19:54389867-54389889 GGGGGGCCAAGGTGAGAGGATGG - Intergenic
1168148284 19:54431401-54431423 GGGGGGAAAGGGAGGGAGGAGGG - Intronic
1168293486 19:55368441-55368463 CTGGGGACAAGGTGGGAGGCAGG - Intronic
1168323954 19:55528708-55528730 CCGGAGAGAAGGAGAGAGGACGG + Intergenic
1168433796 19:56302283-56302305 GAGGGAAGAAGGAGAGAGGAAGG - Intronic
1168459890 19:56545688-56545710 GTGGGGACCAAGAGAGAGGGAGG + Intronic
1168460042 19:56547209-56547231 GTGAGGACACAGAGAGAAGACGG - Intronic
1168509370 19:56961895-56961917 GAGGAGAGAAGAAGAGAGGAGGG - Intergenic
1168548387 19:57272840-57272862 GAGGGGACAAGCAGAGAGCCTGG - Intergenic
1168658120 19:58146534-58146556 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1168682320 19:58325057-58325079 GAGGGGACAAGGACAGAAAAGGG - Intergenic
925100258 2:1238285-1238307 GTGGAGAGAAAGAGAGAGGAAGG - Intronic
925146813 2:1587704-1587726 GTGGGGACAGAGGGACAGGATGG - Intergenic
925146874 2:1587913-1587935 GTGGGGACAGAGGGACAGGATGG - Intergenic
925174344 2:1771714-1771736 GTAGGGAAAGGGAAAGAGGAAGG + Intergenic
925305963 2:2848653-2848675 GTGGGGAGAGAGAGAGGGGATGG - Intergenic
925306000 2:2848814-2848836 GCAAGGCCAAGGAGAGAGGAGGG + Intergenic
925361031 2:3280472-3280494 GGGGAGACAAGCAGAGAGGCGGG - Intronic
925732142 2:6926903-6926925 GTGAGGACTTGCAGAGAGGAAGG + Intronic
926094991 2:10075399-10075421 CAGGGGACAAGAAGAAAGGATGG - Intronic
926235522 2:11040291-11040313 GTGGGGACAAGCATAGGGCATGG + Intergenic
926337397 2:11875022-11875044 GTGGGGAGGAGGGGAGCGGACGG - Intergenic
926407520 2:12570600-12570622 GTAGAGACAAGGAGAGAAGGGGG - Intergenic
926465472 2:13181356-13181378 GATGGGAGAAGGAGAGACGAGGG + Intergenic
926675234 2:15613019-15613041 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
926706324 2:15840289-15840311 GTGGGGCAAAGTGGAGAGGAAGG + Intergenic
926972035 2:18475907-18475929 GAGGGGACATGGGGAGAGAAGGG + Intergenic
927029706 2:19108019-19108041 GTGGGGAGAAAGAGAGAGAGAGG + Intergenic
927307531 2:21590638-21590660 CTGGGGAGCAGAAGAGAGGAAGG - Intergenic
927438455 2:23090593-23090615 GAGGGGAGGAGGAGAGGGGAGGG + Intergenic
927460309 2:23292966-23292988 GAGGGGACAGGGACAGGGGAAGG + Intergenic
927466138 2:23338101-23338123 GTGTGGAGAGGGAGAGTGGATGG + Intergenic
927513122 2:23656906-23656928 TTGGGGACGAGGGGAGGGGAAGG - Intronic
927929286 2:27033794-27033816 GTAGGAACAAGCAGAGAGGTTGG - Intronic
928323782 2:30303977-30303999 GTGGTGACAAGGGGAGATGGGGG - Intronic
928393480 2:30926847-30926869 TTGGGGGCCAGGAGAAAGGAGGG + Intronic
928426620 2:31183823-31183845 GAGGGAAGAAGGAGAGAGGGAGG - Intronic
929190997 2:39139577-39139599 GGGGGGATAAAGAGAAAGGAAGG - Intergenic
929322309 2:40559014-40559036 GTGGTGACAAGGAGAAAGAAAGG + Intronic
929444564 2:41992108-41992130 GTGGAGGAGAGGAGAGAGGAAGG + Intergenic
929769513 2:44879893-44879915 GTGGGGAGAAGGAGTTAGAAAGG - Intergenic
929918544 2:46155783-46155805 GTGGGGAGAAGGATGGAGAAAGG - Intronic
930137568 2:47917697-47917719 GTGGGGACAGTGAGGGAGGTGGG + Intergenic
930169895 2:48240695-48240717 CTGGGGCCGATGAGAGAGGAAGG + Intergenic
930170200 2:48243961-48243983 GTGAGGCCAAGGACAGTGGAGGG + Intergenic
930336637 2:50057191-50057213 GAGGGGACAGGGAGGTAGGAAGG - Intronic
930338373 2:50080200-50080222 TTTGGGACAAGGAGAGAGAGAGG + Intronic
930347705 2:50205940-50205962 CTTGGGAGAAGGAGAGAGAAGGG + Intronic
930665759 2:54096845-54096867 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
930724604 2:54670497-54670519 GTGGGAAGCAGGGGAGAGGATGG - Intronic
930826167 2:55699109-55699131 GGGGTGACAAGAAGAAAGGATGG + Intergenic
930892031 2:56401210-56401232 GTGAGGGCAAGGATAGAAGAAGG - Intergenic
931103713 2:59031367-59031389 GAGGAGGCAAGGAGAGAGAAAGG - Intergenic
931201150 2:60098335-60098357 GTAGAGAAAAGTAGAGAGGAGGG - Intergenic
931419884 2:62117083-62117105 GTGGGGGCAAAGAGGGAGGCAGG - Intronic
931552523 2:63462349-63462371 ATGGGGTCGAGGAGAGGGGAGGG + Intronic
931576226 2:63721723-63721745 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
931648183 2:64444379-64444401 GTGGGGAGCAGGAGAGAGCATGG + Intergenic
931668364 2:64625890-64625912 TGGGAGACAGGGAGAGAGGAAGG + Intergenic
931777912 2:65555980-65556002 CTTTGGACAAGGAGAGACGAGGG - Intergenic
931881595 2:66575913-66575935 GCGGGGAGAAGGGGAGGGGAAGG + Intergenic
931987178 2:67753524-67753546 GTGGGGACAAGAATAGAAGTAGG + Intergenic
932361810 2:71115149-71115171 GTGGGGCCAAGGTGGGAGGATGG + Intronic
932583569 2:73008355-73008377 GCGGGGAGAAGGAGAGGGGAGGG + Intronic
932626771 2:73302717-73302739 TTGGGGCAAAAGAGAGAGGAAGG + Intergenic
932702425 2:74000998-74001020 TTGGGGACCAGGATAAAGGAGGG + Intronic
932761229 2:74440370-74440392 GGGAGGAGAGGGAGAGAGGAAGG + Intronic
933789647 2:85873463-85873485 GTGGGGACAAGGGAGGAGGGAGG + Intronic
933846889 2:86334022-86334044 CTGGGGACAAGCAGAGTGGCTGG - Intronic
933997007 2:87677418-87677440 GAGAAGACAAGGAGAAAGGAGGG + Intergenic
934501763 2:94866854-94866876 GTGGGGAGAGGGAGAGAGGGAGG - Intergenic
935267338 2:101406276-101406298 GTGGAGAGAAGGAGGGAGGTAGG + Intronic
935745652 2:106188307-106188329 ATGGGGACATGGAGAGGGCACGG + Intronic
935949541 2:108316332-108316354 GTGGGAAGAAGGAGAGGGAAAGG - Intergenic
936012806 2:108936020-108936042 GTGGTGACCAGTAGGGAGGACGG - Intronic
936126084 2:109789992-109790014 GTGGGGACAAAGTGACAAGATGG + Intergenic
936153710 2:110035315-110035337 GTGTGCCCAAGGAGAGAGGGTGG - Intergenic
936153750 2:110035501-110035523 GTGGGGAGGAGGAGGGAGGGGGG - Intergenic
936190935 2:110335914-110335936 GTGGGGAGGAGGAGGGAGGGGGG + Intergenic
936190975 2:110336100-110336122 GTGTGCCCAAGGAGAGAGGGTGG + Intergenic
936218609 2:110581476-110581498 GTGGGGACAAAGTGACAAGATGG - Intergenic
936296844 2:111273492-111273514 GAGAAGACAAGGAGAAAGGAGGG - Intergenic
936603535 2:113924314-113924336 GGGAGGCCAAGGTGAGAGGATGG - Intronic
936971044 2:118176585-118176607 GTGGGGAGAAGGAGCAAGGAGGG - Intergenic
937108150 2:119338524-119338546 GTGAGGAGAATGAGAGAGAAAGG + Intronic
937168934 2:119845229-119845251 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
937341025 2:121090615-121090637 GTGGGGAGAGGCAGAGAGAAGGG + Intergenic
937905324 2:127050189-127050211 ATGGGGACAGGGAGAGAGAGAGG + Intronic
937922350 2:127139623-127139645 GTGGGGAAAAGTAGAAAGCATGG - Intergenic
938203956 2:129401431-129401453 GTGCAGGCAAGGAGAGAGAAGGG - Intergenic
938419813 2:131136176-131136198 GCGGGGGAAAGGAGAGAGGGAGG - Intronic
938611142 2:132948775-132948797 GTGGGGAAAAGGCAAGAGAAGGG - Intronic
939044980 2:137239424-137239446 TTGGGGACAGGGAAGGAGGACGG - Intronic
939223858 2:139339874-139339896 GAGGGGACAGAGAGAGAGGAGGG + Intergenic
939223862 2:139339892-139339914 GAGGGGAGAGAGAGAGAGGAGGG + Intergenic
939546973 2:143566569-143566591 GTGAGGTCAGAGAGAGAGGAGGG - Intronic
939566502 2:143791799-143791821 GGGAGGCCAAGGTGAGAGGATGG - Intergenic
939812520 2:146852107-146852129 ATGAGGACAAGGAGAGACAATGG - Intergenic
939980649 2:148776775-148776797 GTGAGGACAAAGTGGGAGGATGG + Intronic
940104302 2:150080781-150080803 GTGTGGGCAAGGGCAGAGGAAGG + Intergenic
940523765 2:154785348-154785370 GTGAGGACAAGGCAAGAAGATGG - Intronic
941228914 2:162884415-162884437 GTGGGGATGAGAAGAAAGGATGG + Intergenic
941901845 2:170686358-170686380 GGGGAGGGAAGGAGAGAGGAGGG + Intergenic
941965566 2:171297090-171297112 GGGAGGACAAGGTGGGAGGATGG + Intergenic
941973205 2:171374647-171374669 GTGGGGAGAAGGGGAGGGGTGGG - Intronic
942069024 2:172298652-172298674 GTGGAGAATGGGAGAGAGGAAGG + Intergenic
942313355 2:174676543-174676565 GGGAGGCCAAGGTGAGAGGATGG - Intronic
942946591 2:181680655-181680677 GTGGGGAGAAGTGGGGAGGAGGG - Exonic
942965853 2:181891901-181891923 GAGGGGACAGGGAGGGAGGGAGG - Exonic
943381600 2:187156656-187156678 GTGAGGACACAGAGAGAGGATGG - Intergenic
943701906 2:190996075-190996097 CCGGGGACAGGAAGAGAGGAAGG + Intronic
944604376 2:201337760-201337782 GGGAGGCCAAGGCGAGAGGATGG - Intronic
945170427 2:206989493-206989515 ATGGGGACAGGGAGGGAGGTGGG + Intergenic
945256081 2:207804373-207804395 GTGTGCAGAAGGAGACAGGAAGG + Intergenic
945396560 2:209325337-209325359 GTGTGGAAATGGGGAGAGGAGGG - Intergenic
945918118 2:215726144-215726166 GTGGGGACAGGGAGAGGGGAGGG + Intergenic
946029542 2:216693661-216693683 GTGGGGAAGAGTAGAAAGGAAGG - Intronic
946163024 2:217847614-217847636 GTGAGGCCAGGGAGAGAGGCTGG + Exonic
946190209 2:218003874-218003896 GTGGGGGCGAGGGGAGGGGAGGG - Intergenic
946291512 2:218748978-218749000 GTGAGGCCCAGGAGAAAGGAGGG - Intronic
946426646 2:219601966-219601988 GCTGGGACAAGGAAAGAGGAGGG - Exonic
946430587 2:219625197-219625219 GAGGGGTGGAGGAGAGAGGAAGG + Intergenic
946519116 2:220446683-220446705 GAGGGGAGAAGGGGGGAGGAAGG - Intergenic
946639885 2:221772961-221772983 GTGGGGACAAGGGTAGAGTTGGG + Intergenic
946705256 2:222452327-222452349 GAGGGGAGGAGGGGAGAGGAAGG + Intronic
947026225 2:225741012-225741034 GTGGGGCCATGGAGGGAGGCTGG - Intergenic
947421014 2:229941633-229941655 GTGGGGAAGGGGAGATAGGAGGG + Intronic
947942414 2:234069743-234069765 CGGGGGAGAAGGAGAGAGAATGG + Intronic
947947898 2:234122111-234122133 GGGAGGACAAGGAGAGAGAGAGG - Intergenic
948091837 2:235301905-235301927 GAGAGGAGGAGGAGAGAGGAGGG - Intergenic
948231817 2:236354672-236354694 GTGGGGACAAGGCGGGACCAGGG - Intronic
948319825 2:237060458-237060480 GTGGGGAAAGTGAGAGACGATGG + Intergenic
948539630 2:238680322-238680344 GAGGGGACAGGGAGAGAAGCTGG - Intergenic
948660078 2:239501640-239501662 CTAAGGACAAGGAGACAGGATGG + Intergenic
948695754 2:239732309-239732331 GTGGGTCCAAGGAGGCAGGATGG - Intergenic
948875533 2:240825337-240825359 GGGGGGAGAGAGAGAGAGGAGGG - Intergenic
948915933 2:241035114-241035136 GTGGGAATAAGGGGAGAGTAGGG - Intronic
1169206826 20:3745322-3745344 GTGGGGCTAAGGAGAGGGGTCGG + Intronic
1169428479 20:5514268-5514290 GTGGGGATAAGGAAAGTGGAAGG + Intergenic
1169673734 20:8132208-8132230 GGGGGGAGGAGGAGGGAGGAGGG + Intronic
1169801285 20:9514929-9514951 TTGGCGACTGGGAGAGAGGACGG + Intronic
1169902713 20:10569773-10569795 GTGAAGACAAAGGGAGAGGACGG - Intronic
1170121117 20:12913364-12913386 GTTGGGACAAGGAGACAAGGAGG - Intergenic
1170341137 20:15328284-15328306 GTGGCCAGAGGGAGAGAGGAGGG + Intronic
1170459620 20:16564970-16564992 GAAGGGGCATGGAGAGAGGAAGG - Intronic
1170571403 20:17634793-17634815 GAGGGGACAGGCAGAGGGGAAGG + Intronic
1171190275 20:23154036-23154058 GTGAGGACACAGAGAGAAGATGG - Intergenic
1171338278 20:24407743-24407765 GAGGGGAAAAGGAGGGAGCATGG + Intergenic
1171433855 20:25104302-25104324 GTGGTGGAAAGGACAGAGGAGGG - Intergenic
1171907198 20:30908814-30908836 TAGGGGAGAAGGAGAGAGAAAGG + Intergenic
1171941145 20:31331014-31331036 AGGGGGAGAAGGAGAGAAGAAGG + Intergenic
1172114001 20:32563103-32563125 GTGGAGGCAGGGAGAGTGGAGGG + Intronic
1172136360 20:32689414-32689436 GTGTCTATAAGGAGAGAGGAAGG + Intergenic
1172209395 20:33186207-33186229 GTGGGGAGAGGGAGAGGGGGAGG + Intergenic
1172883014 20:38213745-38213767 TGGGGGACAAGAAGAGAGGGAGG + Intronic
1172970750 20:38871499-38871521 GTGGGAAGAAGGAGAGAGAAGGG + Intronic
1173183027 20:40818923-40818945 GGGTGGAAGAGGAGAGAGGATGG - Intergenic
1173214524 20:41068186-41068208 TTGGGGACAAAGAGAGATAAAGG - Intronic
1173225564 20:41160497-41160519 GAGGGGCCAAGGAGAGAAGGGGG + Intronic
1173285683 20:41669878-41669900 GAAGGGACAAGGAGGGAGGCAGG + Intergenic
1173471187 20:43324833-43324855 GAGGGTGCATGGAGAGAGGAGGG - Intergenic
1173502976 20:43566889-43566911 GTGGGTAGAAGGAGGGAGGGAGG + Intronic
1173661364 20:44736325-44736347 ATTGGGAGAAGGAGAGAGGAAGG - Intergenic
1173915884 20:46708782-46708804 GAGAAGACAGGGAGAGAGGAGGG - Intergenic
1173955385 20:47028415-47028437 GTGGGGGCAAGAAGAGAAGAAGG - Intronic
1174079879 20:47963056-47963078 GTGGGGAAAAGAAGGGAGGGAGG - Intergenic
1174344683 20:49921433-49921455 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
1174403116 20:50286663-50286685 GTGGGGCCAAGGAGTGGGGGCGG + Intergenic
1174607450 20:51771181-51771203 CTGGGGACATGGATATAGGATGG - Intergenic
1174640056 20:52036085-52036107 GAGGGGCCAAGGCGAGAGAATGG - Intergenic
1175162988 20:57022510-57022532 GAGGGGACCAGGAGAGAGAGAGG - Intergenic
1175391660 20:58631453-58631475 CTGGGGACAAGGGGAGTGGAGGG - Intergenic
1175415745 20:58799764-58799786 GGGAGGCCAAGGAGGGAGGATGG + Intergenic
1175487384 20:59355720-59355742 GGGGGGAGAGGGACAGAGGAGGG - Intergenic
1175487392 20:59355740-59355762 GGGGGGAGAGGGAGAGAGGAGGG - Intergenic
1175487401 20:59355761-59355783 GGGGGGAGAGGGAGAGAGGAGGG - Intergenic
1175487409 20:59355781-59355803 GGGGGGAGAGGGAGAGAGGAGGG - Intergenic
1175487417 20:59355801-59355823 GGGGGGAGAGGGAGAGAAGAGGG - Intergenic
1175515874 20:59569436-59569458 GTGGGGAGAGAGAGAGAGAATGG + Intergenic
1175748085 20:61475535-61475557 GGGGGGGCAGGGAGAGAGGGAGG - Intronic
1175891491 20:62317969-62317991 GTGGGGAAGAAGAGAAAGGAAGG + Intronic
1175903045 20:62367424-62367446 GGGGGGGGAAGGAGAGAGGAGGG + Intergenic
1176123876 20:63466489-63466511 GTGGAGGCCAGGAGGGAGGATGG - Intronic
1176204971 20:63883337-63883359 CTGGGGCCAAGGAGTGAGCAGGG + Intronic
1176251300 20:64121657-64121679 GTGAGGAGAAGGATAGAGGCTGG + Intergenic
1176411816 21:6453326-6453348 GTGGTGACAGGGAAAGTGGAAGG - Intergenic
1176920554 21:14683196-14683218 GAGGGAACAGGGAGAGAGGAAGG + Intergenic
1177208050 21:18033293-18033315 GTAGGGATAAGGACAGAGGCAGG + Intronic
1177629986 21:23714432-23714454 GTGGGGACATGCAGACAGGCAGG + Intergenic
1178348283 21:31850969-31850991 TAGGGGGCAAGGAGAGAGGTGGG - Intergenic
1178361029 21:31948616-31948638 GTGGGAAGGAGGAGAGAGGAAGG + Intronic
1178460268 21:32796261-32796283 GTGGGGAGGAGGCGAGAGGAGGG + Intronic
1178640023 21:34338054-34338076 GTGGGCACACGGAGAGGGGAAGG + Intergenic
1178724860 21:35042457-35042479 GTGGAGGGAAGCAGAGAGGAAGG - Intronic
1178858784 21:36272246-36272268 GGGAGGCCAAGGTGAGAGGATGG + Intronic
1179033049 21:37736661-37736683 ATGGGGAGATGGAGAGAGGGAGG + Intronic
1179084938 21:38207840-38207862 GAGGGGAGGAGGGGAGAGGAGGG - Intronic
1179084983 21:38207958-38207980 GAGTGGAGGAGGAGAGAGGAGGG - Intronic
1179086221 21:38220196-38220218 GAGGGCACAGGGAGGGAGGAGGG + Intronic
1179164778 21:38926802-38926824 GTGAGGACACAGGGAGAGGACGG + Intergenic
1179236735 21:39554141-39554163 AGGAGGACATGGAGAGAGGAAGG - Intergenic
1179687310 21:43061648-43061670 GTGGTGACAGGGAAAGTGGAAGG - Intronic
1179711150 21:43263956-43263978 CAGGGTACAATGAGAGAGGAAGG + Intergenic
1180626870 22:17199425-17199447 GAGGGGAAGAGGATAGAGGAGGG - Intronic
1180627773 22:17205737-17205759 GGGAGGCCAAGGTGAGAGGACGG + Intronic
1180818224 22:18806482-18806504 GTGGGGAGAAGTGGGGAGGATGG + Intergenic
1180861112 22:19083702-19083724 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1181046664 22:20217862-20217884 GGGGGGACAAGCAGAGAGGTCGG - Intergenic
1181204447 22:21240937-21240959 GTGGGGAGAAGTGGGGAGGATGG + Intergenic
1181471671 22:23144309-23144331 GGGGAGACAAGGAAAGAGAACGG - Intronic
1181728411 22:24827383-24827405 GTGGGGAGAGGGAGGGAGGGCGG + Intronic
1181744389 22:24945717-24945739 CTGGGGACAAGCACAGAGGAAGG + Intronic
1181792491 22:25278634-25278656 GTGGGGAGAGGGAGAGGGGGAGG + Intergenic
1181998611 22:26902773-26902795 GGGGGGAAAGAGAGAGAGGAAGG - Intergenic
1182029744 22:27148634-27148656 GTGAGGACACGGCGAGAAGACGG + Intergenic
1182064849 22:27423388-27423410 GTGGGGGCAGGGAGTGAGTAGGG + Intergenic
1182116788 22:27761337-27761359 AGGGGGAGAAGGAGAGAGGGAGG - Intronic
1182286647 22:29252531-29252553 GTCTGGACTAGGAAAGAGGAAGG + Intronic
1182459308 22:30472677-30472699 GGGGGGACCAGGAGAGCTGAAGG - Intergenic
1182471233 22:30549611-30549633 GAAGGGAGAAGGAGAGAGGGCGG - Intergenic
1182526418 22:30923149-30923171 GAGGGGACAAGAAAAGAGGAGGG + Intergenic
1182889494 22:33805311-33805333 TTGCAGACAAGGATAGAGGAAGG - Intronic
1183094133 22:35542086-35542108 CTGGGGACAAGGGGAGGGGAGGG - Intronic
1183124126 22:35759141-35759163 ATGGGGAAAAGGAGTGAAGATGG - Intronic
1183172372 22:36197797-36197819 GTAGGGACAGGGGGAGGGGATGG + Intronic
1183180891 22:36258964-36258986 GTAGGGACAGGGGGAGGGGATGG - Intronic
1183266618 22:36830487-36830509 GTGTAGGCAGGGAGAGAGGAGGG - Intergenic
1183338287 22:37263612-37263634 GTGGGGACACAGGGAGAAGACGG + Intergenic
1183358236 22:37370611-37370633 GTGGAGAGAGGGAGGGAGGAAGG + Exonic
1183543844 22:38445131-38445153 GAGGGCACAAGGACAGAGCAGGG + Intronic
1183720673 22:39559839-39559861 ATGGGGGCAAGGGGAGGGGAGGG - Intergenic
1183983534 22:41556589-41556611 TGGGAGACAAGGAGAGAGGAAGG + Intergenic
1184036342 22:41920035-41920057 GCGGGGTCAAGAAGAGAGGCGGG - Intergenic
1184075214 22:42172697-42172719 GTGGGCTCAAGGAGGGAGGTAGG + Intronic
1184084949 22:42255749-42255771 GTGGTGGGAAGGAGAGGGGAGGG - Intronic
1184208851 22:43023493-43023515 GGGGGGACAGGGAGACAGGTGGG - Intergenic
1184403588 22:44287531-44287553 GTGGGGGCAAGGAGGCAGCAAGG - Intronic
1184485842 22:44778846-44778868 GTGGGGTTAGAGAGAGAGGAGGG - Intronic
1184561637 22:45267254-45267276 GTGGGGTGGAGGAGAGGGGAGGG + Intergenic
1184736155 22:46398828-46398850 GAGGGGACCAGGCCAGAGGATGG + Intronic
1184866583 22:47204975-47204997 GTGGGGTGACGGAGAGAGCAGGG + Intergenic
1184933695 22:47702180-47702202 TGGGAGTCAAGGAGAGAGGAGGG - Intergenic
1185051669 22:48557325-48557347 GTGAGGACACAGAGAGAAGACGG + Intronic
1185161342 22:49231757-49231779 TTGGGTTCTAGGAGAGAGGAAGG - Intergenic
1203222478 22_KI270731v1_random:54478-54500 GTGGGGAGAAGTGGGGAGGATGG - Intergenic
1203268354 22_KI270734v1_random:32336-32358 GTGGGGAGAAGTGGGGAGGATGG + Intergenic
949774042 3:7611445-7611467 GTGGAGACAGGGAGAACGGAGGG - Intronic
949853154 3:8439035-8439057 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
950018889 3:9772477-9772499 ATCAAGACAAGGAGAGAGGAGGG - Intronic
950195506 3:11006537-11006559 GTGGGGAGGAGGAGAGGAGAGGG - Intronic
950311332 3:11960959-11960981 GTGGGGGGAAGGACAGAGAACGG + Intergenic
950645581 3:14374673-14374695 GGAGGGAGGAGGAGAGAGGAGGG + Intergenic
950667216 3:14504976-14504998 GTGGGTACCAGGAGGGAGGGAGG + Intronic
950678711 3:14570103-14570125 ATGGGGTGAAGGTGAGAGGAAGG + Intergenic
951046182 3:18041069-18041091 GAGAGGACAAGGAGGGAAGAGGG - Intronic
951170749 3:19539167-19539189 GAAGGGCCAAGGGGAGAGGAGGG - Intergenic
951537209 3:23751025-23751047 GTGTGGGTAGGGAGAGAGGAAGG - Intergenic
951670891 3:25180754-25180776 TAGGGGAGAAGGAAAGAGGAAGG + Intronic
951849921 3:27127885-27127907 GAGGGGAGGAGGAGAGAAGAAGG - Intronic
951909064 3:27730462-27730484 GTGGGGAGGAGGACAAAGGAGGG - Intergenic
952603226 3:35109772-35109794 GTGGGGAAGAGGAGGGGGGAGGG + Intergenic
952759516 3:36901714-36901736 GTGGGGAAGGGGAGAGAGGATGG + Intronic
952767284 3:36965260-36965282 GGGAGGACAAGGAGGGAGGATGG + Intergenic
953182401 3:40608235-40608257 GTGGGGGCATGGAGAGGGCAGGG + Intergenic
953430496 3:42835878-42835900 GTGGGCAGAAGGAGGAAGGAGGG - Intronic
953763885 3:45717809-45717831 GGGAGGCCAAGGTGAGAGGATGG + Intronic
953864838 3:46575389-46575411 GTGGGGAGAAGGGGAAGGGAAGG - Intronic
953877293 3:46673608-46673630 GTGGTGACCAGTAGAGAGGGAGG + Intronic
954425068 3:50438848-50438870 GTGGGGAAAAGCAAGGAGGAAGG + Intronic
954444479 3:50539491-50539513 GTGGGGAGGAGGAGAGGGAAAGG + Intergenic
954481522 3:50804751-50804773 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
954656816 3:52198771-52198793 GTGGGGACCAGGAGAAAGTCAGG + Exonic
954853919 3:53626474-53626496 GAGGGGAAATGGAGAGAGAAAGG + Intronic
955115127 3:55990653-55990675 GGGAGGCCAAGGTGAGAGGATGG - Intronic
955625739 3:60917360-60917382 AAGGGGACAAGAAGAGAGGCAGG - Intronic
955850069 3:63210825-63210847 GTGAGGAGAACAAGAGAGGAAGG - Intergenic
956263659 3:67373698-67373720 GAGGGAGGAAGGAGAGAGGAAGG - Intronic
956264434 3:67380999-67381021 GTGGGGACACGCAGAGAAGAGGG + Intronic
956560731 3:70571370-70571392 TTGGGGGCATGGAGAGAGGAGGG - Intergenic
956725694 3:72154905-72154927 GTGGGGGCATGGAGAGAAGCAGG - Intergenic
957040412 3:75331768-75331790 CTGGGGAGAAGGACAAAGGAGGG - Intergenic
957128029 3:76187511-76187533 GTGAGGCCAAGGCAAGAGGATGG - Intronic
957387236 3:79511920-79511942 GAGGGTAAAAGGTGAGAGGAGGG + Intronic
957769036 3:84663935-84663957 CAGGGGAGAAGGAGAGAGGAAGG + Intergenic
957833613 3:85554953-85554975 GTGAGGCCAAGGTGAGAGGATGG - Intronic
958027201 3:88061986-88062008 GTGGGCAAAGGGAGAGAGGAAGG + Intronic
958112150 3:89162524-89162546 TTGAGGAGAAGGAGAGAGGTTGG - Intronic
959260859 3:104077722-104077744 GTGGGGAGGAGGGGAGGGGAGGG + Intergenic
959408053 3:105985872-105985894 GTGGCTACAAGAAGAGATGATGG - Intergenic
959518048 3:107291590-107291612 GTAGGGAAAAGGAGAAAGAAAGG - Intergenic
959533624 3:107461448-107461470 GTAGAGACAAGTAGAGATGAAGG - Intergenic
959681813 3:109105141-109105163 GGGAGGCCAAGGAGGGAGGATGG + Intronic
959759863 3:109947991-109948013 GTGAGGACAGGGAGAGAAGGTGG + Intergenic
960180479 3:114569862-114569884 GTGGGGAGAGAGAGAGAGAATGG - Intronic
960333222 3:116388090-116388112 GTGGGGGCAAGTAGAGAGAGAGG + Intronic
960702214 3:120450422-120450444 GCGGGGAGGAGGAGAGGGGACGG - Intronic
960717344 3:120589804-120589826 TTGGTGAGAAGGTGAGAGGAAGG + Intergenic
960883238 3:122367161-122367183 GTGAAGAGAAGGAGAGAGGGAGG + Intronic
960924596 3:122781558-122781580 GTGGGGAGACGGAGAGAGAGAGG + Intronic
960963113 3:123085689-123085711 CTGGGGAGAAGGAAAGGGGAAGG - Intronic
960983489 3:123254469-123254491 GTGGGGAAACAGAGACAGGAAGG - Intronic
961345435 3:126260616-126260638 GGGAGGAAGAGGAGAGAGGAAGG - Intergenic
961587994 3:127950283-127950305 GTGGGAAGAAGGAGATAGAAGGG + Intronic
962033204 3:131623049-131623071 GTAAGTACAAGGACAGAGGAGGG + Intronic
962573677 3:136736277-136736299 CTAGGGGCAAGGAGAGGGGAAGG + Intronic
962850595 3:139305903-139305925 GTGGGGAGAAAGAGAGAGAGAGG - Intronic
962988245 3:140555778-140555800 GTGGGGACATGGAGAGGGCAAGG + Intronic
963068446 3:141282161-141282183 GTGAGCACGAGGAGAGTGGAGGG - Intronic
963284223 3:143417486-143417508 GGGGGGAGAGGGAGGGAGGAGGG + Intronic
963804180 3:149706691-149706713 GAGGGAACAAGGAGAAAGAAGGG + Intronic
963851648 3:150215974-150215996 GAGGGGGAAAGGAGGGAGGATGG + Intergenic
963989834 3:151640307-151640329 GTGGGAAAAAGGGGAGAGAATGG - Intergenic
965046920 3:163590136-163590158 GAGTGGACATGGAGAGAGAATGG + Intergenic
965338307 3:167455425-167455447 CTGGGGATAAGGGGAAAGGAAGG - Intronic
966444569 3:179987309-179987331 ATGGGGAGAGGGAGAGAGGGAGG - Intronic
966770600 3:183500350-183500372 GTGTGGCCAGGGAGGGAGGAAGG + Intronic
967536165 3:190605695-190605717 GTAAAGACAAGGAGAGAAGATGG - Intronic
967577330 3:191108817-191108839 ATGGGGAGAAAGAGAGAGAAGGG - Intergenic
967672425 3:192253407-192253429 ATGGCAACAAGGAGAGAGGGAGG + Intronic
967863864 3:194174452-194174474 GGGAGGCCAAGGAGGGAGGATGG + Intergenic
967991811 3:195137128-195137150 GTGGGGGCCAGGACAGAGAAGGG + Intronic
968267659 3:197375209-197375231 GTGGGGATGGGGAGAGAGGATGG - Intergenic
968310675 3:197681021-197681043 GAGGGGACAAGAGGAGGGGATGG + Intronic
968530109 4:1086946-1086968 ATGGGGTCGGGGAGAGAGGATGG + Intronic
968676381 4:1883080-1883102 TTTGGGATAAGGAGAGATGAGGG + Intronic
968690544 4:1987701-1987723 GTGTGGGCACGGAGACAGGAGGG - Intronic
968913417 4:3486892-3486914 GAGGGGAGCAGGAGAGAGCAGGG - Intronic
968962240 4:3751537-3751559 GTGAGGAAGAGGAGCGAGGATGG - Intergenic
969032133 4:4223977-4223999 GTGGAGAGAAGGATGGAGGAAGG + Intronic
969063407 4:4457898-4457920 GAGTGGCCAAGGGGAGAGGATGG - Intronic
969150817 4:5167180-5167202 TTGGGGGCAAGGTGGGAGGATGG - Intronic
969275854 4:6135335-6135357 GTGAGGACATGGGGAGAAGACGG + Intronic
969285981 4:6202033-6202055 GTGGGGACAAGGAGGCAGTGTGG + Intergenic
969371906 4:6736983-6737005 GGGAGGCCAAGGAGGGAGGATGG - Intergenic
969607837 4:8211302-8211324 AGGGGGAGAAGGAGGGAGGAGGG - Intronic
969630169 4:8331250-8331272 GTGGGCAGAAGGCCAGAGGAAGG + Intergenic
971358178 4:25913526-25913548 CAGGGAACAGGGAGAGAGGATGG + Intronic
971530828 4:27686678-27686700 TTGGGAGCAAGGAGAGAGGGAGG + Intergenic
972201331 4:36717378-36717400 GTGGGGTCCAGAAGAGAAGAAGG - Intergenic
972321505 4:37977235-37977257 GGGGGGAGGAGGGGAGAGGAGGG - Intronic
972552811 4:40148463-40148485 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
972894077 4:43597504-43597526 GAGGGTAGAAGGAGAGAGGGAGG - Intergenic
972944491 4:44237323-44237345 ATGGGAAGAAAGAGAGAGGAAGG - Intronic
973031170 4:45342169-45342191 GGGGGGCCAAGGTGGGAGGAGGG - Intergenic
973096870 4:46213263-46213285 GTGAGGACATGGTGAGAAGATGG + Intergenic
973701347 4:53540276-53540298 GGGGGGCTTAGGAGAGAGGATGG + Intronic
973766543 4:54168266-54168288 GGGGGGACAGGGAGAGAGGAGGG + Intronic
973829360 4:54742865-54742887 GTGGGAACAAGGAGAAGAGAAGG + Intergenic
973835621 4:54806439-54806461 GAAGGGAGAAGGAGAGAGGGAGG + Intergenic
973919186 4:55667354-55667376 GAGGAGACAAGGAAAGAGGAAGG + Intergenic
973976324 4:56266437-56266459 GTGGGAAGAAGGGGACAGGAGGG - Intronic
974652772 4:64776720-64776742 GTGTGCACAGGGAGAGAGAAAGG - Intergenic
974933878 4:68390582-68390604 GAGGGGAAAAGGGGAGAGTATGG - Intergenic
975115176 4:70672134-70672156 GTGGGGACAGAGAGAAGGGAAGG + Intronic
975122757 4:70746897-70746919 GTAGGGGCAAGGAGAGATGTGGG + Intronic
975832119 4:78380342-78380364 CTGGCGACAGAGAGAGAGGATGG + Intronic
975874430 4:78819238-78819260 GGGAGGCCAAGGAGAGTGGATGG - Intronic
976047526 4:80968855-80968877 GTGGGGGGAAGGAGAGAAGAGGG - Intergenic
976367607 4:84247441-84247463 GAGGGGAGGTGGAGAGAGGACGG - Intergenic
976787936 4:88843862-88843884 GTGGGGACAATGAGAGCGCACGG + Intronic
976853413 4:89575710-89575732 GTGTGAACAAAGAGATAGGATGG + Intergenic
976884734 4:89969303-89969325 GTAGAGACACGGAGAGGGGATGG + Intergenic
977066606 4:92324309-92324331 CTGGGGACAGAGAGAAAGGATGG - Intronic
977113826 4:92995330-92995352 GTGGGAAGATGGAGTGAGGAGGG + Intronic
977265609 4:94849832-94849854 GTGGGAACAAGAAGTAAGGAAGG + Intronic
977285730 4:95104455-95104477 GTGGGCACCAAGAAAGAGGATGG + Exonic
977669783 4:99682769-99682791 ATGGGGACAAGGAGAGATTGAGG - Intergenic
977797115 4:101179545-101179567 CTGGGGACAAAGAGACAGCATGG - Intronic
977957874 4:103051334-103051356 ATAGGGACAAGGTGAGAAGAGGG - Intronic
978527551 4:109680831-109680853 GGGAGGACAAGGTGAGAGGAAGG - Intronic
978592471 4:110340421-110340443 GTGGGGAGAAGGAGGGACCAGGG - Intergenic
978630875 4:110742790-110742812 GTGAGGACATAGTGAGAGGATGG - Intergenic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
980145133 4:128973423-128973445 GTGGGGGGAGGGAGAGGGGAGGG + Intronic
980545281 4:134253676-134253698 GATGGGGGAAGGAGAGAGGAAGG - Intergenic
980577854 4:134708499-134708521 GTGGGGAGCAAGAGAGAGCAAGG - Intergenic
980991267 4:139740577-139740599 GTGGGTACAATAAGAGAGAAAGG - Exonic
981026990 4:140086701-140086723 GTGGGGTGAACGAGAGAAGAGGG + Intronic
981044637 4:140253466-140253488 GTGGGGATAAGGAGGAAGGAGGG + Intergenic
981126852 4:141116997-141117019 GGGGGGACTAGGGGAGGGGAGGG + Intronic
981626683 4:146764390-146764412 GTGGGGAGGAGGAGAGAGGAGGG + Intronic
981829083 4:148979610-148979632 TTGGGGAGGAGGAGAAAGGAAGG - Intergenic
981950482 4:150400612-150400634 GGGAGGACAAGGAGGGAGGATGG + Intronic
982065238 4:151649398-151649420 GTGGGGACAAAGGTAGTGGATGG - Intronic
982235633 4:153249089-153249111 GTGGGGAAGAGGAGGGAGTAAGG - Intronic
982271342 4:153592528-153592550 TAGGGTACAAGGAGAGAGGCAGG - Exonic
982629063 4:157808596-157808618 TTGGGGAGAAAGACAGAGGAGGG + Intergenic
982909678 4:161124020-161124042 GTGGGGACATGGGGGTAGGAAGG + Intergenic
983324386 4:166234637-166234659 ATGAGGACACGGAGAGGGGATGG + Intergenic
983472801 4:168177129-168177151 GTGGGGAGAAGGAGGTAGGGAGG - Intronic
983713508 4:170749257-170749279 GAGGAGACGAGGGGAGAGGAGGG - Intergenic
983925674 4:173399246-173399268 GTGGGGAGGAGGGGAGTGGAAGG + Exonic
984214821 4:176897609-176897631 GAGAAGACAAGGAGAGATGAAGG + Intergenic
984466508 4:180106458-180106480 GGGAGGCCAAGGAGGGAGGATGG - Intergenic
984656305 4:182322366-182322388 TTGGCAACATGGAGAGAGGAGGG + Intronic
984813889 4:183819557-183819579 GTGGGGAGAGGGAGAGGGGGAGG + Intergenic
985175113 4:187192395-187192417 GTGAGGACACGGCGAGAGGGTGG + Intergenic
985211864 4:187604074-187604096 GAGGGGAGGAGGAGAGGGGAGGG - Intergenic
985477886 5:90152-90174 GTGGGGACACTCAGAGGGGATGG - Intergenic
985543744 5:499031-499053 CTGGGGACCAAGAGAGGGGAAGG + Intronic
985696019 5:1340607-1340629 GAGGGGACACGGAGAGGGGCAGG + Intronic
985756652 5:1723479-1723501 GAGGGGAAAGGGAGAGAGGAAGG - Intergenic
986004029 5:3652607-3652629 GGGGTGACAAGGAGGGTGGAGGG + Intergenic
986517940 5:8582777-8582799 GGAGGGAGAAGGAGAGAGGGAGG + Intergenic
986556414 5:9014560-9014582 GGGAGGACACGGTGAGAGGATGG - Intergenic
986677139 5:10195998-10196020 GTGAGGACATGGTGAGAAGACGG - Intergenic
986691514 5:10317406-10317428 GGGGGGAGAGGGAGAGAGGGGGG - Intergenic
986691521 5:10317423-10317445 GGGGGGAGAGGGAGAGAGGGGGG - Intergenic
986808305 5:11329669-11329691 TTGGAGACCAGGAGAGAAGAAGG + Intronic
987210896 5:15682111-15682133 GTGGGGGACAGAAGAGAGGAGGG + Intronic
988251931 5:28770510-28770532 GAGGGGAGAAGAGGAGAGGAAGG - Intergenic
988346416 5:30042655-30042677 GTGAAGAGAAGGAGAGAAGAGGG + Intergenic
988355324 5:30166408-30166430 TTGGGGACCAGGAGAAAGGGTGG - Intergenic
988603641 5:32662059-32662081 GAGGGGGCAATGATAGAGGAAGG - Intergenic
988615108 5:32767954-32767976 GTGGAGGCAGGGAAAGAGGAGGG - Intronic
988982326 5:36584128-36584150 GTGGGCACCAGGAGAGAAGAGGG - Intergenic
989200763 5:38760594-38760616 GAGCGGAGAGGGAGAGAGGAAGG + Intergenic
989466889 5:41767539-41767561 GAGGAGCCATGGAGAGAGGATGG - Intronic
989542336 5:42632003-42632025 GGGGGTGGAAGGAGAGAGGAGGG - Intronic
989622804 5:43401323-43401345 TTGGGGGCATGGAGAGTGGATGG + Intronic
990589635 5:57249723-57249745 GGCGAGAAAAGGAGAGAGGAGGG - Intronic
990871197 5:60432084-60432106 GTGGGGAGAAGGAGAGGGAGAGG + Intronic
990925669 5:61019380-61019402 ATAGGGAAAAGGAGAGAAGAGGG - Intronic
990948104 5:61270663-61270685 GTGCGGACCAGGAGAGTGGCTGG + Intergenic
991144398 5:63283832-63283854 GTGGGGACGGGGAGGGTGGAGGG + Intergenic
991229378 5:64313299-64313321 ATGGGTAAAGGGAGAGAGGAAGG - Intronic
991297869 5:65100965-65100987 GGAAGGGCAAGGAGAGAGGATGG - Intergenic
991483001 5:67103509-67103531 GAGGGGAGGAGGAGGGAGGAAGG + Intronic
991693157 5:69245270-69245292 GAGGGGAAAAGGAGGGAGGACGG - Intronic
992249755 5:74865805-74865827 GTGGGGAGAGGGCGAGGGGAGGG + Intronic
992442800 5:76811588-76811610 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
992574292 5:78096019-78096041 GTGGGGAGAGGGAGAGGGAAAGG - Intronic
992675579 5:79102537-79102559 CTGGGGACATAGTGAGAGGAGGG + Intronic
992738426 5:79747067-79747089 TTAGGGAGAAAGAGAGAGGAAGG - Intronic
993140820 5:84031027-84031049 GTGAAGACATGGAGAGAAGATGG - Intronic
993234686 5:85289304-85289326 GTGGGGAAGAGGAGGAAGGAAGG + Intergenic
993876095 5:93308765-93308787 GGGTGGACTTGGAGAGAGGAAGG + Intergenic
994044271 5:95290633-95290655 GTGGCCAGAAGGAGAGAGGGAGG + Intergenic
994088771 5:95789681-95789703 GTGAGGAGAAGGAGAGAGAGAGG + Intronic
994240592 5:97415956-97415978 GAGGAGGGAAGGAGAGAGGAAGG - Intergenic
994352531 5:98763397-98763419 GTAGGGACTAGCAGAGAGGATGG - Intergenic
994815095 5:104576140-104576162 AGGGGGACAGGGAGAGAGGGAGG - Intergenic
994867550 5:105296072-105296094 GTGGTGACAAGGTGATAGGGAGG + Intergenic
994927450 5:106135861-106135883 GAAGGAACAAGGAGGGAGGAAGG - Intergenic
995118227 5:108505964-108505986 GAGGAGAGGAGGAGAGAGGAGGG - Intergenic
995150341 5:108836786-108836808 GAGGGGAAAAGGAGAGAGAAAGG - Intronic
995186326 5:109275494-109275516 CTGGGGACAGGGAGAGAGTTCGG + Intergenic
995396898 5:111696742-111696764 GTGAGGACACAGAGAGAAGATGG - Intronic
996053948 5:118964394-118964416 GTGGGGAGAAGGAGAGGGAGAGG - Intronic
996486961 5:124047092-124047114 GTGAAGAGAAAGAGAGAGGAGGG + Intergenic
996883631 5:128329612-128329634 GTGGTGTCAAGGAAAGAGCATGG - Intronic
996885958 5:128353981-128354003 GGGGAGACAGGGAGGGAGGATGG - Intronic
997262651 5:132476445-132476467 GTGGGGACTGGCAGACAGGAAGG + Intergenic
997584672 5:135037311-135037333 GATGGGACACGAAGAGAGGAGGG + Intronic
997671511 5:135678872-135678894 CTGGGGACAAGGACATAGGGTGG + Intergenic
997702036 5:135909243-135909265 GTGGGGAGAAGGAGTGAGTCAGG - Intergenic
997732087 5:136189079-136189101 GTGAGGACACGGTGAGAAGATGG - Intergenic
997998328 5:138604337-138604359 GTGAGGGAAAGAAGAGAGGAAGG + Intergenic
998006781 5:138662309-138662331 GTGGGGACAGGGGGAGATTATGG + Intronic
998013602 5:138714947-138714969 GAGAGGGCAGGGAGAGAGGAGGG + Intronic
998076215 5:139238630-139238652 GTGGGGACTAAGAGAAAGAAAGG + Intronic
998198832 5:140101249-140101271 GTGGGGGAAAGGAGAGGAGAAGG + Intergenic
998394543 5:141810216-141810238 GAGGGGAGAAGGAGAAAGAAGGG - Intergenic
998400285 5:141845274-141845296 TTGGGGAGAAAGAGAGAGTAGGG - Intergenic
998416185 5:141947835-141947857 TTGGGGGTAAGGAAAGAGGAGGG - Intronic
998656830 5:144190649-144190671 GAGGGGACAAGGAAAGAGGTAGG - Intronic
999679944 5:154047430-154047452 GTGGGGAAGAGTAGAAAGGAAGG + Intronic
1000126005 5:158244858-158244880 GTAGGGAAAAGAAGAGAAGAGGG - Intergenic
1000249314 5:159479146-159479168 GTGGTTACAGGGAGAGAGGAAGG - Intergenic
1000309668 5:160029914-160029936 GTGGGGCCCACCAGAGAGGAGGG + Intronic
1000329867 5:160198030-160198052 GAAGGGAGAAGGAGAGAAGAAGG + Intronic
1000369278 5:160519462-160519484 GTGGGAGCCAGAAGAGAGGAAGG - Intergenic
1000942483 5:167379044-167379066 GGGTGGACATGGAGAGGGGAGGG - Intronic
1001101852 5:168820910-168820932 GCGGGGAAGAGGAGAGAGGAAGG - Intronic
1001213404 5:169832419-169832441 GTGGGGAGAAGCAGAGATGATGG + Intronic
1001310063 5:170604102-170604124 GTGGGAACCAGGGAAGAGGAGGG + Intronic
1001506570 5:172284263-172284285 GAGGGGAGGAGGAGAGAGGGAGG + Intergenic
1001545982 5:172570805-172570827 GAGGGGAAAAGGAAGGAGGAAGG + Intergenic
1001890966 5:175338195-175338217 GAGGAGAGAGGGAGAGAGGAAGG - Intergenic
1001896325 5:175384994-175385016 GGGGAGGGAAGGAGAGAGGAAGG + Intergenic
1002899577 6:1399605-1399627 CTGGGGACCTGGAGAGAGAATGG - Intergenic
1003153134 6:3569912-3569934 GAGGGGAGAGGGAGGGAGGATGG - Intergenic
1003263767 6:4549166-4549188 GTGGGAAGAGGGAGAGAGGGAGG + Intergenic
1003382737 6:5639633-5639655 GTGGATAGAAGAAGAGAGGAAGG - Intronic
1003502122 6:6711578-6711600 GTGGGGACACAGGGAGAAGATGG - Intergenic
1003617737 6:7670659-7670681 GTGGGGACACAGGGAGAAGATGG - Intergenic
1003651848 6:7968059-7968081 GTGAGCACAAGGTGAGTGGAAGG + Intronic
1003785946 6:9487177-9487199 TTGGGGACAATGACAGAGCAGGG - Intergenic
1003882216 6:10489172-10489194 GTGGGGACACAGGGAGAAGATGG - Intergenic
1004152300 6:13133242-13133264 GTGGGGAGAGGGAGAGGGAAAGG - Intronic
1004160226 6:13206143-13206165 GTGGGCACCAGGAGGGAGGACGG + Intronic
1004321933 6:14638735-14638757 GTGGGGAGCAGAAAAGAGGAAGG - Intergenic
1004488947 6:16095525-16095547 GGGTGGACAAGGAGAGAAGAGGG - Intergenic
1004918320 6:20352983-20353005 GGGAGGCCAAGGAGAGAGGATGG + Intergenic
1004932586 6:20476498-20476520 GTGGAGAGAAGGAGAGAGAGGGG - Intronic
1005223974 6:23620127-23620149 GAGGGGACAGAGAGAGAGGGAGG + Intergenic
1005223981 6:23620148-23620170 GGGGGGACAGAGAGAGAGGGAGG + Intergenic
1005429719 6:25742418-25742440 GAGAGGTCAAGGAGGGAGGATGG + Intergenic
1005952880 6:30644412-30644434 ATGGAGGAAAGGAGAGAGGAAGG - Intronic
1005958165 6:30679104-30679126 CTGTGGTCCAGGAGAGAGGAGGG - Intronic
1006085864 6:31594544-31594566 GGGAGGCCAAGGTGAGAGGACGG + Intergenic
1006098565 6:31671372-31671394 TGGGGTACAAGAAGAGAGGAGGG + Intronic
1006174267 6:32112481-32112503 GTGGGGAGAAGGGAGGAGGAAGG + Intronic
1006187325 6:32188860-32188882 CTGAGAACAAGGAGGGAGGAGGG + Intronic
1006358205 6:33573037-33573059 GTGTCTATAAGGAGAGAGGAAGG + Exonic
1006510297 6:34517729-34517751 GAGGGGACAGGGAGGGAAGATGG - Intronic
1006613415 6:35309580-35309602 GTGAGGACAAGCAGAGAGGTGGG + Intronic
1006702125 6:35983980-35984002 GTGAGGAAAATGAGAGAGGGAGG - Intronic
1006795995 6:36732772-36732794 GTGGGGAAAGGGAGTGAGGTTGG - Exonic
1006881273 6:37342049-37342071 GTGGGGAGAAGTAGGGAGGTGGG - Intergenic
1006970854 6:38043511-38043533 GGGGAGAAAAGGAGAGAGGGAGG - Intronic
1007099074 6:39232120-39232142 GTGGGGAGATGGGGAGGGGAGGG - Intergenic
1007275840 6:40673046-40673068 ATGGAGAGAAGGAGAAAGGAAGG - Intergenic
1007323386 6:41042822-41042844 GCTGGGCCAGGGAGAGAGGAAGG + Intronic
1007358764 6:41340989-41341011 GTGGGGAGAAGGGGAAAGAAGGG - Intronic
1008543619 6:52566630-52566652 GTGGGGACAAGGGTGGAGGTGGG - Intronic
1008700624 6:54095338-54095360 GTCAGGACAAAGTGAGAGGAAGG + Intronic
1009896255 6:69754122-69754144 GTTGTCAGAAGGAGAGAGGAAGG + Intronic
1010117595 6:72333003-72333025 GAGGGGACAAGGAAGGAGGAGGG + Intronic
1010250769 6:73704767-73704789 GTGGGGAATAAGAGAAAGGAAGG + Intronic
1010415703 6:75609186-75609208 GCGGGGAGAAAGGGAGAGGAAGG - Intronic
1010592490 6:77726679-77726701 GTGGGATGTAGGAGAGAGGAAGG + Intronic
1011131633 6:84058051-84058073 GTGGGGACAAGGACATGGGGGGG + Intronic
1011632362 6:89339597-89339619 GAGGGGGGAAGGAGAGGGGAGGG + Intronic
1011708239 6:90024978-90025000 GTGGAGACAAGAGGAGAGGATGG - Intronic
1012396273 6:98801075-98801097 AAGGGGACTAGGAGACAGGAAGG + Intergenic
1012420238 6:99056782-99056804 GTGGAGACATGGAGTGAGGTGGG + Intergenic
1012776505 6:103500842-103500864 GTGGGGATGAGGGGAGAGGATGG - Intergenic
1013756460 6:113467539-113467561 ATGGGGACAGGGAGAGGGGAGGG - Intergenic
1013805234 6:113989405-113989427 GTGAGGACACAGAGAGAAGAGGG - Intronic
1014179578 6:118370408-118370430 GAGGGGGGAAGGTGAGAGGAGGG + Intergenic
1014207862 6:118676311-118676333 GTTGGGAAAAGGAGAGATGTTGG - Intronic
1014233023 6:118925100-118925122 AGGGGGAAAAGGGGAGAGGAGGG + Intronic
1014388053 6:120825561-120825583 GTGAGGCCAAGGCGGGAGGATGG - Intergenic
1014608872 6:123515673-123515695 CTGGGAGCAAGGTGAGAGGAAGG + Intronic
1015395863 6:132733954-132733976 GAGGGGAGAGAGAGAGAGGAAGG + Intronic
1015503033 6:133953032-133953054 TTGGGGACCAGGAAGGAGGAAGG + Intronic
1015598076 6:134885144-134885166 GAGGGGAGATGGAGAGAGGGGGG + Intergenic
1015795619 6:137008202-137008224 GGGAGGCCAAGGAGGGAGGATGG - Intronic
1015922474 6:138279840-138279862 GTGGGGAGAAGTAGAGATGGAGG - Intronic
1015955087 6:138590422-138590444 GAGGGGAAAGGGAGAAAGGAGGG - Intronic
1016063656 6:139656128-139656150 GGGAAGAAAAGGAGAGAGGAAGG - Intergenic
1016095442 6:140031553-140031575 GAGGATACAATGAGAGAGGAAGG + Intergenic
1016634795 6:146275558-146275580 ATAGGAAAAAGGAGAGAGGAAGG - Intronic
1016830095 6:148425687-148425709 GAGGGGAGAAGGGGAGGGGAGGG - Intronic
1017230708 6:152070307-152070329 CTGGGAACAAGGACAGAGGGAGG - Intronic
1017851706 6:158309901-158309923 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
1018162892 6:161064864-161064886 GTGCAGACAGGGAGAGAGGGAGG + Intronic
1018421258 6:163642683-163642705 GTGGGGCCAACCAGAGAGCAAGG + Intergenic
1018428206 6:163701949-163701971 GAGGAGACAAGTGGAGAGGAAGG - Intergenic
1018597300 6:165495346-165495368 GAGGGGAAAGGGAGAGAGAAAGG + Intronic
1018754873 6:166840358-166840380 GTGGGGAGGTAGAGAGAGGAAGG - Intronic
1018796118 6:167186861-167186883 GTGGGGAAAAGAAGAGGGGAAGG - Intronic
1018820203 6:167368196-167368218 GTGGGGAAAAGAAGAGGGGAAGG + Intronic
1019404745 7:877468-877490 GGGAGGACAGGGAGAGAGGCGGG - Intronic
1019420604 7:949017-949039 TTGGGGACAAGGAGGGCCGAGGG - Intronic
1019421325 7:952612-952634 GCGGGGACAAGCAGAGCGGCCGG + Intronic
1019494925 7:1333366-1333388 AGGGGGAGGAGGAGAGAGGAGGG - Intergenic
1019508221 7:1404112-1404134 CTGGGAACACGGAGAGGGGAGGG - Intergenic
1019578576 7:1749233-1749255 TGGGGGACAAGGAGGGAGGGAGG + Intergenic
1019644408 7:2121348-2121370 GTGGGGACAGGCAGGGATGAGGG + Intronic
1019958618 7:4437451-4437473 GTAGGGACAGGGGTAGAGGAAGG - Intergenic
1019964026 7:4484479-4484501 GAGAGGAAAGGGAGAGAGGAGGG + Intergenic
1020079591 7:5280366-5280388 GAGAGGCCAAGGCGAGAGGATGG - Intronic
1020106419 7:5424169-5424191 GGGAGGAGAAGGAGAAAGGAGGG - Intronic
1020256084 7:6503791-6503813 GCGGGGCCTAGGGGAGAGGACGG + Intronic
1020459483 7:8412693-8412715 TGGGGGACAGGGAGAGTGGAAGG + Intergenic
1020498386 7:8885857-8885879 GTGGGGACTGAGAGAGATGATGG + Intergenic
1020615468 7:10454072-10454094 GGGAGGCCAAGGAGAGAGAATGG - Intergenic
1020688906 7:11330253-11330275 CTGGGGCAAATGAGAGAGGAGGG - Intergenic
1020842026 7:13230086-13230108 GAGGGAAAAAGGAAAGAGGAAGG - Intergenic
1021028407 7:15698325-15698347 GGGAGGCCAAGGTGAGAGGATGG - Intergenic
1021509998 7:21425275-21425297 GAGGGGAAAGGGAGGGAGGAAGG - Intergenic
1021530339 7:21637217-21637239 GGGAGGAGAAGGAGAGAGAAAGG - Intronic
1021785864 7:24152075-24152097 CTGGGGAGAAGGAGAAGGGATGG - Intergenic
1021815899 7:24447486-24447508 GTGGCAACAGGCAGAGAGGACGG + Intergenic
1022183004 7:27940103-27940125 GTAGGGAGCAGGTGAGAGGAGGG - Intronic
1022312837 7:29213266-29213288 GAGGGGAGGAGGGGAGAGGAAGG - Intronic
1022380727 7:29857208-29857230 TTGGGGACAAGGTGAGGTGAGGG - Intronic
1022393014 7:29959951-29959973 GTGGGGGGAGGGAGGGAGGAGGG + Intronic
1022424267 7:30253173-30253195 GTGGGCAGAAGGAGAAGGGAGGG - Intergenic
1022437343 7:30401878-30401900 GTGGGGAGAAGAAGAGAAGAGGG - Intronic
1022539960 7:31126170-31126192 GTGAGGACACAGAGAGAAGACGG + Intergenic
1022863985 7:34398385-34398407 GTGAGGACACAGAGAGAAGATGG - Intergenic
1024242951 7:47449374-47449396 GTAGGGACAGGGAGTGAGGGAGG - Intronic
1024246013 7:47471191-47471213 GTGGGGAGAAGGGGTGAGGGTGG + Intronic
1024267848 7:47620519-47620541 GTGGGAGCATGGAGAGAGGAGGG - Intergenic
1024365064 7:48510710-48510732 GTGAGGACACAGGGAGAGGATGG - Intronic
1024457985 7:49630674-49630696 GTGAGGACACAGAGAGTGGACGG - Intergenic
1024470703 7:49766678-49766700 GTGGGGACCTGGAGAGGGCATGG + Intergenic
1024516645 7:50265016-50265038 GAGGTGACAAGGAGAGGTGAGGG + Intergenic
1024525296 7:50343271-50343293 ATGGAGAAAAGAAGAGAGGAAGG - Intronic
1024571577 7:50727261-50727283 GTGCAGACAAGTAGAGGGGAGGG - Intronic
1024997980 7:55289280-55289302 GAGGGGAGAGGGAGAGGGGATGG - Intergenic
1025199308 7:56951835-56951857 GAGAGGCCAAGGCGAGAGGATGG + Intergenic
1025253878 7:57370151-57370173 GGGGGGCCAAAGAGAGAGGTTGG + Intergenic
1025672639 7:63625099-63625121 GAGAGGCCAAGGCGAGAGGATGG - Intergenic
1026033512 7:66815473-66815495 GGGAGGTCAAGGAGGGAGGATGG - Intergenic
1026222778 7:68415115-68415137 GTGGGGCTTAAGAGAGAGGAGGG - Intergenic
1026277193 7:68890346-68890368 GGAAGGCCAAGGAGAGAGGATGG - Intergenic
1026606909 7:71824287-71824309 GGGGGGACAATGATTGAGGAAGG - Intronic
1026955054 7:74371755-74371777 GGGAGGAGAAGGAGAGAGGAGGG + Intronic
1027698774 7:81442951-81442973 GTGGGGCCGGGGAGAGGGGAGGG - Intergenic
1027918956 7:84365478-84365500 TTGGAGACAAAGAGAGATGAGGG - Intronic
1028051537 7:86193946-86193968 GTGAAGAGAAGGAGGGAGGAAGG + Intergenic
1028134277 7:87210001-87210023 GGGGGGACAGAGAGAGAGGAGGG + Intronic
1028199712 7:87947039-87947061 CTGGGGACTAAGAGAGAGGAAGG + Intronic
1028610928 7:92710776-92710798 GTGGGGAAAAGCAGAGATGAGGG + Intronic
1028959772 7:96735602-96735624 GTGGGGAGAAGTGAAGAGGAGGG - Intergenic
1029578307 7:101418845-101418867 GTGGAGAGGAGGAAAGAGGAAGG - Intronic
1029655888 7:101924156-101924178 ATGGGGAGGAGGACAGAGGATGG + Intronic
1030113059 7:106042714-106042736 GTGGGGAGATAGAGAGAGGCTGG + Intergenic
1030339554 7:108361622-108361644 GTGGGAACCAGGAGAGCTGATGG - Intronic
1030566483 7:111164126-111164148 GGGAGGAGAGGGAGAGAGGAAGG + Intronic
1030924223 7:115431275-115431297 GTGAAGACAAGAAGAGAAGATGG + Intergenic
1030945918 7:115720124-115720146 GAGAGGAAAAGAAGAGAGGAAGG + Intergenic
1031035297 7:116781815-116781837 GAGAGGCCAAGGCGAGAGGATGG - Intronic
1031083313 7:117278754-117278776 GTAGGGAGAAGGAGCCAGGATGG - Intronic
1031181956 7:118430720-118430742 GAGGGTAGAAGGTGAGAGGAAGG - Intergenic
1031245776 7:119309560-119309582 CTGGGGACTACTAGAGAGGAAGG + Intergenic
1031329787 7:120450450-120450472 GAGTGGAAAAGGAGAGGGGATGG + Intronic
1031969286 7:128052452-128052474 ATGGGGAAAAGGAGACAGGATGG - Intronic
1032056496 7:128688784-128688806 GTGGGGAGAGGGAGGGGGGAGGG - Intergenic
1032095236 7:128935001-128935023 GTGGGGAGCAGGGGGGAGGAGGG - Intergenic
1032186590 7:129732017-129732039 CTGGGGACCAGCAGAGAGGAAGG - Intronic
1032190694 7:129763954-129763976 GGGTGGGCAAGGAGGGAGGATGG - Intergenic
1032402213 7:131631243-131631265 GTGGGGACAGGCAGAGGGGATGG - Intergenic
1032432525 7:131873439-131873461 ATGGAGGCAAGCAGAGAGGAAGG - Intergenic
1032507530 7:132446929-132446951 GTGGGGAGAGGAAGGGAGGATGG - Intronic
1032519914 7:132535998-132536020 GTGGGAAGCAGGAGAGAGGTGGG - Intronic
1032544334 7:132729063-132729085 GAGGGGCCAAGGCGGGAGGATGG + Intergenic
1032835467 7:135668641-135668663 GGGAAGACAAGGTGAGAGGATGG - Intronic
1032951282 7:136917222-136917244 GGGGAGGCAAGGAAAGAGGACGG - Intronic
1033068070 7:138175349-138175371 ATGGAGAAAAGGAGAAAGGAAGG + Intergenic
1033426297 7:141247584-141247606 GTAGGGAAAGGGAAAGAGGATGG + Intronic
1033427281 7:141255792-141255814 GGGGGGCCAAGGTGAGAGGATGG - Intronic
1033845932 7:145432151-145432173 CTGAGGAGAAGGAGAGATGAGGG + Intergenic
1034100832 7:148449043-148449065 GTGAGGACACGGTGAGAAGACGG + Intergenic
1034391528 7:150791404-150791426 GTGGGGAGAAGAAAGGAGGAGGG + Exonic
1034447350 7:151120423-151120445 AAGGGGCCTAGGAGAGAGGAAGG - Intronic
1034541629 7:151762194-151762216 GTGGGGAGAAGACGAGAGGAAGG + Intronic
1034729373 7:153371043-153371065 AGGGGGCCAAGGTGAGAGGATGG + Intergenic
1034859134 7:154581328-154581350 GTGGGGAAAAGGAGACAGAGGGG + Intronic
1034882858 7:154775846-154775868 GTGTAGACAAGGAGAGTGGGAGG - Intronic
1034936961 7:155206479-155206501 GTGAGGACACAGGGAGAGGATGG - Intergenic
1034978065 7:155459325-155459347 GGGGAGACAGGGAGAGAGGAAGG - Intronic
1035094936 7:156346427-156346449 GCAGGGAGAAGGAGAGAGGATGG + Intergenic
1035134179 7:156684540-156684562 GTTGGGACAACGGAAGAGGAAGG - Intronic
1035237664 7:157509182-157509204 AGGGGGACAGGGAGAGAGGGGGG + Intergenic
1035237668 7:157509201-157509223 GGGGAGAGAAGGAGAGAGGAGGG + Intergenic
1035237692 7:157509271-157509293 ATGGGGAGAAGGAGAGAGGGGGG + Intergenic
1035237722 7:157509373-157509395 GAGGGGACAGGGAGAGAGAGGGG + Intergenic
1035237727 7:157509390-157509412 GAGGGGACAGGGAGAGAGAGGGG + Intergenic
1035237732 7:157509407-157509429 GAGGGGACAGGGAGAGAGAGGGG + Intergenic
1035280697 7:157776360-157776382 GTGAGGAAGAAGAGAGAGGAGGG - Intronic
1035690720 8:1557732-1557754 ATGAGGACATGGGGAGAGGACGG - Intronic
1035917325 8:3638816-3638838 CTGGAGACAAGGTGTGAGGAAGG - Intronic
1036657050 8:10683451-10683473 GAGGGGACAAGGTATGAGGATGG + Intronic
1036663048 8:10720858-10720880 GAGGGGGGAAGGAGGGAGGAAGG - Intergenic
1036767288 8:11556965-11556987 GTGGGGACAGGGAGGGATGGAGG + Intronic
1036779292 8:11634657-11634679 GTGGGGGCAGTGGGAGAGGAGGG - Intergenic
1036975387 8:13405287-13405309 GAGGGGAGAAGGAGGGAGGGAGG - Intronic
1037357843 8:18041494-18041516 GTGGGGGAAAGGTGAGAGGGAGG - Intergenic
1037403976 8:18522253-18522275 GTGGGGATAAGCAGCGAGGGAGG + Intergenic
1037752841 8:21693781-21693803 GAGAGGGGAAGGAGAGAGGAAGG + Intronic
1037767692 8:21782155-21782177 GTGAGAACCAGGAGAGAGAAGGG - Intronic
1037807209 8:22065271-22065293 GGGAGGCCAAGGAGAGAGGATGG - Intronic
1037836883 8:22219871-22219893 GTGTGGAGAAGGAGAGAACATGG - Exonic
1038266859 8:26044621-26044643 GGGGGGACAGGGAGAGAGAAAGG + Intronic
1038325237 8:26567809-26567831 ATGGGGAGAAGAAGAGATGAAGG + Intronic
1038400003 8:27277387-27277409 GAGGGGAAAAAGAAAGAGGAGGG - Intergenic
1038524494 8:28261424-28261446 GTGAAGACATGGAGAGAAGACGG + Intergenic
1038661576 8:29501953-29501975 ATAGGTACAAGGAGAGGGGATGG + Intergenic
1039044420 8:33436904-33436926 GAGGGGAGAAGGAGGGAGGGGGG - Intronic
1039396670 8:37231672-37231694 GTGAGAGAAAGGAGAGAGGAAGG + Intergenic
1039501795 8:38023595-38023617 GGGAGGCCAAGGTGAGAGGATGG - Intergenic
1039568193 8:38565756-38565778 GAGGGGACTAGAAGACAGGAGGG + Intergenic
1039715092 8:40099590-40099612 GTGAGGACAAAGGGAGAAGATGG + Intergenic
1040532187 8:48275116-48275138 GTGTGGAATAGGGGAGAGGAGGG + Intergenic
1040586833 8:48751542-48751564 GCTGGGAGAGGGAGAGAGGATGG + Intergenic
1041126529 8:54646277-54646299 GGGAGGAGAAGGAGAGAGTAGGG - Intergenic
1041158360 8:55011161-55011183 ATGGAAACAAGGAGAGCGGAAGG + Intergenic
1041444236 8:57932079-57932101 GGGGGGGCAGGGAGGGAGGAAGG + Intergenic
1041769155 8:61454316-61454338 AGGGGGGAAAGGAGAGAGGAGGG - Intronic
1041810332 8:61901890-61901912 ATGGAGACAAGGATAGAGGCCGG - Intergenic
1041855656 8:62451307-62451329 GGGGAGAGAAGGAGAGGGGAGGG - Intronic
1041899914 8:62970671-62970693 GAATGGACAAGGAGACAGGAAGG + Intronic
1042215046 8:66422921-66422943 AGGGGGACCAGGAGACAGGAGGG - Intergenic
1042520635 8:69707775-69707797 ATAAGGACAGGGAGAGAGGAAGG + Intronic
1042564573 8:70099074-70099096 GAGGGGAGAAGGAGGGAGGGGGG + Intergenic
1042978486 8:74498817-74498839 GTGGGGAGCAGGACAGAGAAAGG - Intergenic
1043052080 8:75396739-75396761 GTGGTGAGAAGGAAAGAGGAGGG - Intergenic
1043260497 8:78188519-78188541 GAGGGGAGAAGGAGAAGGGAAGG + Intergenic
1043383092 8:79723484-79723506 GTGAGGAGGAAGAGAGAGGAAGG - Intergenic
1043615998 8:82126405-82126427 GTAGGGAGAATGAGACAGGATGG + Intergenic
1043693398 8:83186512-83186534 GTGGGAAGAAGGAGAGAAGCAGG + Intergenic
1043823476 8:84896694-84896716 GTGGGGACAAGGAGAACAGAGGG + Intronic
1043933437 8:86116443-86116465 GGGAGGCCAAGGTGAGAGGATGG - Intronic
1044367829 8:91370299-91370321 AGAGGGAAAAGGAGAGAGGAGGG - Intronic
1044646250 8:94446621-94446643 GTGGGAAATAGGAGACAGGAGGG - Intronic
1044820721 8:96154147-96154169 TTGGGGAGAAGGACAGAGGACGG - Intronic
1045033750 8:98161691-98161713 GAGGAGAGAAGAAGAGAGGAGGG - Intergenic
1045218847 8:100176898-100176920 GGAGGGAAAAGGAGAGAGGGAGG - Intronic
1045383429 8:101648747-101648769 GTGGGGAGAAAGGGAGAAGAGGG - Intronic
1045659333 8:104420500-104420522 GTGGGAAAAAGGAGAGAAGGGGG - Intronic
1045661511 8:104442820-104442842 GGGAGGCCAAGGTGAGAGGATGG + Intronic
1045837441 8:106538834-106538856 GTGGGGAAAAGGAAAAAGTATGG + Intronic
1046513844 8:115233047-115233069 GATGGGACAGGGAGAGAGCATGG - Intergenic
1047009084 8:120651721-120651743 GTAGGGAGAAGGAGAGAAAAAGG + Intronic
1047329013 8:123868107-123868129 GAGGGGAGAAGGAGCGGGGAAGG - Intronic
1047357478 8:124137248-124137270 TTGGGAACAAAGAGAGAAGATGG - Intergenic
1047478154 8:125255546-125255568 GTGATCACAAGCAGAGAGGAAGG + Intronic
1047495257 8:125404516-125404538 GTGGGGAGAAGCAGAGGGGTGGG + Intergenic
1047619176 8:126588863-126588885 GTGTGGACAAGGAGGAACGAGGG - Intergenic
1047756178 8:127920010-127920032 TTGGGGACAAGAGGAGAGGCTGG - Intergenic
1047966713 8:130050556-130050578 GTGGGCACAAGGTTAGGGGAGGG + Intergenic
1048043505 8:130752498-130752520 GTGGGGACAAGGAGTCAGGGTGG + Intergenic
1048152501 8:131907842-131907864 GTGGGTAGAAGAAGGGAGGAAGG - Intronic
1048597967 8:135886617-135886639 GTGAGGACAGGAAGATAGGAAGG + Intergenic
1048759855 8:137782220-137782242 GTAGAGAGAAGGAGAGAGCAGGG - Intergenic
1048872950 8:138813796-138813818 CTGGTGACCTGGAGAGAGGATGG - Intronic
1048936921 8:139365141-139365163 GTGAGGACACAGAGAGAAGACGG - Intergenic
1049290451 8:141798830-141798852 GTGGGGACAATAAGAGAGGCAGG - Intergenic
1049370304 8:142261180-142261202 GTGGGAGGAAGGAGAGAGGAAGG + Intronic
1049370336 8:142261291-142261313 GAGGAGGGAAGGAGAGAGGAAGG + Intronic
1049411706 8:142476519-142476541 GTGGCCACAGAGAGAGAGGACGG + Intronic
1049469240 8:142768140-142768162 GGGGAGAAGAGGAGAGAGGAAGG + Intronic
1049632550 8:143666480-143666502 GTGTGCACACGGAGAGAGGGAGG - Intergenic
1049752532 8:144291903-144291925 GTGGGGACCGGGAGGGAGCAGGG + Intronic
1049835610 8:144733697-144733719 GTCGGCGCGAGGAGAGAGGATGG - Intronic
1050151307 9:2621885-2621907 GGGGAGGCAAGGGGAGAGGAGGG - Exonic
1050271888 9:3955053-3955075 GAGGGGACAAGGGGACAGGCTGG + Intronic
1050848772 9:10258014-10258036 GTGGGGAGAAGGGGGCAGGAAGG + Intronic
1050939707 9:11443332-11443354 GAGGGGAGCTGGAGAGAGGATGG - Intergenic
1051130065 9:13850856-13850878 GTGGGGGCAGGCAGAGAAGAAGG - Intergenic
1051164754 9:14249686-14249708 GAGGGGAGAAGAAGAGAGGAAGG + Intronic
1051169174 9:14301571-14301593 GGGGAGAGAAGGAGAGAGGGAGG - Intronic
1051250398 9:15153013-15153035 GTGGGGAAAGGGAAAAAGGAGGG - Intergenic
1051475744 9:17507130-17507152 GTGGGGAAAAGGAGGGAGAGAGG - Intergenic
1051634239 9:19167080-19167102 CTGGGGACTATGAGAGAGGAGGG - Intergenic
1052398963 9:27976658-27976680 GTGGGCAAAAGTAGAGATGATGG - Intronic
1052750331 9:32483588-32483610 GAGGGAACAAGGCAAGAGGAAGG - Intronic
1052850558 9:33375899-33375921 GTGGGAACAAGGGAAGAGGCTGG + Intergenic
1052898578 9:33770702-33770724 GTGAGGACACTGAGAGAAGATGG + Intronic
1052917232 9:33932754-33932776 GTGGGGATAAGGAATGAGGATGG - Intronic
1053205477 9:36182685-36182707 GGGAGGCCAAGGGGAGAGGATGG + Intergenic
1053296105 9:36913850-36913872 GGAGGGAAAAGGAGAGAGGTGGG + Intronic
1053350801 9:37412153-37412175 GTGGGAAGCAGGAGAGGGGAGGG - Intergenic
1054190946 9:61985421-61985443 GTGGTGCCGAGGAGAGAGCAGGG - Intergenic
1054462346 9:65472145-65472167 GTGGTGCCGAGGAGAGAGCAGGG + Intergenic
1054943647 9:70771483-70771505 GTGAGAACAAGGAAAGAAGAGGG - Intronic
1055505254 9:76941711-76941733 GTGAGCACAAGGAGAGATGGCGG + Intergenic
1055786964 9:79881555-79881577 GGGGGAAGAAGGAGAGGGGAGGG - Intergenic
1056071191 9:82988668-82988690 GAGGGAGCAAGGAGAGGGGAGGG - Intronic
1056459369 9:86794776-86794798 GTGGGGAGAAAGAATGAGGAGGG + Intergenic
1056639603 9:88359247-88359269 TTGGGGACAACGAGAGAGGTAGG - Intergenic
1057017514 9:91665691-91665713 TTGGGGACAAGGAAAGAAGGAGG - Intronic
1057291247 9:93808808-93808830 TTGGGGACAAGGAGAGGATAAGG + Intergenic
1057508000 9:95652359-95652381 GAGGGGAGAGGTAGAGAGGAGGG - Intergenic
1057716359 9:97498911-97498933 GTGGGGAGAGGGAGAGGGGGAGG + Intergenic
1057849720 9:98556008-98556030 GAGGGGAAAGGGAGACAGGAGGG + Intronic
1057936606 9:99244905-99244927 AAGGGGAGAAGGAGAGAGAAGGG + Intergenic
1058341665 9:103904788-103904810 GAGGGGAGAAGGAGGGAGGGAGG + Intergenic
1058359455 9:104126164-104126186 GCGGGCACAGGGAGAGAGTATGG - Intronic
1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG + Intronic
1059050467 9:110919227-110919249 GTGGGCAGAGGGAGAGAGGGAGG - Intronic
1059118285 9:111618232-111618254 GTGGGGAGAGGGAGAGGAGAGGG + Intergenic
1059838206 9:118181222-118181244 GTGGGGAAGAGGAGGGAGAAAGG - Intergenic
1059870091 9:118563290-118563312 GGGGGCAATAGGAGAGAGGATGG - Intergenic
1059955866 9:119515413-119515435 GTGGAGACAGAGAGAGAGAAAGG + Intronic
1060000184 9:119951598-119951620 CAGGGGACAGGTAGAGAGGAGGG - Intergenic
1060015744 9:120084821-120084843 GTGGGGGCATGGAGAGAGTTGGG - Intergenic
1060225362 9:121786930-121786952 GGGTGGAGAATGAGAGAGGAAGG - Intergenic
1060251092 9:121987367-121987389 GTGGGTAGGAGGAGAGAAGAAGG - Intronic
1060341797 9:122783702-122783724 GTGGGAACAAAGGGAGAGGGTGG + Intergenic
1060351600 9:122866371-122866393 GTGGGGAGAGGGAGGGGGGAGGG - Intronic
1060404091 9:123364556-123364578 GTGGGGATGGGGAGGGAGGAGGG + Intronic
1060525718 9:124320251-124320273 GGGGGGACCTGGTGAGAGGATGG + Intronic
1060587564 9:124795939-124795961 CTGGGGACAAGGACAGAGTTGGG + Intronic
1060592761 9:124829366-124829388 GTGGAGAGAGAGAGAGAGGAAGG - Intergenic
1060730982 9:126036930-126036952 ATGGGGACCAGAGGAGAGGAAGG - Intergenic
1060871073 9:127040525-127040547 TGGGGGTCAAGGAGAGAGTAAGG + Intronic
1060954531 9:127629149-127629171 GTGGGGCCTGGGGGAGAGGAAGG + Intronic
1060983727 9:127808206-127808228 GAGGGAAGAAGGAGAGAGAAAGG - Intronic
1061146689 9:128803810-128803832 GAGGGGTCAAGGACAGAGGAAGG + Intronic
1061281688 9:129601354-129601376 GGGGGAAGAAGGAGAGAGGAGGG + Intergenic
1061662455 9:132139256-132139278 GGGGAGAGAAGGGGAGAGGAGGG + Intergenic
1061662473 9:132139296-132139318 GGGGAGAGAAGGGGAGAGGAGGG + Intergenic
1062168775 9:135122635-135122657 GTGGGGCCTAGGAGAGCAGATGG - Intergenic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062255546 9:135619125-135619147 GAGGGGACCAGGAGAGAGGCAGG - Intergenic
1062559739 9:137136194-137136216 GTCAGGACAGGGAGAGAGGAGGG + Intergenic
1062697940 9:137884941-137884963 GGGGGGAAGAGGGGAGAGGAGGG - Intronic
1203562316 Un_KI270744v1:69039-69061 GTGGGGAGAGGGAGAGAGAGAGG - Intergenic
1185445039 X:253429-253451 GTGGGAACTAGGAGAGAGATTGG + Intergenic
1185459479 X:328220-328242 GGGGGGGCAGGGAGAGAGGAGGG - Intergenic
1185459521 X:328298-328320 GGGGGGACGGGGAGAGGGGAGGG - Intergenic
1185459533 X:328319-328341 GGGGGGACGGGGAGAGAGGGAGG - Intergenic
1185459543 X:328340-328362 GGGGGGACGGGGAGAGAGGGAGG - Intergenic
1185459569 X:328388-328410 GGGGGGACGGGGAGAGGGGAGGG - Intergenic
1185459580 X:328408-328430 GGGGGGACGGGGAGAGGGGAGGG - Intergenic
1185459591 X:328428-328450 GGGGGGACGGGGAGAGGGGAGGG - Intergenic
1185459603 X:328449-328471 GGGGGGACGGGGAGAGAGGGAGG - Intergenic
1185459613 X:328470-328492 GGGGGGACGGGGAGAGAGGGAGG - Intergenic
1185459623 X:328491-328513 GGGGGGACGGGGAGAGAGGGAGG - Intergenic
1185459633 X:328512-328534 GGGGGGACGGGGAGAGAGGGAGG - Intergenic
1185459659 X:328560-328582 GGGGGGACGGGGAGAGGGGAGGG - Intergenic
1185459670 X:328580-328602 GGGGGGACGGGGAGAGGGGAGGG - Intergenic
1185459681 X:328600-328622 GGGGGGACGGGGAGAGGGGAGGG - Intergenic
1185459693 X:328621-328643 GGGGGGACGGGGAGAGAGGGAGG - Intergenic
1185459703 X:328642-328664 GGGGGGACGGGGAGAGAGGGAGG - Intergenic
1185459795 X:328802-328824 GGGGGGGCAGGGAGAGGGGAGGG - Intergenic
1185459843 X:328892-328914 GGGGGGAGGGGGAGAGAGGAGGG - Intergenic
1185459926 X:329070-329092 GGGGGGACGGGGAGAGAGGAGGG - Intergenic
1185459935 X:329090-329112 GGGGGGACGGGGAGAGAGGAGGG - Intergenic
1185459962 X:329147-329169 GGGGGGACGGGGAGAGAGGGAGG - Intergenic
1185631107 X:1516332-1516354 GTGGGGACACAGGGAGAAGACGG + Intronic
1185648016 X:1628801-1628823 GAGAGGAGAAGGAGAGAGGCAGG - Intronic
1185704736 X:2258289-2258311 GTGAGGACACAGAGAGAAGATGG + Intronic
1185756669 X:2659224-2659246 GGAGGGAGGAGGAGAGAGGAGGG - Intergenic
1185756794 X:2659480-2659502 GGAGGGAGGAGGAGAGAGGAGGG - Intergenic
1185770398 X:2761522-2761544 GTGGGGACACAGGGAGAAGATGG + Intronic
1186009789 X:5116613-5116635 GTGAGGACACGGGGAGAAGACGG + Intergenic
1186051761 X:5604091-5604113 GTGGGCAGAGGGAGACAGGAGGG + Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187090453 X:16090613-16090635 GTGGGGACAGGAAGGAAGGAGGG + Intergenic
1187346598 X:18470924-18470946 GAGGGGACAAGAGGAGAGCAGGG + Intronic
1187352617 X:18534899-18534921 TTAGGGAGAAGGAGCGAGGAAGG + Intronic
1187452858 X:19413853-19413875 AAGGGGAAAAGGAGAGAAGAAGG + Intronic
1187553110 X:20325785-20325807 GAAGGGAGAAGGAGTGAGGATGG + Intergenic
1187626070 X:21115253-21115275 GGGAGGCCAAGGAGGGAGGAAGG + Intergenic
1187949785 X:24460490-24460512 GTGGGGGGAGGGAGAGAGGTAGG + Intergenic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188616833 X:32167840-32167862 GTGGGGACAAGGAGTGGTGGTGG - Intronic
1189197654 X:39165746-39165768 GTGGGGAGGAGCAGTGAGGAGGG - Intergenic
1189325583 X:40109094-40109116 GCGGGGAGGAGGAGAGACGAGGG + Intronic
1189367821 X:40402797-40402819 AGGGGGAGAGGGAGAGAGGAGGG - Intergenic
1189465770 X:41276516-41276538 GCGGGGAGAAGAAGAGAGGGAGG + Intergenic
1189778070 X:44487900-44487922 GAGGGGAGAAGGAGAGAAGCTGG + Intergenic
1190047684 X:47125833-47125855 GTGAGGACACAGTGAGAGGATGG - Intergenic
1190184361 X:48221772-48221794 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1190260096 X:48792080-48792102 TTGGGGACAGGGAGTGATGAAGG - Exonic
1190472612 X:50798040-50798062 GAGGGGAGAGGGAGAGAGGGAGG + Intronic
1190871632 X:54429732-54429754 GATGGGAGAAGGTGAGAGGAGGG - Intergenic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191091389 X:56626274-56626296 GTGGGGAGAAGAAAAGAGGAGGG + Intergenic
1191697032 X:64000786-64000808 GGGAGGCCAAGGAGAGAGGATGG - Intergenic
1191870296 X:65739920-65739942 GTGGGGACAAGGAAAAAGGGAGG - Exonic
1192319615 X:70079123-70079145 GTGGCAGCAGGGAGAGAGGAGGG + Intergenic
1192464261 X:71342553-71342575 GTGGGGAGAGGGAGAGGGGGAGG + Intergenic
1192534661 X:71917242-71917264 GAGGGGGGAGGGAGAGAGGAAGG - Intergenic
1192764231 X:74125970-74125992 CTGGGTATAAGGTGAGAGGATGG + Intergenic
1192764762 X:74129309-74129331 GTGGAGACAAGAGGAGTGGATGG + Intergenic
1193834643 X:86326679-86326701 GGAGGGACAAGGAGGGAGAAGGG - Intronic
1193894301 X:87093206-87093228 GTGGGGGGAAGGTGGGAGGAGGG - Intergenic
1194301768 X:92196185-92196207 GTGGAGACAAGGAGAAAGGTTGG - Intronic
1194644139 X:96437737-96437759 GTGTGGACAAGGTAAGAGAAGGG + Intergenic
1195065602 X:101235760-101235782 GTGTGAACAAGGGGAGAGAAGGG - Intronic
1195130111 X:101842898-101842920 GTGGGGAAAGGGAGAGAAGGTGG + Intronic
1195176164 X:102317354-102317376 GTGGGGAAGAGGAGAGAAGGCGG - Intronic
1195182700 X:102369739-102369761 GTGGGGAAGAGGAGAGAAGGCGG + Intronic
1195328430 X:103776752-103776774 GTGGGGAAAAGGGGAGGAGAAGG + Intronic
1195385884 X:104313290-104313312 AGGGGGACAAAGAGGGAGGAAGG - Intergenic
1196375645 X:115029710-115029732 GAGAGGGCCAGGAGAGAGGAGGG - Intergenic
1196422510 X:115537544-115537566 GTGAGGCCAAGGAAAGAGGATGG + Intergenic
1197215196 X:123860351-123860373 GAGGGGAAAAGAAGAGGGGAGGG - Intronic
1197816498 X:130504216-130504238 GAGAGGACAGGAAGAGAGGAAGG - Intergenic
1197969187 X:132097119-132097141 GTGAGGATCTGGAGAGAGGATGG - Intronic
1198102109 X:133431142-133431164 GTGGGAAGGAGGAGAGAAGAAGG + Intergenic
1198158860 X:133987314-133987336 AGGGAGACAAAGAGAGAGGAAGG + Intergenic
1198301363 X:135336775-135336797 CTGGGAATAAGGAGAGGGGAAGG - Intronic
1199550443 X:149056183-149056205 GTTGGGAAAAGGAGATGGGATGG + Intergenic
1199825837 X:151498419-151498441 GTGTGGACAGGGAGGGAGGTGGG + Intergenic
1199995397 X:153021598-153021620 GTGGTGAACAGGAGGGAGGAGGG - Intergenic
1200117877 X:153777097-153777119 GTGGGGACTGGAAGAAAGGAAGG - Intronic
1200375484 X:155775310-155775332 GAGGGGAGAAGGAGAAAGGGAGG - Exonic
1200645753 Y:5781358-5781380 AGGGGGAAAAGGAGAGAGAAAGG - Intergenic
1200747926 Y:6918656-6918678 GGGAGGTCAAGGAAAGAGGATGG - Intronic
1201741215 Y:17326088-17326110 GAGGGAAGAAGGAGAGAGGGAGG + Intergenic
1201890906 Y:18942829-18942851 GAGGGGAGACAGAGAGAGGAAGG + Intergenic
1202035613 Y:20631839-20631861 GTGGGGAAAAAGAGAGAGGTAGG - Intergenic