ID: 1084605793

View in Genome Browser
Species Human (GRCh38)
Location 11:70170920-70170942
Sequence CAGTGGGGCCAGGGGGAAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1090
Summary {0: 1, 1: 1, 2: 14, 3: 100, 4: 974}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084605793_1084605802 14 Left 1084605793 11:70170920-70170942 CCTCCTTCCCCCTGGCCCCACTG 0: 1
1: 1
2: 14
3: 100
4: 974
Right 1084605802 11:70170957-70170979 CAACATCATCGAGATCCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084605793 Original CRISPR CAGTGGGGCCAGGGGGAAGG AGG (reversed) Exonic
900101633 1:964536-964558 CAGTGGGGCTGCGGGGAGGGGGG + Intronic
900164858 1:1240585-1240607 CATGGGGGCCAGGGTGAATGGGG - Intergenic
900179862 1:1306328-1306350 CGGAGGGGCCAGGGAGAAGGTGG + Intronic
900242445 1:1623516-1623538 AAGTGGGGCCAGCAGGACGGCGG + Exonic
900265717 1:1756072-1756094 CGGTGGGGCCAGGGGCAGTGTGG - Intronic
900295457 1:1946919-1946941 CAGCTGGGGCTGGGGGAAGGTGG + Intronic
900299593 1:1970069-1970091 CAGTGGGGCCCGTGGGTGGGGGG + Intronic
900582432 1:3415721-3415743 CCGTGGGGGCAGCGGGCAGGAGG - Intronic
900599568 1:3497251-3497273 CAGTGAAGCCAGGGGGACAGCGG + Exonic
900613556 1:3554367-3554389 CAGCCGGGCCAGGCGGGAGGGGG + Intronic
900644330 1:3702241-3702263 CAGGCAGGCCAGGGGGCAGGCGG + Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900917750 1:5650533-5650555 TAGCGGGGCCTGGGGGAAGATGG + Intergenic
900938846 1:5784800-5784822 CTGTGGGGCCAGGGGGACCAGGG - Intergenic
900970854 1:5991913-5991935 CAGAGAGGCCAGGGGGCAGGGGG + Intronic
900991546 1:6100468-6100490 CAATGGTGCCAGAGGGCAGGTGG + Exonic
901109986 1:6786010-6786032 CAGTGGGGCGCGGGGCCAGGAGG - Intronic
901829794 1:11885480-11885502 CAGTGGGACCTGGGGTAGGGAGG + Intergenic
902816516 1:18919413-18919435 CAGGGGAGCCCGGGGGAGGGCGG + Intronic
902821855 1:18948377-18948399 GAATGGGGACAGTGGGAAGGTGG - Intronic
903291563 1:22317483-22317505 CAAAGGGGCCAGGAGGAAGGGGG + Intergenic
903410711 1:23140974-23140996 CAGTGTGCCCAGGGAGAAGGTGG + Intronic
904369639 1:30040291-30040313 CTGTGGGGCCAGGTAGGAGGAGG + Intergenic
904503621 1:30933168-30933190 CAGTGAGGTCAGCGGGAATGAGG + Exonic
904718122 1:32484607-32484629 AAGTGGGGCCTGGTGGGAGGTGG + Intronic
904988730 1:34574018-34574040 CAGTGGGTGCCAGGGGAAGGGGG + Intergenic
905001183 1:34671327-34671349 CTGTGGGGCCAGGGGGTTGGGGG - Intergenic
905019076 1:34796037-34796059 CAGTGTGGCCAGGGCGACGATGG - Intronic
905274318 1:36807234-36807256 CACTGGGGCCAGGAGAGAGGAGG + Intronic
905552579 1:38855191-38855213 CAGTCAGTCCAGGGGGGAGGTGG + Intronic
906293050 1:44632184-44632206 CAGAGGGGCCGGCGGGAGGGAGG + Intronic
906607550 1:47182509-47182531 AAGTGGGGCCAGAAGGTAGGAGG - Intergenic
906668985 1:47641272-47641294 TAGTGGAGCAAAGGGGAAGGAGG - Intergenic
906808235 1:48800995-48801017 CTGTGGGGCATGGGGGAGGGTGG + Intronic
906969390 1:50495241-50495263 CAGTGGGGTGTGGGGGAAGGTGG - Intronic
907328028 1:53653604-53653626 CAGTGGGGTGAGGGGGAGGAGGG - Intronic
907328170 1:53654328-53654350 CACAGAGGCCAGGGGGATGGAGG + Intronic
907414272 1:54303370-54303392 CAGTCAGCCCAGGGGGCAGGGGG + Intronic
907515948 1:54993611-54993633 CAGCAGGGCCAGGGGCAGGGTGG - Intergenic
907515964 1:54993657-54993679 CAGTGGGGGGTGGGGGGAGGGGG - Intergenic
907566291 1:55437362-55437384 CAGTGGTTCCATGGGGTAGGAGG + Intergenic
908268020 1:62397344-62397366 CTTGGGGGCCAGGAGGAAGGAGG + Intergenic
908577571 1:65477271-65477293 AAGTGGGGCCACGGGGAGGTGGG - Intronic
908926451 1:69260647-69260669 CAGAGGGTGGAGGGGGAAGGAGG + Intergenic
909169982 1:72282754-72282776 GTGTGGTGCCAGGGGGAGGGAGG - Intergenic
911086169 1:93979197-93979219 CAGCGGGGCCAGGACGGAGGTGG - Intergenic
911090486 1:94013407-94013429 CAGTGGGGCCCAGAGGCAGGTGG + Intronic
911983158 1:104590899-104590921 CAGTGGGGCCTGTAGGGAGGTGG + Intergenic
912005597 1:104896110-104896132 CAGTGGGAAAAGGGGGAATGGGG + Intergenic
912417579 1:109520496-109520518 CAGTGGGGCCAAGGGGTAGCTGG + Intergenic
912565780 1:110586218-110586240 CAGTGAGGCGAGGTGGAAGAGGG - Intergenic
912687022 1:111775833-111775855 CACTGGGGCCAGAGGAAGGGAGG - Exonic
912713236 1:111964417-111964439 CTGTGGGGGCCGGGGGAGGGAGG - Intronic
914338568 1:146739060-146739082 CAGTGGGGACAGGGCGAACTGGG + Intergenic
914450638 1:147788335-147788357 CAGATGGGTCAGGGGGAAGCAGG + Intergenic
914511179 1:148333815-148333837 TGCTGGGGCCAGGGGGAGGGCGG - Intergenic
914998659 1:152566589-152566611 CAATGGGGGAAGGGGGCAGGAGG - Intronic
915267118 1:154726847-154726869 CAGGGGAGCCCGGGGGAGGGTGG + Intronic
915313335 1:155015392-155015414 CAGTGGGGGCAGTGGGCCGGGGG + Exonic
915441457 1:155947909-155947931 CAGTGGGGCACGGGGCAGGGGGG + Exonic
915461488 1:156073151-156073173 CAGTTAGGCCTGGGGGAAGCAGG + Exonic
915517159 1:156420309-156420331 CAGAGGGGCCCGGGGAAAGCCGG - Intronic
916265094 1:162882569-162882591 CACTGGGGTCAGGGAGAAGATGG - Intergenic
916929130 1:169556680-169556702 CTGTGGGCCCAGAGGGAAAGTGG - Exonic
917052832 1:170942877-170942899 CAGGTGGGCCAGGGTAAAGGAGG + Intronic
917502681 1:175599688-175599710 CAGAGGGGCCAGGTGGAGCGGGG + Intronic
917929169 1:179812187-179812209 CATTGGGACCAAGGGGCAGGAGG - Intronic
918183333 1:182105446-182105468 CAGTAGGACCACAGGGAAGGAGG + Intergenic
918610744 1:186487996-186488018 CAGTGGGGCCACAGAGAAAGAGG + Intergenic
918839735 1:189518881-189518903 CAGTGGGGCCTGTTGGGAGGAGG + Intergenic
919196736 1:194296069-194296091 CAGTGGGGCAGGAGGGAAAGTGG + Intergenic
919861122 1:201740084-201740106 CGGTGAGGCCAGGGGGGTGGGGG - Intronic
920018187 1:202930691-202930713 CAGTGGGGGTTGGGGGAAGGTGG - Intergenic
920096402 1:203489031-203489053 TAGTGGAGCACGGGGGAAGGAGG - Exonic
920255639 1:204652280-204652302 CAGGGAGGCAAGGAGGAAGGCGG - Intronic
920310314 1:205044472-205044494 CAGTGAGGCCAGGAGGGAGTGGG + Intronic
920435128 1:205942479-205942501 CCGTGGGGCCAAGTGTAAGGGGG + Intronic
920673891 1:208025546-208025568 CACTGGAGTCAGGGGGTAGGAGG - Exonic
921219533 1:212963326-212963348 CAGTGGCCCCAGTGGGCAGGGGG - Intronic
922188437 1:223296370-223296392 GAGTGGGCCTAGGGAGAAGGGGG + Intronic
922280078 1:224114695-224114717 CTCTCGGGCCAGGCGGAAGGTGG - Intronic
922571272 1:226635884-226635906 CAGTGGGGCCAGAGGAAGGCCGG + Intronic
923232240 1:231997767-231997789 CAGTGGGTTCAGGTGGTAGGAGG - Intronic
923372775 1:233328836-233328858 AAGTGGGGCCAGAGGGAGGTGGG + Intronic
923719416 1:236454433-236454455 CATGGGGGCTAGGAGGAAGGAGG - Intronic
924045960 1:240030826-240030848 GATTGAGCCCAGGGGGAAGGAGG + Intronic
924931675 1:248737814-248737836 CAGTGGGTCATGGGGGATGGTGG + Intronic
1062818438 10:516832-516854 GAGGGGGGACAGGGGGATGGGGG + Intronic
1062857079 10:784762-784784 CAGAGGGGCCAGCGGGGAGCCGG - Intergenic
1063048810 10:2422603-2422625 AACTGAGGCCAGGCGGAAGGTGG + Intergenic
1063371511 10:5525607-5525629 CAGGGGAGGCAGGGGGATGGGGG - Exonic
1063602955 10:7498602-7498624 GAGTGGTGACAGGGGGAAAGAGG - Intergenic
1063949449 10:11208528-11208550 CAGAGAGGCCAGGGAGAATGCGG - Intronic
1064060805 10:12135145-12135167 CTGTGGGGGTAGGGGGAAAGGGG + Intronic
1064230002 10:13521549-13521571 CAGTGGGGCCAGGGTGCTGAAGG + Intronic
1066471814 10:35705636-35705658 TAGTGTGGCCTGGGGGAACGGGG - Intergenic
1066546201 10:36503131-36503153 CAAGGGGGCCAGGAGGAAGCAGG - Intergenic
1067224437 10:44366450-44366472 CACTGGGGCCTGTTGGAAGGTGG - Intergenic
1067437361 10:46287443-46287465 CACTGGCGCCAGGGGCAAGCAGG + Exonic
1067521512 10:47010619-47010641 CAGTGGGGAGAGAGGGAGGGAGG - Intergenic
1068476489 10:57533146-57533168 CACTGGGGCCAGTTGGGAGGTGG + Intergenic
1069184074 10:65400468-65400490 TGGTGGGGGAAGGGGGAAGGAGG - Intergenic
1069603267 10:69723158-69723180 AGCTGGGGCCTGGGGGAAGGAGG + Intergenic
1069628009 10:69880296-69880318 CAGAGGGCACAGGGGCAAGGAGG - Intronic
1069867578 10:71513224-71513246 CAGTGTGGCCAGTGGGGATGTGG + Intronic
1070259184 10:74837698-74837720 CAGTGGGGCCAGTGGGATGTTGG + Intronic
1070260949 10:74855207-74855229 CAGTGAGGCCTGCAGGAAGGAGG + Intronic
1070495226 10:77015337-77015359 CTGTGGGGTCAAGGGGAAGGAGG - Intronic
1070579923 10:77711468-77711490 CTGTGGGGGCAGGGGGCAAGGGG - Intergenic
1070798344 10:79230244-79230266 CAGTGGTCCCAAGGGGAAAGGGG - Intronic
1070842269 10:79495403-79495425 CAGTGGGGGCAGAGGGGAAGCGG + Intergenic
1071470658 10:85981876-85981898 GAGAGGGACCAGGGAGAAGGAGG + Intronic
1071524053 10:86347963-86347985 CACTGGGACCATGGGGAAGGTGG - Intronic
1071598011 10:86942168-86942190 CAGGTGGGCCAAGGGGAAGGTGG + Intronic
1072188201 10:93061504-93061526 CAGTGGGAGCCGGGGGAAGAAGG - Intronic
1072271735 10:93783506-93783528 CAGTGGGGCTGTGGGGAGGGAGG + Intronic
1072394475 10:95024685-95024707 GAGTGGGGGGAGGGGGAAGGGGG + Intergenic
1073056218 10:100704422-100704444 CAGAGGGGCCAGGGTGATGGTGG - Intergenic
1073116563 10:101094808-101094830 AAGTGGGCACAGGTGGAAGGAGG - Intronic
1073137914 10:101229903-101229925 CAGTGGGGTGAGGGGCAAGAGGG - Intergenic
1073267255 10:102235185-102235207 CAGAGGGGCCAGGGAGGCGGTGG - Intronic
1074163754 10:110857016-110857038 GGGTGGGGGGAGGGGGAAGGGGG + Intergenic
1074358594 10:112807151-112807173 CAGTGCAGCCATGGGGAAGAAGG + Intronic
1074855055 10:117467267-117467289 CAGCGAGGCCAGGGAGAAAGTGG - Intergenic
1075015643 10:118908445-118908467 CAGTGGGGGCTGGGGGAGGGAGG - Intergenic
1075122691 10:119675854-119675876 GAAGGGGGCAAGGGGGAAGGGGG - Intronic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075303672 10:121348502-121348524 AGGTGGGGCAAGGGGGAAGAGGG - Intergenic
1075360354 10:121826760-121826782 GAGTGGGGAGAGAGGGAAGGTGG - Intronic
1075736675 10:124668691-124668713 AAGTGGGGCCAGGGGTCATGAGG + Intronic
1075916706 10:126174181-126174203 CAGTGGGGGGAAGGGGGAGGAGG - Intronic
1076222199 10:128743252-128743274 CAGAGGGGCCAGAGGCAGGGTGG + Intergenic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1076456325 10:130601157-130601179 TAGTGGGGCTTGGGGGCAGGTGG - Intergenic
1076485419 10:130812613-130812635 CATTTGGGCCAGGGGCAGGGAGG - Intergenic
1076550990 10:131278080-131278102 CAGTGGGCCCGGGGGGAGGCAGG - Intronic
1076568175 10:131412941-131412963 GTGTGGGGCCGGGGGAAAGGCGG + Intergenic
1076698367 10:132257735-132257757 CAGAGGGGCCTGGTGGAGGGTGG - Intronic
1076726612 10:132416893-132416915 CTGTGGGCCCTGAGGGAAGGAGG + Intronic
1076728082 10:132422529-132422551 GAGCGGGGCCAGGAGGGAGGGGG - Intergenic
1076769673 10:132656156-132656178 CAGTGGGGACAGGGTGCAAGAGG + Intronic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1077021869 11:420560-420582 CAGCGGCGCCAGCGGGAAGGCGG + Exonic
1077233766 11:1470219-1470241 CAGTGGGGGCAGTGGGGATGGGG - Exonic
1077249471 11:1554618-1554640 CAGAAGGGACAAGGGGAAGGGGG + Exonic
1077281818 11:1749385-1749407 CAGTGGGTCCGGGGAGATGGAGG - Intronic
1077350359 11:2090397-2090419 GAGAGGGGCCAGGGGTCAGGAGG - Intergenic
1077474851 11:2781515-2781537 CAGTGGGGCCAGAGGGGGAGTGG - Intronic
1078971580 11:16418700-16418722 GAGGGGGGCCAGGGAGAGGGAGG + Intronic
1079641910 11:22816187-22816209 AAGTGGGGGCAGGGAGATGGGGG - Intronic
1080844538 11:36015311-36015333 CAATGGGGGCAGGGGGCGGGGGG - Intronic
1081568650 11:44276096-44276118 CAGTGGGGCTTGGGGTGAGGAGG + Intronic
1081831753 11:46120834-46120856 CAGAGGGGGAAGGGGGAGGGAGG + Intronic
1082207987 11:49462256-49462278 GGGTGGGGGGAGGGGGAAGGGGG - Intergenic
1083121453 11:60516675-60516697 CCCTGGGGGCAGGGGGTAGGCGG + Intronic
1083171304 11:60925194-60925216 CAGGGAGCCCTGGGGGAAGGGGG - Intronic
1083259438 11:61515231-61515253 CAGTGGGGTGAAGGGGATGGGGG - Intergenic
1083554220 11:63613561-63613583 CGGTCCGGCCAGGCGGAAGGGGG + Intronic
1083615401 11:64023674-64023696 GAATGGGCCCAGTGGGAAGGAGG - Intronic
1083619546 11:64042101-64042123 CAGTGGGACCAGGCGGGAGGGGG + Intronic
1083663999 11:64265049-64265071 TGGTGGGGCCAGGGGGCCGGCGG - Exonic
1083738507 11:64695170-64695192 CAGTGGGGCTGGGGGCCAGGAGG - Intronic
1083756057 11:64792232-64792254 CAGGGCGGCCAGCAGGAAGGTGG + Exonic
1083896637 11:65623422-65623444 CAGTGGGGCAGTGGGGAAGATGG - Intronic
1083897085 11:65625349-65625371 GACTGGGGCCGGGGGGAAGGAGG + Intronic
1084014242 11:66369281-66369303 CAGTAGGGCTGGGGGGCAGGGGG + Intronic
1084121260 11:67070399-67070421 CAGGGGGGCGAGGGGGCATGTGG - Intronic
1084154934 11:67308097-67308119 CAGAGGTCCCAGAGGGAAGGTGG + Intronic
1084171585 11:67403781-67403803 CACTGGGGCCATGGGGAAGGTGG + Intronic
1084284322 11:68121556-68121578 GAGCGGGGCCTGGGCGAAGGGGG + Intergenic
1084338578 11:68476448-68476470 CCGTGGGGAGAGGGGGGAGGGGG + Intronic
1084395784 11:68909124-68909146 CAATGGGGCCAGGCGCACGGTGG - Intronic
1084425774 11:69083898-69083920 CAGTGGGGCCAGGAGGAGTAAGG + Intronic
1084546611 11:69818046-69818068 CTGTGCGGCCAGGGCGGAGGCGG + Intronic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1084661581 11:70549550-70549572 CAGTGTGGCCAGGGGCAGGCGGG + Intronic
1085040068 11:73321853-73321875 CAGTGGGGGCAGTGTGATGGAGG + Intronic
1085295626 11:75430120-75430142 CAGCGGGGCCAGCGAGAAGGCGG + Exonic
1085297121 11:75437531-75437553 GGGTGGGGCCAGGTGGTAGGGGG + Intronic
1085300432 11:75455364-75455386 GAGTGAGGGCAGGAGGAAGGTGG + Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085402560 11:76243456-76243478 AGGTGAGGCCAGGGGGAAAGGGG + Intergenic
1085969741 11:81573477-81573499 TACTGGGGCCAGAGGGAAGATGG + Intergenic
1086085342 11:82947448-82947470 GAGAGGGGAAAGGGGGAAGGAGG + Intronic
1086187606 11:84038127-84038149 CACTGGGGCCTAGTGGAAGGTGG - Intronic
1086559077 11:88146206-88146228 CAGTGGGGTCAGTGGTAAGATGG + Intronic
1087427402 11:98007777-98007799 CAGAGGGGGCAGGGTGGAGGAGG - Intergenic
1087439885 11:98170018-98170040 CAGTGGGGTGAGAGGGATGGGGG + Intergenic
1087781569 11:102306364-102306386 CAGTGTGCCCTGGGGAAAGGGGG + Intergenic
1088687597 11:112298107-112298129 CAGGGGGGCCATGTGGAAAGGGG - Intergenic
1088832291 11:113547661-113547683 CAGTAGGACAAGTGGGAAGGTGG - Intergenic
1088906319 11:114157887-114157909 CAGTGGAGCCAGGGGCAGGGTGG - Intronic
1089058942 11:115610246-115610268 CACTGGGGCCTGTGGGAAGGGGG - Intergenic
1089201058 11:116724974-116724996 AAAAGGGGGCAGGGGGAAGGAGG - Intergenic
1089311648 11:117562000-117562022 GAGTGGGGACAGTGGGAAGCAGG + Intronic
1090204765 11:124878110-124878132 GAGTGGAGCCAGGGGGACAGTGG + Exonic
1090363597 11:126189317-126189339 CAGTGGGGCCAGGTGACAGCTGG - Intergenic
1091237766 11:134033284-134033306 CAGAAGGGCCAGGGAGAGGGAGG + Intergenic
1091285792 11:134408194-134408216 CAGTGGGGTGAGGAGGGAGGTGG + Intronic
1091285814 11:134408276-134408298 CAGTGGGGTGAGGAGGGAGGTGG + Intronic
1091285826 11:134408317-134408339 CAGTGGGGTGAGGAGGGAGGTGG + Intronic
1091285838 11:134408358-134408380 CAGTGGGGTGAGGAGGGAGGTGG + Intronic
1091285851 11:134408399-134408421 CAGTGGGGTGAGGAGGGAGGTGG + Intronic
1091285863 11:134408440-134408462 CAGTGGGGTGAGGAGGGAGGTGG + Intronic
1091285875 11:134408481-134408503 CAGTGGGGTGAGGAGGGAGGTGG + Intronic
1091285887 11:134408522-134408544 CAGTGGGGTGAGGAGGGAGGTGG + Intronic
1091285899 11:134408563-134408585 CAGTGGGGTGAGGAGGGAGGTGG + Intronic
1091285911 11:134408604-134408626 CAGTGGGGTGAGGAGGGAGGTGG + Intronic
1091285923 11:134408645-134408667 CAGTGGGGTGAGGAGGGAGGTGG + Intronic
1091285935 11:134408686-134408708 CAGTGGGGTGAGGAGGGAGGTGG + Intronic
1091285947 11:134408727-134408749 CAGTGGGGTGAGGAGGGAGGTGG + Intronic
1091285959 11:134408768-134408790 CAGTGGGGTGAGGAGGGAGGTGG + Intronic
1091285971 11:134408809-134408831 CAGTGGGGTGAGGAGGGAGGTGG + Intronic
1091285983 11:134408850-134408872 CAGTGGGGTGAGGAGGGAGGTGG + Intronic
1091285995 11:134408891-134408913 CAGTGGGGTGAGGAGGGAGGTGG + Intronic
1091286008 11:134408932-134408954 CAGTGGGGTGAGGAGGGAGGTGG + Intronic
1091440008 12:505392-505414 CAGTGGGAACAGAGGAAAGGGGG - Intronic
1091816927 12:3445915-3445937 CAATGGGGCCAGGAGGTAGGTGG - Intronic
1091826498 12:3516796-3516818 CTAAGGGGCGAGGGGGAAGGTGG - Intronic
1091912730 12:4244935-4244957 CAGCGGGGTGATGGGGAAGGAGG - Intergenic
1092064483 12:5578463-5578485 CACAGGTGCCAGGGGAAAGGAGG + Exonic
1092164142 12:6332592-6332614 CTGTGGAGCCAGGAGTAAGGAGG + Intronic
1092181746 12:6451213-6451235 CAGTGGGGGCAGGGGGAGACGGG - Intronic
1092900434 12:13054725-13054747 CAGTGAGGCCAAGGGGTGGGTGG + Intronic
1094202212 12:27805800-27805822 CACTGTGGCCAGGGGCATGGAGG + Intergenic
1094250430 12:28353879-28353901 CATTGGGGCCAATTGGAAGGTGG + Intronic
1095130964 12:38541763-38541785 CAGAGGGGCCAGAGGGGAGGTGG + Intergenic
1095524034 12:43104051-43104073 CAGTTGCGCCAGGTGGCAGGTGG + Intergenic
1095722576 12:45416732-45416754 CAGAGGGGCCAGTGGAAAAGAGG - Exonic
1096113923 12:49044158-49044180 CAGTGGGGCCTGGGAGAAGGTGG - Intronic
1096257517 12:50072423-50072445 CAGAGGGGCCAGGGGCCTGGGGG + Intronic
1097054264 12:56240466-56240488 CGGTGGGGAGAGGGGGGAGGGGG + Exonic
1097191026 12:57219712-57219734 CAGCTGGGCCAGGGGGACAGGGG + Intronic
1097246448 12:57610231-57610253 CAGTGCGGCCAGGGGCGGGGCGG - Exonic
1097951169 12:65429614-65429636 CAGTGGGCCCAGTGGGAACATGG - Intronic
1098877015 12:75876455-75876477 TTGTGGGGACAGGTGGAAGGGGG + Intergenic
1099593064 12:84621146-84621168 CACTGGGGCCTGTTGGAAGGTGG + Intergenic
1100355684 12:93827009-93827031 AAGTGGGGCCAGGGACAAGAAGG + Intronic
1100447618 12:94675923-94675945 CAGAGGGGCATGGAGGAAGGCGG - Intergenic
1101202285 12:102449380-102449402 CAGTGGGGCCAGTCGGGGGGTGG + Intronic
1101220618 12:102635412-102635434 ACGTGAGGCCAGGGAGAAGGTGG + Intergenic
1101236084 12:102791852-102791874 CAGTGTGGTCAGGCTGAAGGTGG + Intergenic
1101324258 12:103700992-103701014 GGGTGGGGGCAGGGGGGAGGGGG - Intronic
1101788724 12:107909684-107909706 CAGTGGGGCCTGTCGGAGGGTGG - Intergenic
1101968149 12:109294760-109294782 CAGTGTGGGCAGGGGGTTGGGGG - Intronic
1102207617 12:111101195-111101217 CAGTGCGGCCCGGGGGAGGCTGG + Intronic
1102257731 12:111425794-111425816 CAGCGGTGCCCAGGGGAAGGAGG - Intronic
1102390344 12:112544477-112544499 CAGTGGGGGTAGGGGAAAGAGGG + Intergenic
1102536756 12:113587682-113587704 GAGTGGGGGAAGTGGGAAGGAGG - Intergenic
1102569401 12:113818381-113818403 TACTGGGGCCAGTGGGCAGGGGG + Intronic
1102703422 12:114860313-114860335 CAGTGGGGCCCAGGGGCTGGAGG - Intergenic
1102729145 12:115092630-115092652 CAGGGGGGCCAGGATGAAAGTGG - Intergenic
1102776560 12:115524814-115524836 CAGTGGGGCTAACTGGAAGGAGG - Intergenic
1103238949 12:119397864-119397886 AAGTGGGGCAGGGAGGAAGGGGG + Intronic
1103239785 12:119403599-119403621 CAGAGGGCACAGGGGGAAGATGG - Intronic
1103516781 12:121513440-121513462 CAGAGGGCGAAGGGGGAAGGAGG + Intronic
1103916194 12:124376832-124376854 CAGACGGGGCAGGAGGAAGGAGG + Intronic
1104420671 12:128631987-128632009 GAGTGGGGATGGGGGGAAGGGGG + Intronic
1104536341 12:129621381-129621403 CAGTGGGGGCAGGGGGAGGGTGG - Intronic
1104603407 12:130169137-130169159 CAGTGGGGCTAGGGGGAAGCAGG + Intergenic
1104877284 12:132044328-132044350 CAGGGGGGCAAGAGGGCAGGAGG - Intronic
1104971020 12:132530730-132530752 GGGTGGGGGGAGGGGGAAGGGGG + Intronic
1106231316 13:27823448-27823470 CAGAGGGGACTGGGGGGAGGAGG - Intergenic
1106590104 13:31091538-31091560 CAGTGCTGCAAGGGGAAAGGAGG + Intergenic
1106598407 13:31166555-31166577 CAATTGGGCCAGGGGTGAGGTGG - Intergenic
1107333019 13:39321816-39321838 GAGTGGGCCCAGAGGGAATGAGG - Intergenic
1107628786 13:42320511-42320533 CAGTGGGAGGAGGGGGGAGGGGG - Exonic
1108026089 13:46179556-46179578 TAGTGGGGGCAGGGAGAAGATGG + Intronic
1108258084 13:48629760-48629782 CAGTGGGGGCTGGTGGGAGGTGG + Intergenic
1109293070 13:60498929-60498951 CAGTGGGTCCAGTGGGTACGCGG + Intronic
1109497895 13:63197933-63197955 TTGTGGGGTCGGGGGGAAGGGGG + Intergenic
1110401845 13:75101065-75101087 AAGTGGGGCCTGGTGGGAGGTGG - Intergenic
1111528701 13:89508822-89508844 GCTTGGGGTCAGGGGGAAGGTGG - Intergenic
1111963826 13:94840370-94840392 CTGTGGGGTCAGGGGGCACGGGG + Intergenic
1112004341 13:95241514-95241536 CAGGGGGGGCAGGAGGAAGGAGG - Intronic
1112288226 13:98122862-98122884 AAGTGGGGCCTGGTGGGAGGTGG + Intergenic
1113126107 13:106981481-106981503 CAGTGGGCTCAGGGGGAGAGGGG - Intergenic
1113488795 13:110676310-110676332 CAAGGGGACCAGGGAGAAGGCGG + Intronic
1113491617 13:110696910-110696932 CATGGGGGCGATGGGGAAGGTGG - Intronic
1113614217 13:111669604-111669626 CCGAGGGGGCAGGGGGCAGGGGG - Intronic
1113619685 13:111754518-111754540 CCGAGGGGGCAGGGGGCAGGGGG - Intergenic
1114270329 14:21097226-21097248 GAGTGAGGACAGAGGGAAGGAGG - Intronic
1114480986 14:23034467-23034489 CGGTGGGGCCGGGGGTAAGTCGG - Intronic
1114515618 14:23298007-23298029 CAGTGGGGGAAGAGGGAGGGAGG + Exonic
1115397636 14:32926578-32926600 CAGTGGGGTAAGGGGGAAGTGGG + Intergenic
1115727858 14:36236828-36236850 CACTGGGGCCTGTGGGGAGGGGG + Intergenic
1116426814 14:44800440-44800462 GAGTGGGGAGAGAGGGAAGGGGG + Intergenic
1116658066 14:47675356-47675378 GAGTGGGGCTAGGGGAACGGGGG + Intergenic
1116916851 14:50532981-50533003 CAGCGGGGCGCCGGGGAAGGAGG + Intronic
1117016959 14:51527892-51527914 CAGTGGGGCCAGGCTGAGGTGGG + Intronic
1117073208 14:52074832-52074854 GATGGGGGCCAGGGAGAAGGAGG - Intergenic
1117079071 14:52132813-52132835 GATTGGGGGAAGGGGGAAGGGGG + Intergenic
1117605897 14:57428871-57428893 CAGTGGGGCCGGGGCCAAAGAGG - Intergenic
1118166967 14:63346348-63346370 CATTGAGGGCTGGGGGAAGGGGG - Intergenic
1118473172 14:66093881-66093903 CAGCGGGGCGAGGAGGCAGGGGG + Intergenic
1118749230 14:68794458-68794480 CAGTCGGGCCAAGGCGCAGGGGG - Intronic
1118925515 14:70187759-70187781 CAAGGGGGCGAGGGAGAAGGAGG - Intronic
1118982952 14:70730799-70730821 CATTGGGGTCAGGGAGACGGGGG + Exonic
1119188837 14:72664622-72664644 CAGAGGGGGCAGGTGGGAGGTGG - Intronic
1121102802 14:91261638-91261660 CTGTGGGGCCAGGGTGGAGCCGG + Intergenic
1121505377 14:94473126-94473148 TGGTGGGGGAAGGGGGAAGGAGG - Intronic
1121530713 14:94651423-94651445 CAGAGCGGCCTGGGGAAAGGGGG + Intergenic
1121638812 14:95471812-95471834 CAATGAGGGCAAGGGGAAGGTGG + Intronic
1121791508 14:96702880-96702902 GAGTGGGGGCGGGGTGAAGGGGG + Intergenic
1122015336 14:98790269-98790291 CAGTGGGACCAGGTGGGAGCAGG - Intergenic
1122079218 14:99255436-99255458 CAGGGGGGCCAGGGGGTGGAAGG + Intronic
1122412135 14:101531040-101531062 CAGAGGGACCAGGGGCAGGGCGG - Intergenic
1122721966 14:103727354-103727376 CAGAGGGGGCGGGGGGCAGGTGG - Intronic
1122930846 14:104932509-104932531 CTGTGGGGCCAGGTGACAGGCGG - Intronic
1123112308 14:105878760-105878782 CTGGGGGGCCAGGGGCATGGCGG - Intergenic
1124022824 15:25939592-25939614 CAGTGGGGTGGGGCGGAAGGAGG + Intergenic
1124193792 15:27602937-27602959 CACTGTGGTCAGGGGGATGGAGG - Intergenic
1124594821 15:31083658-31083680 CAGTGGAGCGAGGGGGTGGGAGG - Intronic
1124905838 15:33867751-33867773 CCTTGGGGCCTGGAGGAAGGGGG - Exonic
1125741208 15:41966156-41966178 CAGCTAGGCCTGGGGGAAGGAGG - Intronic
1125782167 15:42279373-42279395 CAGGTGGGCCAGGGGGAACAGGG + Intronic
1126679985 15:51193109-51193131 CAGTGGGGCTTGGGGGAGGACGG + Intergenic
1127136898 15:55933531-55933553 GGGTGGGGGGAGGGGGAAGGGGG + Intronic
1127320000 15:57834690-57834712 GAGTGGGGGCGGGGGGAAGCTGG + Intergenic
1127856771 15:62960017-62960039 CTGTGGGGAGAGGGGGATGGGGG + Intergenic
1128138604 15:65282814-65282836 AAGTGGGGCAAGGGAGAAGGGGG + Intronic
1128157784 15:65402523-65402545 CAGGGGGGCCACAGGGAGGGTGG + Intronic
1128638095 15:69315968-69315990 CAGTGAAGCCTCGGGGAAGGCGG + Intronic
1128677920 15:69625256-69625278 CAGAGGGGGCTTGGGGAAGGGGG + Intergenic
1128940933 15:71787091-71787113 CAGTGGAGCCAGTGGAGAGGAGG + Intergenic
1129360114 15:75019329-75019351 CAGAGGGGCCAGAGGCAAGAGGG - Exonic
1129655763 15:77524915-77524937 TAGTGAGGTCAAGGGGAAGGTGG - Intergenic
1129661748 15:77556609-77556631 AACTGGGCCCAGGTGGAAGGTGG - Intergenic
1129789206 15:78329548-78329570 CAGTGGGGCAAGCGGGGAGCTGG - Intergenic
1130118321 15:81024738-81024760 TGGTGGAGGCAGGGGGAAGGAGG + Intronic
1130220507 15:82015392-82015414 CAGTGGGACCAGCCTGAAGGAGG - Intergenic
1130321838 15:82848457-82848479 CAGTGGGGCCAGCGGGCCTGTGG - Intronic
1130661974 15:85837916-85837938 CAGTGGGGAGGTGGGGAAGGTGG - Intergenic
1130742448 15:86615392-86615414 CAGTGGGATCTGGGGTAAGGAGG + Intronic
1130933725 15:88451002-88451024 CAGTGGGGACTGGTGGTAGGGGG + Intergenic
1131034255 15:89210829-89210851 CACTGGGGCCATGGGGAACGGGG - Intronic
1131395790 15:92084911-92084933 CCGCAGGGCCAGGCGGAAGGAGG + Intronic
1131487054 15:92829533-92829555 AAGTGGGGCCAAGGGAAAGCTGG + Intergenic
1132028311 15:98421057-98421079 CATTGGCTCCAGGGGCAAGGAGG - Intergenic
1132100535 15:99020039-99020061 CAGTGTGGCCATGGGGTTGGTGG + Intergenic
1132238514 15:100239737-100239759 TGGTGTGGCCAGGAGGAAGGTGG + Intronic
1132478202 16:153056-153078 GAGTGGGGACAGTGGGGAGGGGG + Intronic
1132548704 16:545360-545382 CGGTGGGCCGAGGTGGAAGGGGG - Intronic
1132567733 16:630988-631010 CAGAGGGGCCAGGCTGAAGCTGG + Exonic
1132644034 16:990687-990709 CCGTAGGCCCATGGGGAAGGCGG - Intergenic
1132672728 16:1108317-1108339 CAGAGTGGCCAGTGGGGAGGTGG + Intergenic
1133014738 16:2934120-2934142 CAGGGGGGCCAAGGAGTAGGAGG - Intronic
1133022710 16:2973958-2973980 ATGGGGGGCTAGGGGGAAGGTGG - Intronic
1133041130 16:3060132-3060154 GAGTGGGGACAGGGTGAACGAGG - Exonic
1133276447 16:4640961-4640983 CCTTGGGGCCAGCGGGAAAGGGG + Intronic
1133304144 16:4799520-4799542 CTGTGGGGTCAGGGGCAAGCTGG - Intronic
1133605644 16:7385248-7385270 CAGTGGGGCCCAGGAGAAGAAGG + Intronic
1133629281 16:7603911-7603933 CAGAATGGACAGGGGGAAGGAGG + Intronic
1134058245 16:11183332-11183354 CAGTAGGACGTGGGGGAAGGGGG - Intergenic
1135081255 16:19437949-19437971 CTCTGTGGCCAGGGGGATGGTGG + Intronic
1135087757 16:19488494-19488516 CAGTGGAGCCAAAGGGAAGTGGG - Intronic
1135137428 16:19895332-19895354 CAGTGGGGCCAGGAGAGTGGAGG - Intergenic
1135597407 16:23754946-23754968 CAGTGGCCCCAGGGGGACGAAGG - Exonic
1135695328 16:24581361-24581383 CGGTGGGGGGAGGGGGAAGATGG - Intergenic
1136395985 16:29992777-29992799 CAGAGGGGCCACGGGGTAGGCGG + Exonic
1136428679 16:30184993-30185015 GCCTGGGGCCAGGGAGAAGGGGG + Intronic
1137248961 16:46729358-46729380 CTGTGGGGCCTGGGGCAAGAAGG - Intronic
1137374937 16:47944326-47944348 CAGCGGGGCAAGGGGAAAGCAGG + Intergenic
1137613617 16:49834857-49834879 AAGTGGGTCAAGGAGGAAGGAGG + Intronic
1137760292 16:50934967-50934989 CAGATGGGCCAAGGGGATGGAGG - Intergenic
1137978878 16:53053436-53053458 GAGTGGGGGCCGGGGGGAGGGGG + Intergenic
1138345008 16:56315399-56315421 CACTGGGCTCAGGGGAAAGGAGG + Intronic
1138390660 16:56668040-56668062 CAGTGGGTGCACGTGGAAGGCGG + Exonic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1139327611 16:66164323-66164345 CAAATGGGGCAGGGGGAAGGAGG + Intergenic
1139390939 16:66605786-66605808 GGGTGGGGGCAGGAGGAAGGGGG + Intronic
1139516335 16:67454458-67454480 CAGAAGGGCCCGGGGGAAGCAGG + Intronic
1139662503 16:68430635-68430657 CAGTGGGGTGATGGGGCAGGGGG - Intronic
1139672217 16:68499641-68499663 CTGTTGGGGCAGGGGGCAGGGGG - Intergenic
1139995711 16:70978294-70978316 CAGTGGGGACAGGGCGAACTGGG - Intronic
1140105436 16:71955574-71955596 CACTTGAGCCAGGGGGATGGAGG - Intronic
1140417624 16:74787412-74787434 GAGTGGGAACAGGGGGAAGAAGG - Intergenic
1140504082 16:75459441-75459463 GAGTGGGGCCAGCTGGAAGGAGG - Intronic
1140511517 16:75512243-75512265 AAGTGGGGCCAGCTGGAAGGAGG - Intergenic
1141210172 16:81972379-81972401 AAGTGGGGGGAGGGGGAAGAAGG - Intergenic
1141452920 16:84117401-84117423 CCGTGGGGCCGGGGGTCAGGAGG - Intergenic
1141699710 16:85636764-85636786 CAGTGGTGCTAGGGGTGAGGGGG - Intronic
1141704218 16:85655782-85655804 CAGTGGGGGCAGGGAGCCGGGGG - Exonic
1141988054 16:87592870-87592892 CTGTGGGGGAAGGGGGAGGGAGG + Intergenic
1141992506 16:87618574-87618596 CAGTGTGGCCAGGTGGAAAAAGG - Intronic
1142036980 16:87868574-87868596 CAGCGGGGCCAACGGGAGGGTGG + Intronic
1142153553 16:88523227-88523249 CTGGGGAGCAAGGGGGAAGGGGG - Intronic
1142279463 16:89140209-89140231 CAGAGGGGCAGTGGGGAAGGCGG - Intronic
1142353137 16:89588871-89588893 CAGGGGGGTGAGGGGGAAGACGG - Intronic
1142595067 17:1025910-1025932 AACTGGGGCATGGGGGAAGGAGG + Intronic
1142707864 17:1708022-1708044 CAGCGGGACCAGGCGGAAGAGGG + Exonic
1142712258 17:1730067-1730089 AAGAGAGGCCAGAGGGAAGGTGG + Intronic
1142950946 17:3479625-3479647 GAGTCGGTGCAGGGGGAAGGTGG - Intronic
1142982148 17:3678553-3678575 CAGTGGGGCAAGGAGGCTGGAGG - Intronic
1143012008 17:3871124-3871146 CAGCGAGACCAGGGGGAAGGTGG + Intronic
1143045757 17:4078003-4078025 CAGTGGGGCCCCAGGGGAGGTGG - Exonic
1143046546 17:4085213-4085235 CAGTGGGGAAAGGAGGAAAGGGG + Intronic
1143096784 17:4482638-4482660 CAGCGGGGCCAAGGGGAGGCTGG - Intronic
1143109137 17:4543789-4543811 CAGAGGGCCCAGGAGGGAGGCGG - Intronic
1143174249 17:4947545-4947567 CAGTGTGGACAGGGAGATGGTGG + Intronic
1143204216 17:5131559-5131581 CAGTGTCCCCATGGGGAAGGGGG + Intronic
1143321731 17:6072725-6072747 CAGGAGGCCCAGGGAGAAGGTGG - Intronic
1143492694 17:7293555-7293577 CAGTGGGGACAGTGAGATGGGGG + Intronic
1143499489 17:7330442-7330464 CAGTGGGGCCATGGAGAAGGTGG + Intergenic
1143583947 17:7842215-7842237 CAGCGGGGGCGGGGGGTAGGGGG + Intronic
1143586476 17:7853172-7853194 CAGTGCAGTCAGGGGGAGGGAGG - Intronic
1143712623 17:8744887-8744909 CAATGGGGGCAGGGGGCAGGGGG - Intronic
1144169011 17:12640641-12640663 TAGTGGGGAAAGGGGGAAGGTGG + Intergenic
1144493130 17:15731592-15731614 CAGTGGGGTCAGTGGGAACGTGG + Intergenic
1144574055 17:16417879-16417901 AAGTGGGGGCAGGGCAAAGGGGG + Intronic
1144787654 17:17840765-17840787 CAGGGGGGCAGGGGGGCAGGGGG - Intergenic
1144852507 17:18251158-18251180 CAGGGAGGCCAGGTGGGAGGTGG - Intronic
1144907125 17:18645060-18645082 CAGTGGGGTCAGTGGGAACGTGG - Intronic
1144955211 17:19015593-19015615 CAGTAGGGCCAGGGCCATGGAGG - Intronic
1145077885 17:19870141-19870163 AAGTGGGGGCAGGAGGCAGGGGG + Intergenic
1145791891 17:27632528-27632550 CAGAGGGGGCTGGGGGAAGCTGG + Intronic
1146268080 17:31466220-31466242 CAGTGGGTCCCAGGGGAAGGAGG + Intronic
1146536463 17:33657038-33657060 CAGAGTGGCTAGGGAGAAGGAGG + Intronic
1147037179 17:37690465-37690487 CAGTGGGGCAAGGGTGGAAGTGG + Intronic
1147392033 17:40115459-40115481 AAGTGGGGTGAGGGAGAAGGAGG - Intergenic
1147544865 17:41393529-41393551 CAGGCAGGCCAGTGGGAAGGAGG - Intronic
1147768322 17:42851451-42851473 CAGAGGGGCAATGGGGAAGCTGG - Exonic
1147952429 17:44114570-44114592 CAGCGGGGCCATGGAGGAGGCGG - Intronic
1148051020 17:44769953-44769975 CAGAGGGGGCAGCAGGAAGGGGG - Intronic
1148218336 17:45846033-45846055 CAGCAGGGCCAGCAGGAAGGAGG - Exonic
1148735798 17:49864267-49864289 GAGTGGGGTCAGGGAGAAGAAGG + Intergenic
1148769325 17:50057704-50057726 CAGTGGGGTCAGAGGCCAGGTGG - Intronic
1148790314 17:50169040-50169062 GAGTGGGGGCAGGGGGCACGAGG - Intronic
1148849594 17:50548219-50548241 CTGGGGGGCCTGGGAGAAGGTGG + Intronic
1148857270 17:50585620-50585642 CAGTGTGCCCAGTGGGCAGGAGG + Intronic
1149240971 17:54648592-54648614 TAGTGGGGTCCAGGGGAAGGTGG + Intergenic
1149342236 17:55698985-55699007 CAGGGAGGCCAGGGGAAGGGAGG + Intergenic
1149540296 17:57463441-57463463 CAGTGGGGCCATGGGGAGGGAGG - Intronic
1149656416 17:58311714-58311736 CAGGTGGGCCTGGGGGCAGGGGG + Exonic
1149939665 17:60850323-60850345 CAGTGGTGCCAGGAGTTAGGGGG - Intronic
1150514439 17:65793320-65793342 CAATGGGGCCTGTTGGAAGGTGG + Intronic
1150634397 17:66902683-66902705 AGGTGGGGCCAGGGGGCTGGAGG + Intergenic
1150807002 17:68327189-68327211 GAGTGGGGCGTGGGGGAGGGAGG + Intronic
1151172581 17:72259744-72259766 CAGCAGGGCCAACGGGAAGGTGG - Intergenic
1151379747 17:73717561-73717583 CGGTGGGGGGAGGGGGGAGGTGG - Intergenic
1151553585 17:74835655-74835677 CAGTGGGGCCAGTGGCAGGGTGG - Intronic
1151572223 17:74932562-74932584 AGGTGGGGCCAGAGGGCAGGGGG - Intronic
1151630738 17:75309261-75309283 CAGTGGGGAGAGGGGGACGAAGG + Intergenic
1152029636 17:77834127-77834149 TGGTGGGGGCAGGGGGAATGGGG - Intergenic
1152152217 17:78609306-78609328 CAGAAGGGCCAGGGGGGATGGGG + Intergenic
1152193365 17:78902085-78902107 CAGTGGTGGCGGGGGGACGGGGG + Intronic
1152284209 17:79403097-79403119 GACTGCAGCCAGGGGGAAGGAGG + Intronic
1152324169 17:79625981-79626003 CAGTTGCTCCAGGGGAAAGGCGG + Intergenic
1152525282 17:80884839-80884861 CAGAGTGGCAACGGGGAAGGAGG - Intronic
1152634077 17:81423347-81423369 CGGTGGGGCAAGGGGGGCGGCGG - Intronic
1152723436 17:81933957-81933979 CAGCGAGGGCAGGAGGAAGGTGG + Intronic
1152747166 17:82046401-82046423 CAGTGTGGACAGGGGTGAGGAGG - Intergenic
1152913208 17:83017193-83017215 CAGTGGCGGGAGGAGGAAGGGGG + Intronic
1153447710 18:5192784-5192806 TGGTGGGGTGAGGGGGAAGGGGG + Intronic
1153507102 18:5812180-5812202 CACTGGGGCCTGGCAGAAGGTGG + Intergenic
1153729212 18:7990822-7990844 TGGTGGGGCCTGGGGGACGGGGG + Intronic
1153813519 18:8773234-8773256 CAGGGGGTGCAGGGGGATGGTGG - Intronic
1153846312 18:9052674-9052696 CAGTAGGGGCTGGGAGAAGGAGG + Intergenic
1153966140 18:10183737-10183759 AAGTTGGGCCAGGGAGAAAGGGG + Intergenic
1154270301 18:12912483-12912505 CAGTGGGGCCAGGAGGGGAGGGG - Intronic
1154485151 18:14867016-14867038 CCGTGGGGGAAAGGGGAAGGTGG + Intergenic
1155116951 18:22778199-22778221 AAGTAGGGCAAAGGGGAAGGTGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155688114 18:28580702-28580724 AGGTGGGGCCTGGTGGAAGGTGG - Intergenic
1156088669 18:33440282-33440304 CAGTGGGGACTGGGGGACTGGGG + Intronic
1156498382 18:37540938-37540960 GAGTGGGGGCATGGGGAAGGAGG + Intronic
1156528036 18:37786485-37786507 CAGTGGGGCCTGTTGGAGGGTGG - Intergenic
1156965835 18:43090856-43090878 CAGTGGGGCCTGTTGGAGGGTGG + Intronic
1157491106 18:48124498-48124520 CAGAGGAGCCAGCTGGAAGGGGG + Intronic
1157517318 18:48320262-48320284 GAGTGGAGCGAGGGGGAAGTGGG + Intronic
1157569260 18:48701524-48701546 CACTGGGGGCTGGGGGACGGAGG - Intronic
1157692116 18:49692098-49692120 CAGTGGGGGAAGGGACAAGGAGG + Intergenic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1157860130 18:51133726-51133748 GAGTGGGGCCGTGGGGACGGAGG + Intergenic
1157885204 18:51359972-51359994 CAGAGAGGCCAGTGGGAAGCTGG - Intergenic
1158216399 18:55104640-55104662 AAGAGGGGCCTGGTGGAAGGTGG - Intergenic
1158984581 18:62801130-62801152 CACTGGGGCCCAGGAGAAGGAGG - Intronic
1160059234 18:75514597-75514619 GAGTGGGGCCTGAGGGAAGTTGG + Intergenic
1160078135 18:75697436-75697458 CAATGTGGCCAGGTAGAAGGAGG + Intergenic
1160191878 18:76721506-76721528 CAGTAGGGGCAGGGGGAAGATGG + Intergenic
1160265290 18:77336503-77336525 CAGTGGGAGGAGGTGGAAGGGGG + Intergenic
1160417820 18:78723758-78723780 TAGGGGGGCGAGGGGGTAGGTGG + Intergenic
1160509857 18:79447290-79447312 CAGCGAGGCGAGGGAGAAGGCGG - Intronic
1160538371 18:79607315-79607337 CCATGGGGCCAGAGGGACGGAGG + Intergenic
1160823386 19:1068300-1068322 CTGTGGGGTCAGGGTGATGGTGG + Intronic
1160875885 19:1295988-1296010 GTGTGGGGCCAGGGGGGAGTGGG + Intronic
1160875901 19:1296021-1296043 GAATGGGGCCAGGGGGGAGTGGG + Intronic
1160913930 19:1487853-1487875 CAGGGGGTCCTGGGGGCAGGTGG + Exonic
1160923798 19:1533418-1533440 CATGGGGGCCAGTGGGGAGGTGG + Intronic
1161206307 19:3042852-3042874 CAGTGGGGACTTGGAGAAGGAGG + Intronic
1161267180 19:3369752-3369774 CGGTGGCGCCAGCGGGAGGGAGG - Intronic
1161573458 19:5042804-5042826 CGGTGGGGCCGGGTGGGAGGTGG - Intronic
1161589326 19:5121975-5121997 CAGCGTGGACAGGGGGAGGGAGG - Intronic
1161707180 19:5827694-5827716 CAGTGGGTGCAGGGGGTGGGAGG - Intronic
1162018518 19:7858161-7858183 CAGCGAGGACAGGGGGCAGGGGG - Intronic
1162404905 19:10467775-10467797 GGGTGGGGGCAGGGGGAAAGGGG - Exonic
1162664037 19:12194949-12194971 CAGAGGCGCCACGTGGAAGGTGG + Intergenic
1162743468 19:12786347-12786369 CAGTGGGGCCAGCAGGGAGGGGG + Intronic
1163013553 19:14440346-14440368 CTGTGGGGGCAGGCAGAAGGGGG + Intronic
1163173504 19:15549096-15549118 CAGTGGGGCCAAGGGGAGCCAGG - Intronic
1163236351 19:16032650-16032672 CAGTGGGGACTTGGGTAAGGGGG + Intergenic
1163442175 19:17327797-17327819 CAGCGCCGCCAGGGGGAAGGCGG + Exonic
1163577130 19:18117603-18117625 CAGTGGGGCCAGGGTGGGCGTGG + Intronic
1163678576 19:18667915-18667937 CAGCGAGGCCAGGCTGAAGGTGG - Exonic
1163770695 19:19189335-19189357 CAGAGAGGCCAGGGAGAAGGTGG - Intronic
1163771741 19:19195279-19195301 GAGTGGGGAGAGGGGAAAGGAGG - Intronic
1164536172 19:29087898-29087920 CTGTGGGGCCAGGGGGAACAAGG + Intergenic
1164586427 19:29478918-29478940 CAGTGGGGTCTGGGGAAGGGCGG - Intergenic
1164615156 19:29663314-29663336 CAGTGGGGCCATTGGGATGCTGG - Intergenic
1164637078 19:29799432-29799454 CAGAGGGGCCACAGGTAAGGAGG + Intergenic
1164823495 19:31267536-31267558 GAGTGGGGGCAGGGGAAAGAAGG - Intergenic
1164884794 19:31769518-31769540 CTGTTGGGCCAGGGGGTATGTGG + Intergenic
1164974385 19:32560892-32560914 AAGTCTGGCCAGGGAGAAGGGGG + Intergenic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165245589 19:34496718-34496740 GAGTGAGGGCAGGGGGAAGAGGG + Intronic
1165331027 19:35141298-35141320 AAGCGGGGCCAGGGAGAGGGGGG - Intronic
1165712669 19:38023249-38023271 CGGTGGGGCCGGGGGTCAGGGGG + Intronic
1166120628 19:40684373-40684395 CGGCGGGGCGAGGGGGACGGGGG - Intronic
1166306155 19:41938179-41938201 ATCTGGGGCCTGGGGGAAGGAGG - Intergenic
1166562826 19:43744707-43744729 CACTGGGAGCAGGGGCAAGGTGG - Intronic
1166738528 19:45100330-45100352 CAGTAGGGCATGGGGGCAGGTGG + Intronic
1167072815 19:47230631-47230653 CAGTGCGGCCCCGGGGAAGAGGG - Intronic
1167194764 19:48020687-48020709 CAGAGGGCCCTGGAGGAAGGAGG - Intronic
1167383413 19:49150919-49150941 GCGTGGGGGCAGGGGGACGGTGG + Exonic
1167423530 19:49417454-49417476 AGGTGGGGCCAGGTGGGAGGTGG - Exonic
1167427825 19:49438489-49438511 CAGACGGTCCAGGGGGAGGGAGG + Intronic
1167722818 19:51190564-51190586 CAGTGGGGCCAGGTTGAGGCGGG - Intergenic
1167741120 19:51325555-51325577 CCAAGGGGCCAGGGAGAAGGGGG - Intronic
1167761494 19:51452668-51452690 CAGTGGGGCCAGGATGAGGCAGG + Intronic
1167817688 19:51898532-51898554 AAGTGGGGGGTGGGGGAAGGGGG - Intronic
1168166531 19:54552133-54552155 CACAGGGCCCAGGGGGAAGTTGG - Intergenic
1168635236 19:57991029-57991051 CAGTGGGACGAGGGTGCAGGAGG - Intronic
924962836 2:48837-48859 CACTGGGGCCTGGTGGGAGGTGG + Intergenic
925196184 2:1928035-1928057 CACTTGAGCCAGGGGGAATGAGG - Intronic
925278269 2:2665710-2665732 CAGTGAGGCCTTGGGGAAGGAGG - Intergenic
925312070 2:2891884-2891906 AAGTGGGGCCTGGTGGGAGGCGG - Intergenic
925837459 2:7959997-7960019 GTGTGAGGCCTGGGGGAAGGAGG + Intergenic
925846924 2:8043048-8043070 CAGAGGGGCCATGGGGCGGGGGG + Intergenic
926023103 2:9514359-9514381 GGGTGGGGGGAGGGGGAAGGGGG + Intronic
926089918 2:10043272-10043294 CAGCGGCGCCAGGGGCAAGCGGG - Intronic
926124507 2:10263912-10263934 GGGTGGGGGGAGGGGGAAGGGGG + Intergenic
926633851 2:15160576-15160598 CAGTGTGGGCGGGGGGAGGGGGG + Intergenic
926989082 2:18657744-18657766 CAGTGGGGCCGAGGTGCAGGTGG - Intergenic
927244470 2:20945916-20945938 CTGAGGGGCCTGGGGGAAGAGGG - Intergenic
927245260 2:20952388-20952410 CAAATGGGCCAGGGGGAAGCAGG - Intergenic
927704197 2:25286882-25286904 CTGTGGAGACAGGGGAAAGGAGG - Intronic
928013091 2:27629040-27629062 GGGTGGGGCCAGGAGGAAGATGG + Exonic
928020793 2:27703265-27703287 GAGTCGGGCCTGGGGGAGGGAGG - Intergenic
928040646 2:27873027-27873049 CAGTGGGGCCAGGGTAATGATGG + Intronic
928280072 2:29938150-29938172 AAGGGAGGGCAGGGGGAAGGGGG + Intergenic
928332104 2:30365504-30365526 AGGTGGGGCCTGGTGGAAGGTGG + Intergenic
928516640 2:32050476-32050498 GAGCGGGGGCAGGGGGAGGGTGG - Intergenic
929234708 2:39593674-39593696 GGTTGGGGCCATGGGGAAGGAGG + Intergenic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
930122054 2:47768422-47768444 CAGAGGGGCCAGGAGGGTGGTGG - Intronic
931283916 2:60816992-60817014 GGGCGGGGCCAGGGGGGAGGAGG - Intergenic
931882807 2:66583712-66583734 GCGTGGGGCGAGGGAGAAGGAGG + Intergenic
932006898 2:67936518-67936540 CATTGGGGCCTGGGGGGATGGGG + Intergenic
932103617 2:68923544-68923566 GAGTGGGGCCAGATGGAAGACGG - Intergenic
932122318 2:69113180-69113202 CAGCAGGACTAGGGGGAAGGTGG - Intronic
932141091 2:69278839-69278861 CAGTGGTGGCAGTTGGAAGGGGG + Intergenic
932174351 2:69585969-69585991 GGGTGGTGCCAGAGGGAAGGTGG - Intronic
932235037 2:70114175-70114197 CAGAAGGGCCAGGGGCATGGTGG - Intergenic
932336183 2:70932694-70932716 AAGTGGGGGCAGGTGGGAGGAGG - Intronic
932751138 2:74372397-74372419 CTGTGGGGCAGGGGAGAAGGTGG + Intronic
932843599 2:75110917-75110939 CAGTGAGGTTATGGGGAAGGTGG - Intronic
933571859 2:84023278-84023300 CAGTGAGGCCAGGTGCAAGAAGG + Intergenic
934647589 2:96068099-96068121 CAGAGGGGCCATGGGTGAGGGGG + Intergenic
934651329 2:96092735-96092757 CTGTGGCGGCCGGGGGAAGGTGG + Intergenic
934840965 2:97623919-97623941 CAGAGGGGCCATGGGTGAGGGGG + Intergenic
935071781 2:99700796-99700818 AGATGGGGACAGGGGGAAGGAGG + Intronic
935296671 2:101655988-101656010 AAGTGGGGCCAGGGGGAGGGGGG - Intergenic
936092867 2:109512202-109512224 CAGTGGGGCCAGGGCCCAGCAGG - Intergenic
936173429 2:110197114-110197136 CACTGGGGCCTGTAGGAAGGAGG + Intronic
936523527 2:113227378-113227400 GAGTGGGGGCAGGAGGAAGTGGG - Intronic
936925782 2:117735307-117735329 AAGTGGGGAGAGAGGGAAGGAGG + Intergenic
937255973 2:120555790-120555812 CAGGTGGCCCAGGGGCAAGGAGG + Intergenic
937672982 2:124558398-124558420 TGGTGGGGGCAGGGTGAAGGAGG + Intronic
937968167 2:127530379-127530401 CAGTGGGGTCAGTGGTGAGGTGG + Intergenic
938093528 2:128447915-128447937 CAGTGGGGGCAGGTGGGGGGCGG + Intergenic
938093568 2:128448027-128448049 CAGTGGGGGCAGGTGGGGGGCGG + Intergenic
938093595 2:128448101-128448123 CAGTGGGGGCAGGTGGTGGGCGG + Intergenic
938574255 2:132589214-132589236 CAGAGGGGCAATGGGGAGGGGGG - Intronic
938973735 2:136456247-136456269 CAGTGGGGCCAGGAGGGTGGCGG - Intergenic
939243470 2:139593311-139593333 AGGTGGGGCCTGGTGGAAGGTGG + Intergenic
939629175 2:144513971-144513993 GAGTGGGGTGAGGGGGAAGGAGG - Intronic
940213112 2:151276051-151276073 TTGGGGGGTCAGGGGGAAGGAGG + Intronic
942584509 2:177460150-177460172 CAGTGGGGCCTGGGGCGCGGTGG + Intronic
942590472 2:177540465-177540487 AAGTGGGGGCTGGGGGTAGGGGG - Exonic
942650616 2:178163553-178163575 AAGTGGGGAAAGAGGGAAGGAGG + Intergenic
943046460 2:182867000-182867022 CAGAGGGGTTGGGGGGAAGGAGG + Exonic
945240999 2:207676891-207676913 CAGGGGGGCCAGGGGGAATCAGG - Intergenic
946325136 2:218981150-218981172 GTGTGGGGACAGGAGGAAGGGGG + Exonic
946410698 2:219513815-219513837 CAGAGGGGGCAGGGGCATGGTGG + Intergenic
946413267 2:219526281-219526303 GAGAGGGGCCAGGGAGAAGGAGG + Intronic
946510441 2:220349920-220349942 TTGTGGGGCATGGGGGAAGGGGG + Intergenic
946519034 2:220446500-220446522 AAGTGGGGAAAGAGGGAAGGAGG - Intergenic
947429143 2:230010377-230010399 CAGTGGGGTGGGGGTGAAGGTGG + Intronic
947514009 2:230785380-230785402 CAGGGGGGCAGGGGGGCAGGGGG + Intronic
948046530 2:234950521-234950543 CAGTGAGGCGAAGGGGCAGGTGG - Intergenic
948266309 2:236637682-236637704 GTGTGGGGGCAGGGGGAAGATGG - Intergenic
948321609 2:237074122-237074144 AAGTGGGGCCTGGTGGGAGGTGG + Intergenic
948698175 2:239744262-239744284 CAGTGGGCACAGATGGAAGGAGG + Intergenic
948874031 2:240818035-240818057 CAGTGGGGAAGGGGGAAAGGAGG + Intronic
948936367 2:241167544-241167566 CAGGGAGGCCAGGGTGCAGGAGG - Intronic
949040963 2:241849839-241849861 CTGTGGGGGCAGTGGGCAGGAGG - Intergenic
1168796417 20:612671-612693 CAGGGGGGCCAGGAAGAAGTGGG - Intergenic
1169118831 20:3083543-3083565 CAGCAGGGCGAGGAGGAAGGAGG - Intronic
1169403132 20:5300836-5300858 CTCTGGGGTCAGGGGGAAAGAGG - Intergenic
1170469819 20:16657222-16657244 CACTGGGGCCTGTCGGAAGGTGG - Intergenic
1170587485 20:17745696-17745718 GGGTGGGGGCAGGGGGAATGAGG + Intergenic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1172017791 20:31888927-31888949 AAGTGGGGCCTGGTGGGAGGTGG - Intronic
1172126427 20:32627523-32627545 CTGGGGGGCCAGGGCGAAAGTGG - Intergenic
1172170590 20:32929347-32929369 CACCGGGGCCAGTGGGAAGCAGG + Intronic
1172271939 20:33659814-33659836 GAGCGGGCCCTGGGGGAAGGGGG + Intronic
1172577111 20:36017931-36017953 TAGTGGGGGCAGGGGGAGTGTGG - Intronic
1172597248 20:36157834-36157856 CAGTGGGGACTGGGCTAAGGAGG + Intronic
1172608214 20:36230064-36230086 GGGTGGGGGAAGGGGGAAGGGGG - Exonic
1172628597 20:36363314-36363336 CAGTGAGGCCATGGGGAGTGTGG + Intronic
1172870205 20:38131050-38131072 CTTTGGGGCCTGGGGGAAGCGGG - Intronic
1172997869 20:39084004-39084026 CAGTGGGGCTGGGGGCAGGGTGG + Intergenic
1173090819 20:39969323-39969345 CACTGGGGCCAGTTGGGAGGTGG - Intergenic
1173120824 20:40287408-40287430 GAGAGGTGCCAGGGGGAAGGAGG - Intergenic
1173317699 20:41959887-41959909 GAGTGGGGCCAGGAGGGAGCTGG - Intergenic
1173840666 20:46154698-46154720 CAGTTGGGCCTGTGGGGAGGAGG + Intergenic
1173847582 20:46197855-46197877 CAGTGGGGCCTGGGAAATGGGGG + Intronic
1174045467 20:47729756-47729778 CAGAGGGGCCAGGGTGGATGGGG + Intronic
1174881952 20:54289497-54289519 CTGTGGGGCCTTGGGGAAGGGGG + Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175182986 20:57161584-57161606 CTCTGGGGTCAGGAGGAAGGAGG - Intergenic
1175224885 20:57439238-57439260 CAGAGGGGTCAGGGGGTAGGAGG - Intergenic
1175224923 20:57439326-57439348 CAGAGGGGTCAGGGGGATGGGGG - Intergenic
1175237584 20:57525228-57525250 CTGTGGGGGCAGGGGGGAAGGGG + Intronic
1175260831 20:57673138-57673160 CAGTGCGGCCAGGGTGCTGGCGG - Intronic
1175326362 20:58131319-58131341 CGGTGGGGGGAGGAGGAAGGAGG - Intergenic
1175873104 20:62217556-62217578 TGGTGGGGGCAGGGGGCAGGAGG + Intronic
1175948905 20:62571951-62571973 AAGTGGGGCCTGTGGGAAGGCGG + Intergenic
1176061266 20:63173942-63173964 CACTGGGGCCAGGGAGGAGGGGG + Intergenic
1176130610 20:63495218-63495240 CACTGGGGCCTTGGGGAGGGAGG + Intronic
1176139394 20:63538353-63538375 CAGTAGGGTCAGTGGGAGGGTGG - Intergenic
1176239134 20:64067887-64067909 CAGGGGAGCCAGGGGCCAGGAGG - Intronic
1176302840 21:5106984-5107006 CGGTGGGGGCGAGGGGAAGGCGG - Intergenic
1176985429 21:15431009-15431031 CAGGTGGGACTGGGGGAAGGGGG - Intergenic
1177205490 21:18005816-18005838 CACTGGGGCCTGTGGGATGGAGG + Intronic
1177931997 21:27296777-27296799 GGGTGGGGCCAGGGGCCAGGTGG + Intergenic
1178584408 21:33860382-33860404 CAGTGGGGGCTGGGGGAGGCGGG + Intronic
1178610754 21:34077044-34077066 CAGGGGGGGCAGGGTGGAGGTGG - Intronic
1178824654 21:36005007-36005029 CAGGGGGGGCAGGGGAAAGGGGG + Intergenic
1178894140 21:36544677-36544699 CAGTCGGGTCAGCAGGAAGGAGG - Intronic
1179571731 21:42282547-42282569 CAGTGGTCCCAGATGGAAGGAGG - Intronic
1179854184 21:44154939-44154961 CGGTGGGGGCGAGGGGAAGGCGG + Intergenic
1179880284 21:44290766-44290788 CAGTGGGGCCAGGCCCAGGGAGG - Intronic
1180090343 21:45531005-45531027 CTGGGGGGCCACGGGGCAGGGGG + Intronic
1180229835 21:46420605-46420627 CAGTGGGACAATGGGGAATGTGG + Intronic
1180305044 22:11067087-11067109 CTGTGGGGGAAAGGGGAAGGTGG + Intergenic
1180835262 22:18926524-18926546 GGGAGGGGCCAGGGGGAATGGGG - Intronic
1181172153 22:21015796-21015818 AAGTGGGGCCAGAGAGGAGGTGG + Intronic
1181467038 22:23115910-23115932 CACAGGGCCCAGGGGGTAGGGGG - Intronic
1181494309 22:23279406-23279428 CAGTGGGACCAGGAGCAAGGAGG - Intronic
1181506108 22:23358757-23358779 TATTGGGGTCTGGGGGAAGGAGG + Intergenic
1181644940 22:24226051-24226073 GCGTAGGGCCTGGGGGAAGGCGG - Intronic
1181805453 22:25372104-25372126 CAGTCAGGCCCGGGGGATGGAGG - Intronic
1181847500 22:25723599-25723621 CAGTGGGGCCTGGAGGCAGTGGG - Exonic
1181920155 22:26314408-26314430 CAGTGTGGCCAGCAAGAAGGGGG + Intronic
1182446588 22:30393242-30393264 CTGTGGTGCCAGGGGGAAGGGGG - Intronic
1183000875 22:34857605-34857627 CACTGGGGCCTGAGGGGAGGTGG - Intergenic
1183096290 22:35554188-35554210 CAGGAGGGCCAGGCTGAAGGAGG - Intergenic
1183255054 22:36756681-36756703 TACTAGGGCCATGGGGAAGGGGG + Intergenic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1183475862 22:38035427-38035449 CAGTGGGGCAAGTGGGAATCAGG + Intronic
1183543791 22:38444782-38444804 CTGAGGAGCCAGTGGGAAGGTGG - Intronic
1183623139 22:38986492-38986514 CAGTGGGTCAAGAGGGAGGGCGG - Intronic
1183942277 22:41302351-41302373 CAGCCGGGCCCGCGGGAAGGGGG + Intronic
1184021797 22:41826200-41826222 CAGTGGGGCCAGCAGCAGGGTGG - Exonic
1184100593 22:42340001-42340023 CAGCTGGGTCAGGGGGTAGGGGG + Intronic
1184158359 22:42683671-42683693 CAGTGCAGCCAGGGGTGAGGGGG + Intergenic
1184212502 22:43044120-43044142 CAGCGGGGACAGGGAGAAGATGG - Intronic
1184251609 22:43263558-43263580 CGGTGTGTCCCGGGGGAAGGAGG - Intronic
1184294100 22:43512941-43512963 CAGGGGGGCCAGGTGGACAGAGG - Intergenic
1184297555 22:43534643-43534665 ATGTGGGGCCAGGTGGAAAGGGG - Intronic
1184333427 22:43840081-43840103 GAGTGGGGCCAAGGGGAAGGGGG + Intronic
1184351302 22:43945817-43945839 CAGTGGTGCCAGGCGGTGGGTGG + Intronic
1185101794 22:48844579-48844601 CAGCAGGGCCAGGGGCATGGAGG - Intronic
1185134604 22:49062566-49062588 ACCTGGGGCCAGGTGGAAGGCGG - Intergenic
1185134623 22:49062642-49062664 ACCTGGGGCCAGGTGGAAGGGGG - Intergenic
1185173616 22:49307112-49307134 CAGTGAGGCCAGGGCCAAGGGGG + Intergenic
1185274148 22:49943182-49943204 GGCTGGGGCCCGGGGGAAGGAGG + Intergenic
1185281754 22:49972645-49972667 CAGTGGGACCAGGGAGGAGGAGG - Intergenic
1185325111 22:50221719-50221741 CAGTGGGGGCTGGTGGCAGGGGG - Exonic
1203285350 22_KI270734v1_random:151823-151845 GGGAGGGGCCAGGGGGAATGGGG - Intergenic
949606800 3:5662267-5662289 CAGTGGGGTGGGGTGGAAGGAGG - Intergenic
949987278 3:9551341-9551363 AAGTGGGGCCAGGGGATGGGAGG - Intronic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
950145513 3:10647075-10647097 CAATGGGGGTAGGGGGAATGGGG + Intronic
950196268 3:11011261-11011283 CATAGGGGCAAGGGGGAAGCAGG - Intronic
950244669 3:11405274-11405296 CAGTGGGGGCAAGGGGGTGGGGG - Intronic
950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG + Intronic
950883658 3:16344490-16344512 TAGTTGGGCGAGGGGGAAGAAGG - Intronic
951139902 3:19147617-19147639 GAGTGGGGGCTGGGGAAAGGGGG + Intergenic
951506401 3:23449954-23449976 CAGTGGGCCCAGTGGCCAGGAGG - Intronic
951745676 3:25974656-25974678 CAGTGGGACAACTGGGAAGGGGG + Intergenic
951996189 3:28732368-28732390 CACTGGGGCCTGTAGGAAGGTGG - Intergenic
952152629 3:30608426-30608448 CAGAAGAGCCAGGGGAAAGGAGG - Intronic
952406396 3:33008786-33008808 CAAAGGGGCAAGGGGGCAGGTGG + Intronic
953341871 3:42141018-42141040 CTGTGAGGCATGGGGGAAGGTGG + Intronic
953460361 3:43077053-43077075 CCATGGAGCCTGGGGGAAGGAGG + Intergenic
953920675 3:46949261-46949283 CAGTGGGGACAGAGGGACGGAGG + Intronic
953990279 3:47478052-47478074 CAGTGGGCCCAGGGCTCAGGAGG - Intergenic
954107350 3:48416417-48416439 CACCGGGGCCAGTGGGGAGGAGG - Exonic
954150016 3:48652654-48652676 CTGTGGGTCCAGGAGGGAGGGGG - Intronic
954329509 3:49882077-49882099 CAGGGGGGCCATGGAGCAGGAGG - Intergenic
954553674 3:51502363-51502385 CAGTGGAGCAAGGGTGAGGGTGG - Intergenic
954579914 3:51697615-51697637 CACTGAGGCCAGGGGCAGGGAGG - Intronic
955265259 3:57436815-57436837 CTGGGGGGCCAGGGGGCGGGCGG + Intronic
955552726 3:60101325-60101347 CAGTGAGCCCAGGGTGCAGGAGG - Intronic
956129381 3:66039344-66039366 CAGTGGGACCTGCGGCAAGGGGG - Intergenic
956571646 3:70703290-70703312 CAGTGGGGGCGGGGGGGTGGTGG + Intergenic
956761401 3:72447578-72447600 CAGAGGGGCGCGGGGGAACGCGG - Intergenic
956894721 3:73648414-73648436 CACTGGGGCCTTTGGGAAGGAGG - Intergenic
957672824 3:83327592-83327614 GGTTGGGGACAGGGGGAAGGAGG + Intergenic
958586163 3:96091032-96091054 AAGTGGGGCATGGGGGCAGGGGG + Intergenic
959661757 3:108876343-108876365 TATTAGGGCCAGAGGGAAGGGGG + Intergenic
959751376 3:109840318-109840340 CAGTGGGGCAAAGGTGCAGGGGG - Intergenic
959983566 3:112546832-112546854 CAGTGGGGCGGGGGGAAAGAAGG + Intronic
961117303 3:124341535-124341557 AAGTGGGGCAGTGGGGAAGGTGG + Intronic
961138421 3:124534358-124534380 CACTGGGGCCAGTGGGGACGTGG + Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961324273 3:126101089-126101111 CACTTGGACCCGGGGGAAGGAGG - Intronic
961471460 3:127115754-127115776 GAGTGGGGACAGGGGCAAGAAGG + Intergenic
961491013 3:127257020-127257042 CAGGGTGGCCAGGGAGGAGGCGG - Intergenic
961514836 3:127426027-127426049 CAGTGAGTCCTGGGGGAAGCTGG + Intergenic
962267910 3:133956376-133956398 CAGTGGGGCCAGGCTGGACGAGG - Intronic
962403391 3:135080317-135080339 AAGTAGGGCCAGAGAGAAGGGGG + Intronic
962625360 3:137220578-137220600 CACTGGGGCCTGTGGGGAGGGGG + Intergenic
962708232 3:138064871-138064893 CAGAAGGGCCAGGAGGAAGAAGG + Intronic
963015198 3:140817269-140817291 CAGTGGGGGCAGGGGGCATATGG + Intergenic
963271166 3:143287080-143287102 AAGTGGGACCAGAAGGAAGGAGG - Intronic
965527617 3:169738201-169738223 TAGTGGGGGCAGGGGGAGGTTGG + Intergenic
965612787 3:170562485-170562507 CAGTGGGGAGGGTGGGAAGGGGG + Intronic
965615297 3:170586202-170586224 CAGGGGGGCCAGGTGGGAGGTGG - Intronic
965700938 3:171459158-171459180 CAGTGGGGCTGGGGGGAGGGAGG + Intronic
966480344 3:180401328-180401350 GAGTGGGGTCAGGGGGATGGAGG - Intergenic
967072139 3:185971497-185971519 CAGTGGGGAGAGGGGGTAGAGGG + Intergenic
967136973 3:186520788-186520810 CAGTGGGGTGAGGTGGAATGCGG + Intergenic
967214913 3:187201568-187201590 CAGTGGGGTCAGGGGGCAGAAGG - Intergenic
967288598 3:187897589-187897611 CAGAGGGGGCAGGGGGTACGGGG - Intergenic
967897226 3:194407532-194407554 CAGCGGGGCCAGGGAGGAGAGGG - Intronic
968077645 3:195825226-195825248 CTCTGGGGCCAGAGGGAAGCTGG - Intergenic
968135649 3:196217791-196217813 CCATGGGGGCTGGGGGAAGGGGG - Intronic
968394768 4:224697-224719 AAGTGGGGCCTGGTGGGAGGTGG + Intergenic
968516317 4:1017117-1017139 CTGAGTGGCCTGGGGGAAGGGGG - Intronic
968529707 4:1084959-1084981 CCGTGGGGCCTGTGGGAAGCTGG - Intronic
968657195 4:1783712-1783734 CTGTGGGGCCAGGGAGGAAGTGG + Intergenic
968708459 4:2095177-2095199 TATTGGGGCTAGGGGGTAGGGGG + Intronic
968966141 4:3769931-3769953 CAGTGGGGGCAGGGGAGGGGTGG + Intergenic
968970055 4:3789018-3789040 CATGGGGGGCAGGGGAAAGGGGG + Intergenic
968985287 4:3871566-3871588 CGGTGTGGCCAGGAGGGAGGTGG - Intergenic
969338781 4:6527757-6527779 TGGTGGGGCCTGTGGGAAGGGGG - Intronic
969365196 4:6690125-6690147 CAGAGAGGCCAGGAGGAGGGCGG - Intergenic
970073839 4:12195397-12195419 CAGAGGGGCCAGGATGCAGGAGG + Intergenic
970436928 4:16044827-16044849 CTGAGGGGACAGGGGGAAGTAGG + Intronic
973093671 4:46169910-46169932 CTGTGGGGTGAGGGGGAGGGCGG + Intergenic
973637248 4:52871508-52871530 GAGGGGGGCTTGGGGGAAGGAGG - Intergenic
973781105 4:54288938-54288960 CTGTGGGTCTAGGGGGAGGGAGG + Intronic
973857382 4:55026675-55026697 CACTGGGGCCTGTGGGAGGGTGG + Intergenic
973888463 4:55346407-55346429 CAGTAGGGTCAGCAGGAAGGCGG - Exonic
974047335 4:56908585-56908607 CGGTGGGACCCGGGGGCAGGAGG - Intronic
974901682 4:68007045-68007067 CACTGGGGCCTGTTGGAAGGCGG + Intergenic
975495379 4:75030760-75030782 GAGTGGAGACATGGGGAAGGTGG - Intronic
976569924 4:86595371-86595393 CGGTGGGGCTAGGGGGCCGGAGG - Intronic
976607238 4:86995297-86995319 CCGTGGGGAGAGGGGGAGGGAGG - Intronic
976771132 4:88653635-88653657 TAGTGGGTCAAGGGGGAAGCTGG + Intronic
977570706 4:98626575-98626597 CAGGTGGGCCAGGGGTGAGGAGG - Intronic
978822977 4:112987262-112987284 CAGTGGGGACAGAGGGATGGTGG + Intronic
979194899 4:117909160-117909182 ATGTGGAGCCAGGGAGAAGGAGG - Intergenic
979278074 4:118835746-118835768 TAGTGGGGCCGGCGGGATGGGGG - Intronic
979439453 4:120734105-120734127 CAGAGTGTCCAGGAGGAAGGGGG + Intronic
980563007 4:134502003-134502025 AGGTGGGGGCAGGGGGAAGGGGG - Intergenic
980880826 4:138708564-138708586 CAGTGGGGCCAGGTGAGAGTGGG + Intergenic
981132159 4:141169104-141169126 AAGTGGGGCCTGGTGGGAGGTGG + Intronic
982033688 4:151325442-151325464 CCCTCGGGCCGGGGGGAAGGCGG + Intronic
983782893 4:171695206-171695228 CAGTGGGGCAAGGGGTGATGTGG - Intergenic
984429052 4:179625126-179625148 CAGTAGGCCCTGGGAGAAGGAGG - Intergenic
986321374 5:6634412-6634434 CTGTGGGGGCGGGGGGGAGGGGG + Intronic
986980943 5:13447589-13447611 GAGTGGGTGTAGGGGGAAGGAGG - Intergenic
987216777 5:15745752-15745774 CAGTGGGGTCAGGATGATGGGGG + Intronic
987245163 5:16041525-16041547 CTGTGGGGGCAGAGGGGAGGGGG - Intergenic
988172791 5:27681382-27681404 CAGTGGGGCCTGGAGAAGGGTGG + Intergenic
988492737 5:31718309-31718331 CAGATGGGCCTGGGGGAAGAAGG + Intronic
989167573 5:38446245-38446267 CAGAAAGGCCAGGGAGAAGGAGG - Intronic
989395425 5:40950840-40950862 CAGTGGAGATGGGGGGAAGGTGG + Intronic
989538056 5:42586725-42586747 CAGTGGGGCCTTGGTGAGGGTGG - Intronic
989601289 5:43203085-43203107 CGGTGGGGCTGGGGGGATGGTGG - Intronic
990156253 5:52880930-52880952 TACTGGGGCCAGGAGGCAGGTGG + Intronic
990700453 5:58469597-58469619 CAGGGGGTCGGGGGGGAAGGTGG - Intergenic
990986966 5:61649582-61649604 CAGAGTGCACAGGGGGAAGGTGG - Intronic
992583436 5:78206506-78206528 CAGTAGGGCAAGGAGGAAGAAGG + Intronic
993442794 5:87977637-87977659 TAGTGGGAGCAGGAGGAAGGGGG - Intergenic
993892295 5:93489082-93489104 CAGTGGGGCCTGTTGGAGGGTGG + Intergenic
994691629 5:103026827-103026849 CAGTGGGGCCTAGGGGAAGGTGG + Intronic
995019309 5:107349038-107349060 TAGTGGGGTTAGGGGGAAGTGGG - Intergenic
995829147 5:116334455-116334477 CAGTGGGCCCACAGGGATGGGGG - Intronic
996906028 5:128601403-128601425 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996906040 5:128601432-128601454 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
997642771 5:135460373-135460395 CAGCGTGGCAAGGGGGAAGGAGG - Intergenic
998114703 5:139527281-139527303 CTGTGGGGAGAGGGGGAAGGGGG - Intronic
998253500 5:140568080-140568102 CAATGTGGCCAGGAAGAAGGCGG - Exonic
998451173 5:142235689-142235711 CGGTGGGGCCAGGAGGAAGTGGG - Intergenic
998552012 5:143086908-143086930 CAGTGGAGGTAGGGGGTAGGCGG - Intronic
998680007 5:144456482-144456504 CAGGGGGGTCAGGGGTAGGGAGG + Intronic
999326911 5:150649497-150649519 CAGAGGGACCAGGGGGAGGTAGG + Exonic
999383401 5:151137552-151137574 AAGTGGGGCCTGGTGGGAGGTGG + Intronic
1000570846 5:162912177-162912199 GAGTGGGGCGAGAGGGAAGTGGG - Intergenic
1000695173 5:164371689-164371711 CAGTGGGACAAGATGGAAGGGGG + Intergenic
1000821740 5:165993309-165993331 AAGAGTGGCCAGGAGGAAGGAGG - Intergenic
1001551629 5:172606634-172606656 CAGTGGGGCTAAGGCGGAGGGGG + Intergenic
1001647865 5:173295470-173295492 AAGTAGGGCCATGGGGGAGGGGG + Intergenic
1002081623 5:176740861-176740883 CTGGGGGGCCCCGGGGAAGGCGG + Intergenic
1002133126 5:177093309-177093331 CTGTCGGGCCAGAGGGAAGCGGG - Exonic
1002196285 5:177503458-177503480 CAGTGGGGGCGGGGTGCAGGTGG - Intronic
1002569378 5:180131356-180131378 GAGTGGGGACATGGGGAGGGTGG - Intronic
1002593548 5:180307101-180307123 CTGAGGAGCCAGCGGGAAGGAGG - Intronic
1002601640 5:180357064-180357086 CAGAGGGCCCAGGGGGCTGGGGG + Intergenic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1002723923 5:181282446-181282468 CCGTGGGGGAAAGGGGAAGGTGG + Intergenic
1002879417 6:1238154-1238176 CTGTGGGCCCAGGGGCCAGGTGG + Intergenic
1003148911 6:3532187-3532209 CACCAGGGCCTGGGGGAAGGAGG - Intergenic
1003276340 6:4656380-4656402 AAGAGAGGCCAGGGGTAAGGAGG + Intergenic
1003554704 6:7129313-7129335 TAGTGGGGCAAGGTGGAAGGTGG + Intronic
1003781796 6:9436708-9436730 CACTGGGGCCAGGGGCATTGGGG + Intergenic
1003980013 6:11380576-11380598 CAGTGAGGCCTGGAGGAGGGAGG + Intronic
1004193675 6:13486420-13486442 AAGTGGTGCCAGGAGGCAGGAGG + Intronic
1004314793 6:14576341-14576363 CACTGGGGCCTGTGGGTAGGGGG + Intergenic
1004496372 6:16167017-16167039 CACAAGTGCCAGGGGGAAGGAGG + Intergenic
1004814868 6:19301897-19301919 GTGTGGGGCCGGGGGGAGGGCGG + Intergenic
1004822541 6:19383241-19383263 CAGAGGGGCAGGGGGGCAGGAGG - Intergenic
1004866294 6:19856566-19856588 CAGTGGTGCCAGGAGGAGGGGGG + Intergenic
1005711452 6:28506876-28506898 GAGTGGGGCCGGGGGGATGCAGG - Intronic
1005805227 6:29468320-29468342 CTGTGGAGCCAGAGGAAAGGAGG - Intergenic
1005870860 6:29973849-29973871 CAGTGGTTCCAGGGGCCAGGGGG + Intergenic
1005870862 6:29973856-29973878 TCCAGGGGCCAGGGGGAAGGAGG + Intergenic
1006263167 6:32894158-32894180 AAGAGGGGGAAGGGGGAAGGCGG - Intergenic
1006324776 6:33345507-33345529 GAGTGGGGCCGGGGGAATGGGGG - Intergenic
1006342333 6:33453455-33453477 CAGAGGGGCGGGGGGGGAGGGGG - Exonic
1006450948 6:34105423-34105445 CAGTGGGGCCAAGTGCAATGAGG - Intronic
1006453219 6:34117402-34117424 CAGGGGGGCCTGGGAGAAGGAGG - Intronic
1006519638 6:34563800-34563822 CAGTGGGGCCAGAATGAAGCAGG + Intergenic
1006744233 6:36330309-36330331 CAGGAGGCCAAGGGGGAAGGAGG - Exonic
1007059802 6:38927625-38927647 CAGGGGAGCCAAGGGGAATGGGG - Intronic
1007110500 6:39310861-39310883 AGATGGGGCCAGGGGGATGGGGG - Intronic
1007257455 6:40538783-40538805 GACTGGGGCTGGGGGGAAGGAGG + Intronic
1007341544 6:41194122-41194144 CAGGAGGGACAGGGGAAAGGAGG - Intronic
1007390924 6:41549015-41549037 CAGTGGGGCAAGGTGGCAAGGGG + Intronic
1007487898 6:42194966-42194988 CAGTCGGTGCAGGGGGCAGGTGG + Intergenic
1007747387 6:44051453-44051475 CAGTGGGGCCTGGGGTAGGAGGG + Intergenic
1007825660 6:44598886-44598908 CAGGGAGGCCTGTGGGAAGGAGG + Intergenic
1008437226 6:51490528-51490550 AAGTGGGGCTTGGGGGAAGCTGG - Intergenic
1008572503 6:52829270-52829292 CCGTGGGGGCAGGGGGCCGGGGG + Intergenic
1009842616 6:69095385-69095407 CATGGGGGGCAGGGGGCAGGGGG + Intronic
1009977723 6:70690852-70690874 CAGTGGGGAAGGGGGGAAGGGGG - Intronic
1010004733 6:70983429-70983451 CAGTGGGGCCAGGGTGGAGATGG - Intergenic
1010035151 6:71317315-71317337 TGGTGGGGCCTGGGGAAAGGAGG + Intergenic
1010449528 6:75987449-75987471 GGGTGGGGGCAGGGGGGAGGGGG - Intronic
1011407051 6:87026502-87026524 AAGTGAGGGGAGGGGGAAGGTGG + Intergenic
1011415914 6:87120067-87120089 CACTGGGGCCTGTGGGGAGGGGG - Intergenic
1011582192 6:88881298-88881320 AAGTGGGGGCAGGGGGCAGAGGG + Intronic
1011640409 6:89412104-89412126 CAGCGGGGCCCGGCGGAAGCGGG + Exonic
1011970050 6:93211415-93211437 AAGCGGGGAAAGGGGGAAGGGGG + Intergenic
1011970065 6:93211447-93211469 AAGTGGGGAAAGGGGAAAGGGGG + Intergenic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1012401491 6:98845486-98845508 AAGTGGGGCCAGGGGCCGGGAGG + Intergenic
1013013929 6:106144170-106144192 CTGTGGGGCCTGGGGGTGGGAGG - Intergenic
1013257030 6:108397598-108397620 TAGTGGGGGATGGGGGAAGGTGG - Intronic
1013446699 6:110236042-110236064 CACTGGGGCCTGTTGGAAGGTGG - Intronic
1013786744 6:113789733-113789755 CAGTGAGGCCAGGGAGCAGTGGG - Intergenic
1014165191 6:118216442-118216464 AAGTGGGGGTAGGGGGAAGAAGG - Intronic
1014436379 6:121425265-121425287 GAGTGGGGCCTGTGGGCAGGAGG - Intergenic
1014962487 6:127704295-127704317 GTATGGGGCCAGGAGGAAGGCGG + Intergenic
1016050771 6:139527809-139527831 CAGGGGTGACAGGGGGCAGGTGG + Intergenic
1016243307 6:141956384-141956406 CACTGGGGGTAGGGTGAAGGAGG - Intergenic
1016487786 6:144562362-144562384 CACTGGGGCCTGTAGGAAGGGGG - Intronic
1017493322 6:154962891-154962913 CAGAGGGCACATGGGGAAGGTGG + Intronic
1017717924 6:157225014-157225036 CTGTGGGGCCTGCGGGACGGGGG - Intergenic
1017722938 6:157256849-157256871 CAGTGGGGGCAGCTGGATGGTGG + Intergenic
1017764021 6:157592680-157592702 CAGGGAGGGGAGGGGGAAGGAGG + Intronic
1018247997 6:161840606-161840628 CACTGGGGCCTGGCAGAAGGTGG - Intronic
1018473829 6:164121220-164121242 CAGTGGGGCCAGGGAGGGAGTGG + Intergenic
1018638986 6:165889821-165889843 GAGTGGGGCGAGAGGGAGGGAGG - Intronic
1019311585 7:364437-364459 CAGTGGTGACAGTGGGGAGGGGG - Intergenic
1019423646 7:963164-963186 CAGCGGGGGCAGGTGGTAGGAGG + Intronic
1019438474 7:1033918-1033940 CAGTGGGGACAGTGGGAGGGTGG - Intronic
1019513041 7:1427747-1427769 CCTTGGGGCCAGCGGGACGGAGG - Intergenic
1019566096 7:1679750-1679772 GAGTGTGGCCAGGGGGCAGGGGG - Intergenic
1019601260 7:1884857-1884879 CCGTGGGGCAAGGGGGCAGAGGG + Intronic
1019621317 7:1993822-1993844 GAGTGGGGACAGGTGGGAGGAGG - Intronic
1020051714 7:5086242-5086264 CAGGGGGGCCAGGGACAAGGTGG + Intergenic
1020451292 7:8323270-8323292 CAGTGGAGGAAAGGGGAAGGAGG + Intergenic
1020530160 7:9323094-9323116 AAGGAGGGCCATGGGGAAGGGGG + Intergenic
1020967239 7:14886712-14886734 CAGGTGGGCCAGATGGAAGGTGG - Intronic
1021697123 7:23286339-23286361 GAGGGGGGAGAGGGGGAAGGAGG - Intergenic
1022091147 7:27108795-27108817 CTTTGGGGCCTGGTGGAAGGAGG - Intronic
1022219473 7:28298235-28298257 CACTGGGGCCTGTAGGAAGGTGG - Intergenic
1022251209 7:28610254-28610276 GGGAGGGGCCAGAGGGAAGGCGG + Intronic
1023375736 7:39553174-39553196 CTTTGGGGGCAGGGGGGAGGGGG - Intergenic
1023809567 7:43901658-43901680 CACTGGGGGAAGGGGAAAGGGGG - Intronic
1023864988 7:44234300-44234322 CAGAGGGGGCCGGGTGAAGGTGG - Intronic
1023966333 7:44964904-44964926 CAGGGCTGCCAGGGGGAAGTGGG - Intronic
1023984896 7:45088718-45088740 GAGGGGGGCCAGGGGGATGGGGG + Intronic
1024051179 7:45624338-45624360 TAGGAGGGGCAGGGGGAAGGAGG + Intronic
1024337529 7:48224492-48224514 CAGTGGGGAAAGAGGGAAAGAGG - Intronic
1024606280 7:51025060-51025082 CAATGGGGCCAGAGGGTTGGAGG - Intronic
1025230676 7:57201620-57201642 CAGTGTGGCCAGGAGGAGGCAGG - Intergenic
1026500731 7:70941392-70941414 CACTGGGGCCTGTGGGAGGGTGG + Intergenic
1026727273 7:72879578-72879600 CAGAGGGGCCAGGCGGGAGGTGG + Exonic
1026769707 7:73187882-73187904 GAGTGGGGACAGAAGGAAGGCGG + Intergenic
1026877248 7:73886788-73886810 GACTGGGGCCATGAGGAAGGGGG + Intergenic
1027010575 7:74741264-74741286 GAGTGGGGACAGAAGGAAGGCGG + Intronic
1027077467 7:75204776-75204798 GAGTGGGGACAGAAGGAAGGCGG - Intergenic
1028450586 7:90977758-90977780 CAGAATAGCCAGGGGGAAGGAGG + Intronic
1028872711 7:95786765-95786787 TGGTGGGGCCAAGGGGAAGGAGG - Intronic
1028879577 7:95864973-95864995 TTGTGGGGAAAGGGGGAAGGTGG + Intronic
1029607750 7:101609307-101609329 CTGAGAGGCCAGGAGGAAGGAGG - Intergenic
1029720955 7:102364104-102364126 CAGAGGGGCCGGGCGGGAGGTGG + Exonic
1030894226 7:115037615-115037637 CAGTGGGGAAAGGAGGAGGGTGG + Intergenic
1031047111 7:116903723-116903745 CTGTGGGCCCAGAGGCAAGGTGG + Intronic
1031214600 7:118873951-118873973 GAGTGGGGCTAGAGGGAAGGTGG - Intergenic
1031534846 7:122920710-122920732 CACTGGGGCCTGGTGGGAGGTGG - Intergenic
1031643246 7:124191018-124191040 CAGAGGGGGCAGGGGGATGATGG - Intergenic
1031837137 7:126691457-126691479 CAGTGGTGCCTGGGGGAGTGAGG + Intronic
1031991752 7:128203144-128203166 CAGGAGGGACACGGGGAAGGTGG + Intergenic
1032060148 7:128717278-128717300 CATTGGGCCCAAGGGCAAGGAGG + Intronic
1032358143 7:131229318-131229340 CACTGGGGCCTGTGGGCAGGTGG - Intronic
1032394874 7:131582040-131582062 CAGAGGAGCCAGGAGGGAGGGGG - Intergenic
1032503388 7:132417120-132417142 CTTTGAGGCCAGGGGGAAGCGGG - Intronic
1032548442 7:132762597-132762619 CAGGGGCGCCAGGAGGAAGCAGG + Intergenic
1032794660 7:135268190-135268212 CAGTGGACCCAGGAGGAAGGAGG - Intergenic
1032805352 7:135348688-135348710 CAATGTGGCCTGGGGGAGGGTGG + Intergenic
1032877986 7:136058145-136058167 CAGAGGGGCCATGGGTCAGGTGG + Intergenic
1033239161 7:139663015-139663037 CATGGTGGCCAGTGGGAAGGTGG - Intronic
1033962798 7:146934443-146934465 GGGTGGGGGGAGGGGGAAGGGGG + Intronic
1034693098 7:153029644-153029666 GAGAGGGGGCAGGTGGAAGGTGG - Intergenic
1035587191 8:785632-785654 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587204 8:785666-785688 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587216 8:785700-785722 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587229 8:785734-785756 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587242 8:785768-785790 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587266 8:785836-785858 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035640497 8:1181528-1181550 CAGTGGGGCCGGGTTGAGGGTGG + Intergenic
1036290296 8:7481992-7482014 GGGTGGGGGGAGGGGGAAGGGGG + Intergenic
1036301974 8:7574824-7574846 GGGTGGGGACGGGGGGAAGGGGG - Intergenic
1036692929 8:10956149-10956171 CAGTGCTGCCAGGAGGAAGTAGG + Intronic
1037837674 8:22223877-22223899 CCCTGGGGCCAAAGGGAAGGTGG - Intronic
1037988584 8:23304852-23304874 CAGTGGGGGCACGGGGAACGGGG + Intronic
1038103905 8:24412132-24412154 CAGTGGGGCCAGTTGGAGGGTGG + Intergenic
1038268249 8:26052237-26052259 CAGTGGTGGCGGGGGGAGGGGGG + Intergenic
1038313727 8:26465426-26465448 CAGAGGGACCAGGGGGTGGGAGG - Intronic
1038339740 8:26675327-26675349 AATGGGGGCCAGGGGGAAGGGGG - Intergenic
1038529456 8:28306140-28306162 GAGTGGGGGCAGAGGGCAGGTGG - Intergenic
1038609757 8:29049496-29049518 CAGTGGGGCCAGAGTGAGTGGGG - Intronic
1039311578 8:36322414-36322436 CAGGGCGGCCACGGAGAAGGCGG - Intergenic
1039364436 8:36915632-36915654 CAGTGTGAACAGGGTGAAGGAGG - Intronic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039440959 8:37595067-37595089 CAGAGGGGCTGGGTGGAAGGAGG + Intergenic
1039468076 8:37797601-37797623 GGGTGGGAGCAGGGGGAAGGGGG + Intronic
1039518810 8:38153943-38153965 AGGTGGGGGGAGGGGGAAGGCGG + Intergenic
1039721498 8:40169305-40169327 CAGTGGGGTCAGGGGAAAGTGGG + Intergenic
1039808942 8:41027646-41027668 CAGTGGGGGCAGAGGGAATCTGG - Intergenic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1040462700 8:47664129-47664151 CACTGGGGGCTGGGGGAAGAGGG - Intronic
1040525020 8:48214579-48214601 TTGTGGGGCCAGGGGGGAGTTGG - Intergenic
1040543122 8:48377069-48377091 CTGTGGGGCCTGAGGGAAGCTGG + Intergenic
1041639523 8:60181499-60181521 CACTGGGGCCTGTGGGCAGGTGG + Intergenic
1041793448 8:61721973-61721995 GAGTGGGGACAGGAGGAAGGAGG - Intergenic
1042228438 8:66533593-66533615 TAGAGGGGGCAGGGGGTAGGAGG - Intergenic
1042325739 8:67526023-67526045 GAGCGAGGCGAGGGGGAAGGGGG - Intronic
1042643764 8:70963109-70963131 AGGTGGGGACTGGGGGAAGGGGG - Intergenic
1043853036 8:85235747-85235769 CTGTCCGGCCAGGGGGATGGTGG + Intronic
1044058723 8:87605705-87605727 GGGTGGTGGCAGGGGGAAGGTGG + Intronic
1044277767 8:90322126-90322148 CAGTGGAGTCAGTGGGCAGGAGG + Intergenic
1045056406 8:98371970-98371992 GAGTGGGATCAGGGGGAGGGGGG + Intergenic
1045498966 8:102730562-102730584 CAGTGAGTCCAGGTGGGAGGTGG - Intergenic
1046075424 8:109306634-109306656 CAGTGGGGTCCGGGGGTGGGGGG - Intronic
1046195603 8:110859991-110860013 CAGTGGAGCCAGGGGGAGCCAGG + Intergenic
1046986280 8:120391817-120391839 CAGTTGGGACAGGGGGATGGGGG - Intronic
1047145891 8:122199068-122199090 AAGTGGGGGCGGGGGGGAGGGGG - Intergenic
1047346873 8:124037475-124037497 CAGTGGGGACAGAGGGACAGTGG + Intronic
1047425205 8:124739084-124739106 CAGGGGGGCAGGGGGGCAGGGGG + Intergenic
1048047406 8:130785880-130785902 CAGTGTGGCAAGGGGCAAAGGGG - Intronic
1048248150 8:132831843-132831865 CACTGGGGCCTGTGGGAAGTGGG - Intronic
1048278585 8:133087773-133087795 CAGTGGGGCCAGGCAGCAGGAGG + Intronic
1048510179 8:135055004-135055026 CGGTGGGGCTGGGGGGAAGCTGG - Intergenic
1048836370 8:138522631-138522653 CAGTGGGGTCCTGGGGAGGGAGG - Intergenic
1049003492 8:139840637-139840659 CAGTCGGGCCAGGAGGGTGGCGG + Intronic
1049064315 8:140301004-140301026 CCATGGGTCCATGGGGAAGGTGG - Intronic
1049346832 8:142143697-142143719 CAGAGGAGCCAGTGGGAAGGGGG - Intergenic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049418694 8:142507286-142507308 CTGTGGAGCCAGGAGGACGGAGG + Intronic
1049508928 8:143018268-143018290 CAGCAGGGCCGGGTGGAAGGAGG + Intronic
1049577037 8:143394250-143394272 CTGTGGGGCCAGGGGGCTGTGGG + Intergenic
1049630513 8:143652657-143652679 CAGTGGGGACAGGAGGAGGCAGG + Exonic
1049706213 8:144044051-144044073 GAGTGAGTGCAGGGGGAAGGTGG - Intronic
1049789993 8:144468135-144468157 CAGAGGGGCCACGGAGAGGGGGG - Intronic
1049803133 8:144527321-144527343 GAGCGGGGCCAAGGGAAAGGCGG - Exonic
1050183175 9:2942465-2942487 CAGTTGGGGCAGGGGGACGGTGG - Intergenic
1050460827 9:5875969-5875991 CAGAGGGGCCATGGGGCAGGGGG + Intergenic
1050475364 9:6034979-6035001 CAGTGGGGAGAGGGGGAAGCGGG - Intergenic
1050567382 9:6900480-6900502 CAGTGGAGCCAGGGGCATGGTGG + Intronic
1051278342 9:15418056-15418078 CAGTAGAGACAGGGGGAGGGGGG - Intergenic
1051998008 9:23242707-23242729 CAGTAGGGCCAGGAGGGAGAAGG + Intergenic
1052095334 9:24377102-24377124 AAGTTGGGCCAGGGAGAATGTGG + Intergenic
1052799295 9:32952798-32952820 CAGTAGGGCCTGGTGGGAGGTGG - Intergenic
1052832693 9:33228924-33228946 CAGGGGGTCCAGGCAGAAGGTGG - Intronic
1052856171 9:33407999-33408021 CAGGTGAGCCAGTGGGAAGGTGG + Intergenic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1053015689 9:34660729-34660751 AAGTGGGGCATGGGGGATGGAGG - Intronic
1053117752 9:35520421-35520443 TTGTGGGGCCAGGGTGGAGGAGG - Intronic
1053480547 9:38413434-38413456 CAGTGGGAGGAGGAGGAAGGAGG - Intronic
1053654153 9:40198040-40198062 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1053886072 9:42645877-42645899 CCGTGGGGGAAAGGGGAAGGTGG + Intergenic
1053904542 9:42827216-42827238 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1054225094 9:62453326-62453348 CCGTGGGGGAAAGGGGAAGGTGG + Intergenic
1054366267 9:64344256-64344278 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1054530442 9:66178299-66178321 GAGGGTGGCCAGGGAGAAGGGGG - Intergenic
1054673898 9:67833986-67834008 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1054718693 9:68582367-68582389 CAGGGGGTCCAGGGAGAAGAAGG + Intergenic
1055560225 9:77515011-77515033 CAGTGAGGCCTGGGAGAAGCAGG + Intronic
1056119729 9:83475916-83475938 AAGTGAGGCCTGGGGGGAGGAGG - Intronic
1056251677 9:84754804-84754826 CAGATGGGACAGGAGGAAGGTGG + Intronic
1056763935 9:89433328-89433350 CAGGGGGGCCAGGCGGTCGGTGG + Intronic
1056779089 9:89535914-89535936 AAGTGGGGCCAAGAGGAAGGGGG + Intergenic
1056812688 9:89776625-89776647 CTGTGGGGCAAGGGGGCAGATGG + Intergenic
1057022185 9:91707843-91707865 CAGTGTGGACAGGAGGATGGGGG + Intronic
1057164003 9:92912469-92912491 CAGTGGGATGAGGGGCAAGGAGG + Intergenic
1057316804 9:93974454-93974476 CAATGGGGCCACGGGGGGGGGGG + Intergenic
1057379702 9:94556270-94556292 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1057436414 9:95044842-95044864 CAGTGGGGGAAGGGGGAGAGTGG + Intronic
1058784635 9:108374968-108374990 CAGTGGGGAGAGGGGAAATGGGG - Intergenic
1058860458 9:109113075-109113097 CAGCGGGGCCAGGGGCAGGGCGG + Intronic
1058907753 9:109495510-109495532 GAGTGGGGCCAGGAGCAAGAGGG - Intronic
1059529398 9:115022105-115022127 CAGTGGGGCAAGGGGCCATGTGG - Intronic
1059592144 9:115673107-115673129 AAGTGAGGCGAGGGGGAAAGAGG + Intergenic
1060036593 9:120261331-120261353 CAGAGGGGCCAGGGATAAGGCGG + Intergenic
1060180003 9:121527436-121527458 CAGTGGGGGCTGGGGGCTGGGGG + Intergenic
1060966529 9:127715048-127715070 CAGCGGGGCCAGGGCGAGGTCGG + Exonic
1061213532 9:129207188-129207210 CGGTGGGGCCTGGTGGGAGGTGG - Intergenic
1061246002 9:129401569-129401591 TAGTGGGGCAAGGGGGTGGGAGG + Intergenic
1061633137 9:131886420-131886442 CAGTGGGGGTAGGGAGAAGTGGG - Intronic
1061808665 9:133149857-133149879 CAAGGGAGCCTGGGGGAAGGAGG + Intergenic
1062207087 9:135343180-135343202 CAGTGGGACCTGGTGGAGGGTGG - Intergenic
1062447669 9:136602389-136602411 GGGCGGGGACAGGGGGAAGGCGG + Intergenic
1062519209 9:136950647-136950669 GGCTGGGGCCAGGGGGATGGTGG + Intronic
1062532816 9:137009250-137009272 CTGTGGGGCCAGGGGGGCTGGGG - Intronic
1062588735 9:137263507-137263529 CAGGAGGGCCAGGGGGAAGGAGG - Intronic
1185475664 X:413906-413928 CCGTGGGTCCTGGAGGAAGGAGG - Intergenic
1186342829 X:8661705-8661727 CATGGGGGTCATGGGGAAGGTGG - Intronic
1187077196 X:15947035-15947057 CGGTGGGGGTAGGGGGGAGGCGG + Intergenic
1187449518 X:19384345-19384367 CAGTGGGGACTGGGGGAAGGTGG + Intronic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1187549753 X:20290377-20290399 CAGTGTGGCCAGTGGGATAGTGG + Intergenic
1187577597 X:20574962-20574984 CAGTGTGGCCAGGAATAAGGAGG + Intergenic
1188916024 X:35912079-35912101 CCGTGGGGCACAGGGGAAGGGGG - Intergenic
1189136382 X:38555026-38555048 CAGTGGTGCCTCTGGGAAGGAGG - Intronic
1189332793 X:40153611-40153633 CAGCGAGCCCAGGGGAAAGGGGG - Intronic
1190020230 X:46867637-46867659 CAGTGGGGTGGGGGGGAATGTGG - Intronic
1190120768 X:47657640-47657662 CTGTGGGGCCAGGGAAAAAGAGG + Intronic
1191840958 X:65513385-65513407 GAGCAGGGCCAGGGAGAAGGAGG - Intronic
1191932370 X:66388302-66388324 GGGTGGGGGAAGGGGGAAGGGGG - Intergenic
1192214592 X:69149931-69149953 CAGCGGCGACAGGGAGAAGGGGG + Intergenic
1192296442 X:69854164-69854186 CAGTGGGGCCTGTCGGAAGGTGG - Intronic
1192448967 X:71230913-71230935 AAGAGGGGGAAGGGGGAAGGGGG + Intergenic
1193594459 X:83429345-83429367 CAGTGGGGCCTGGAAGGAGGTGG + Intergenic
1193912469 X:87322881-87322903 GGGTGGGGCGAGGGGGGAGGGGG + Intergenic
1193986410 X:88246172-88246194 CAGTGGGTCTAGTGGGAGGGTGG - Intergenic
1194729428 X:97436608-97436630 CAGTGAGGCCTGGGGAAATGTGG - Intronic
1195218317 X:102721917-102721939 CAGTGGGTGCATGGGGTAGGGGG - Intronic
1196038002 X:111167961-111167983 TAGTGGGGCCCAGAGGAAGGAGG - Intronic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1197256861 X:124272887-124272909 CACTGGGGCCATGGGGAAGGTGG + Intronic
1197812228 X:130455509-130455531 CAAAGGGGGCAGGGGGAGGGGGG - Intergenic
1197871839 X:131068677-131068699 CAGTGGGGCTCGGGGGGTGGGGG - Intronic
1198338846 X:135693876-135693898 CAGTGGGGCCAAGGAGGAGCAGG - Intergenic
1198522913 X:137470980-137471002 CATTGGAGGCAGGAGGAAGGGGG - Intergenic
1199136751 X:144262449-144262471 GGGTGGGGGGAGGGGGAAGGGGG + Intergenic
1199482958 X:148318072-148318094 CAGTGAAGCCAGGGTGGAGGGGG - Intergenic
1199762135 X:150913029-150913051 CAGTGGGACCAGGGAGCAGCTGG - Intergenic
1199902286 X:152188068-152188090 CACTGGGGCCTTTGGGAAGGTGG + Intronic
1199967965 X:152835455-152835477 CACTGGGGCCTGGGGGGTGGGGG - Intronic
1200118415 X:153779256-153779278 CAATGGGGAGAGGGGGAAGGAGG - Exonic
1201021685 Y:9664908-9664930 GAGTGGGGGGAGGGGGGAGGGGG + Intergenic