ID: 1084606120

View in Genome Browser
Species Human (GRCh38)
Location 11:70173050-70173072
Sequence TTTGGTCACCAGTGGATGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084606120_1084606128 23 Left 1084606120 11:70173050-70173072 CCCAGCATCCACTGGTGACCAAA 0: 1
1: 0
2: 0
3: 20
4: 148
Right 1084606128 11:70173096-70173118 TTCCAAGATAACTTCAACTCTGG 0: 1
1: 0
2: 1
3: 9
4: 155
1084606120_1084606124 0 Left 1084606120 11:70173050-70173072 CCCAGCATCCACTGGTGACCAAA 0: 1
1: 0
2: 0
3: 20
4: 148
Right 1084606124 11:70173073-70173095 TTCACCAATCCTCCACTGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084606120 Original CRISPR TTTGGTCACCAGTGGATGCT GGG (reversed) Intronic
900112274 1:1013411-1013433 TTTGGCCACCAGCGCAGGCTCGG + Exonic
900924002 1:5691777-5691799 TTTTGTCCCCAGGGGATGCTTGG - Intergenic
903787848 1:25873333-25873355 TGTGGTCACCACTGGGTGCCTGG - Intergenic
904309307 1:29617297-29617319 TTTGCTCACCAGTGTATCCCAGG - Intergenic
904407871 1:30305265-30305287 TGTGGTCACCAGATGATGCAGGG - Intergenic
906250646 1:44308323-44308345 TTTTGTCACCTGTGGAGACTGGG - Exonic
911655550 1:100438945-100438967 TTGGGTCAGCAGTGGAGGCTGGG + Intronic
913126122 1:115791991-115792013 TGTGGTGACCACTGGGTGCTAGG + Intergenic
913659649 1:120994858-120994880 TGTGGTCACCAGATGATGCAAGG + Intergenic
914011010 1:143777982-143778004 TGTGGTCACCAGATGATGCAAGG + Intergenic
914166820 1:145183125-145183147 TGTGGTCACCAGATGATGCAAGG - Intergenic
914649630 1:149686637-149686659 TGTGGTCACCAGATGATGCAAGG + Intergenic
920550604 1:206857560-206857582 TATGGTGACCCGGGGATGCTGGG - Intergenic
920711180 1:208296488-208296510 GATGGTCACCAGTGGCAGCTGGG - Intergenic
921334255 1:214070511-214070533 TTTAGTCAAGAGTGGTTGCTGGG - Intergenic
921637120 1:217509446-217509468 ATTGGTCATCACTGGATGATGGG - Intronic
924076171 1:240339448-240339470 CTAGATCCCCAGTGGATGCTTGG - Intronic
924835313 1:247641013-247641035 TTTGGTAACAAATGGATGCAGGG + Intergenic
1063058828 10:2529644-2529666 TTTGGTCACCACCTGTTGCTGGG + Intergenic
1063333365 10:5184912-5184934 TTGGGTAGACAGTGGATGCTTGG - Intergenic
1064618338 10:17187536-17187558 TTTGTTCACCACTGTATCCTTGG - Intronic
1065288909 10:24210728-24210750 TTTGTTCACCACTGGATGTCTGG - Intronic
1066061853 10:31731041-31731063 CTTGGTAACCAGTAGGTGCTAGG + Intergenic
1067027334 10:42855893-42855915 TATTGTCACACGTGGATGCTGGG - Intergenic
1071402718 10:85292205-85292227 TTTGGTCACCATTGGAAACTTGG - Intergenic
1071450870 10:85790576-85790598 ATGGGGCACCAGGGGATGCTGGG + Intronic
1071497171 10:86176700-86176722 ATTGGTCACCAGAGGAGACTTGG - Intronic
1073030300 10:100520245-100520267 TTTGGGCACCAGTTTCTGCTGGG - Intronic
1076751121 10:132543825-132543847 TCTGGTGAACAGTGGATGTTTGG + Intronic
1080519228 11:33052399-33052421 TTTGGTCACAAGGGGAAGTTGGG - Intronic
1081561174 11:44218376-44218398 TTTGGTGAGCAGTGGAAGCTAGG + Intronic
1082683788 11:56212683-56212705 ATAAGTCACCAGTGGAAGCTAGG - Intergenic
1084606120 11:70173050-70173072 TTTGGTCACCAGTGGATGCTGGG - Intronic
1085167696 11:74417992-74418014 GTTGGTCACCAGTCCATGCCTGG - Intergenic
1087845943 11:102972430-102972452 TTTGGTCACCAGCGGTTTCTGGG - Intergenic
1087919811 11:103853792-103853814 TTTGTTGACCAGAGGATCCTTGG + Intergenic
1090867000 11:130709904-130709926 CCTGGTCACCAGTGGATGCCCGG + Intronic
1093122022 12:15282311-15282333 TATGGTCACCAAGGCATGCTGGG + Intronic
1096154478 12:49334391-49334413 CCTGGGCACCAGTGGGTGCTTGG - Intronic
1096528603 12:52229572-52229594 TTTGGTCAGCAGTGTCTCCTGGG - Intergenic
1097264337 12:57737220-57737242 TGCGGTCACGAGTGGATGCTCGG + Exonic
1102218177 12:111176679-111176701 TCAGGTCACCAGTATATGCTGGG + Intronic
1102280465 12:111614845-111614867 GTTGGTCACCTGTGGATGATAGG + Intergenic
1102890043 12:116551683-116551705 TATGGCCACCATTGGAAGCTAGG - Intergenic
1103591809 12:121996758-121996780 TTTGGCCACCAGCAGATGATCGG - Intronic
1104416971 12:128603531-128603553 TCTGGCCAGGAGTGGATGCTGGG + Intronic
1107096418 13:36542117-36542139 TTTTGTCAATAGTGGATGCGAGG + Intergenic
1107668682 13:42719611-42719633 TTTGGTCACAGATGGATGCCTGG - Intergenic
1108614436 13:52117666-52117688 TTTGCTCACCACTTGATCCTTGG - Intronic
1109295660 13:60527235-60527257 TTTGGCCTCCAGTGGCTGTTTGG + Intronic
1119457361 14:74767622-74767644 TTTTGTCTCCAGGGGATACTTGG - Intronic
1119599005 14:75962063-75962085 TATGGTCACAAGTGATTGCTAGG - Intronic
1123426995 15:20180749-20180771 TATTGTCACACGTGGATGCTGGG - Intergenic
1123536224 15:21187258-21187280 TATTGTCACACGTGGATGCTGGG - Intergenic
1127673548 15:61218597-61218619 AGTGGTCATCTGTGGATGCTGGG - Intronic
1127805344 15:62514118-62514140 TTTGGTCACCAGTTGCTTGTTGG + Intronic
1134689599 16:16182605-16182627 TTTGGTCACAGGAGGATGATGGG + Intronic
1136651906 16:31680234-31680256 TCTGGTCACCAGGTGTTGCTTGG - Intergenic
1136857303 16:33669087-33669109 TATTGTCACACGTGGATGCTGGG + Intergenic
1139133450 16:64173833-64173855 TTTGCTCCCCAGGGGATACTTGG - Intergenic
1140989129 16:80191287-80191309 TTTGTTCACCAGGGCATGCCTGG + Intergenic
1203118876 16_KI270728v1_random:1517578-1517600 TATTGTCACACGTGGATGCTGGG + Intergenic
1143432923 17:6900097-6900119 TTTGTTCACCAGAGGATGTGAGG - Intronic
1145866675 17:28246395-28246417 TTTGGGCACCAGAGCAGGCTTGG - Intergenic
1147654636 17:42081886-42081908 TCTGGGCACCTGTTGATGCTGGG - Intergenic
1147925441 17:43942727-43942749 TTTGGGCACCAGAGCAGGCTTGG + Intergenic
1148583798 17:48762381-48762403 GGAGGTCACCAGAGGATGCTCGG + Exonic
1148714235 17:49704359-49704381 TTTGGTCACAGGTGGAAGGTGGG + Intronic
1148822978 17:50371282-50371304 TTTGGTGAGCAGTGGATGAGTGG - Intronic
1152717591 17:81907382-81907404 TTGGCTCACTGGTGGATGCTGGG - Intronic
1153166754 18:2270241-2270263 GTTGGGTACCAGTGGATGCTAGG - Intergenic
1158925815 18:62258348-62258370 TTTGCTCATCAGTGGATACATGG + Intronic
1160389902 18:78522065-78522087 GATGGTCCCCAGTGGCTGCTTGG - Intergenic
1160421787 18:78753093-78753115 TTTGCTGACCAGTGGATGGTTGG - Intergenic
1160421795 18:78753142-78753164 TTTGCTGACCAGTGGATGGTTGG - Intergenic
1160421802 18:78753191-78753213 TTTGCTGACCAGTGGATGGTTGG - Intergenic
1160421810 18:78753240-78753262 TTTGCTGACCAGTGGACGGTTGG - Intergenic
1160421818 18:78753289-78753311 TTTGCTGACCAGTGGACGGTTGG - Intergenic
1160421835 18:78753387-78753409 TTTGCTGACCAGTGGACGGTTGG - Intergenic
1160421843 18:78753436-78753458 TTTGCTGACCAGTGGATGGTTGG - Intergenic
1160858265 19:1227030-1227052 TTTGAGCACCAGTGGGTGGTGGG + Intronic
1160911607 19:1476454-1476476 TTCGGTCACCTGAGGGTGCTGGG - Intronic
1161145769 19:2677313-2677335 TCTGGTCCCCAGGGGATGCTAGG + Intronic
1163112465 19:15170004-15170026 TGGGGTCCCCAGTGGATGATGGG - Intronic
1164097054 19:22021072-22021094 TTAGGTCATCAGTGCAGGCTGGG + Intergenic
1164117225 19:22234294-22234316 TTAGGTCATCAGTGCAGGCTGGG + Intergenic
1164157913 19:22607638-22607660 TTTGTTCACCAGAGCAGGCTGGG + Intergenic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1166464839 19:43023110-43023132 TTTGGCCACCAGAGGGTTCTCGG - Intronic
1167431747 19:49459126-49459148 CATGGTCTCGAGTGGATGCTGGG - Intronic
925874584 2:8301074-8301096 TATGCTCACCATTGGATGCAAGG - Intergenic
930110989 2:47678356-47678378 AATGGTCACCAGAGGTTGCTTGG + Intergenic
932480181 2:72034502-72034524 CTCGGTCACCCTTGGATGCTGGG + Intergenic
932704221 2:74010605-74010627 ATTGGTCTCCAGTGGAACCTGGG + Intronic
935533245 2:104261374-104261396 CCTGGTCACCTGTGCATGCTAGG - Intergenic
935712292 2:105909800-105909822 TTTGATGACCAGAGGAGGCTGGG + Intergenic
937974967 2:127576963-127576985 TTTGGTCCCCACTGGATGACAGG + Intronic
938207051 2:129432620-129432642 GTGCGTCACCAGTGCATGCTGGG + Intergenic
940397700 2:153210874-153210896 TTTGATCCTCAGTAGATGCTTGG + Intergenic
940770611 2:157835835-157835857 TCTGTTCACTAGAGGATGCTTGG - Intronic
948971230 2:241428807-241428829 TCTGGATACCAGTGGTTGCTGGG - Intronic
1168998511 20:2149786-2149808 GTTGGTGCCCAGTGGCTGCTGGG + Intronic
1169947515 20:11005032-11005054 TGTGGTTTCCAGTGGATACTAGG - Intergenic
1170595470 20:17802269-17802291 CATGGTCAGCAGTTGATGCTGGG - Intergenic
1171457537 20:25280519-25280541 TCTGTTCAGCAGAGGATGCTTGG + Intronic
1171982694 20:31638643-31638665 TTTGCTCCCCAGAGGAAGCTGGG - Intronic
1172617377 20:36298208-36298230 TGGGGTCACCAGAGGATGCACGG + Intergenic
1176107804 20:63397791-63397813 CTGGGTCACCATGGGATGCTGGG + Intergenic
1177799532 21:25814450-25814472 TTTATCCACCAGTGGACGCTTGG - Intergenic
1178490087 21:33044427-33044449 TTTGTCCCCCAGGGGATGCTTGG - Intergenic
1180053259 21:45343415-45343437 CTTGCTCACCCGTGGATCCTGGG - Intergenic
1184644121 22:45886892-45886914 TTTGATCACCATGGGATCCTTGG + Intergenic
952967439 3:38630067-38630089 TTTGATCCCCAGGGGATTCTTGG - Intronic
953607864 3:44423803-44423825 TGTGGCCACCAGGGGATGCTGGG - Intergenic
954880811 3:53834853-53834875 TTGGGTGACCAGTGAAAGCTAGG - Intronic
960402067 3:117212965-117212987 TGTGGTCACCAGAAGATGGTGGG + Intergenic
961429095 3:126867734-126867756 CTTGGTCACCAGTGGATTGGGGG - Intronic
961642145 3:128371470-128371492 TTTGGTCCCCAGGGGACACTTGG - Intronic
962306858 3:134295277-134295299 TTTGCTCACCAGTGTATCCTTGG - Intergenic
963726998 3:148934103-148934125 ATTGGTAACCAGTGGGTGCTTGG + Intergenic
967536748 3:190613603-190613625 TTTAGTCACCTGTGCATGGTTGG - Intronic
971612208 4:28740190-28740212 TTTGGTCACCAGATAATTCTAGG - Intergenic
977482127 4:97592732-97592754 TTTGGCCACCAGTGACTCCTGGG + Intronic
980506084 4:133724025-133724047 ATTGGTCATCAATGGATGCATGG + Intergenic
988476984 5:31595248-31595270 TTTGGTAACCATTGGATGTGAGG + Intergenic
989228319 5:39056229-39056251 TTTGTTCACCATTGCATCCTTGG - Intronic
991947451 5:71913374-71913396 ATTACTCACCAGTGGATCCTGGG - Intergenic
996337854 5:122404164-122404186 TTTTGTCACCAATGGTTTCTCGG - Intronic
997709172 5:135989251-135989273 TTTGGTCACCTGTGGCTGTGGGG + Intergenic
998627348 5:143860622-143860644 ATTGTTCACCACTGGATCCTGGG + Intergenic
999225452 5:150019471-150019493 TGTTGTCACCTGTGTATGCTTGG + Intronic
1001921526 5:175603955-175603977 TCTGGTGCCTAGTGGATGCTTGG - Intergenic
1004005622 6:11634823-11634845 TCTGGGCACCAGAGGATGCCTGG + Intergenic
1004212335 6:13661883-13661905 TTTCGTCATCAGTTGTTGCTGGG - Intronic
1007140376 6:39567567-39567589 TTTGGTATCCACTGGATGCTAGG - Intronic
1007317817 6:41003459-41003481 TGTTCTCACCAGTGGATGTTGGG - Intergenic
1010382079 6:75236863-75236885 TTTGTTCACCAGTGATTCCTAGG + Intergenic
1011672693 6:89698763-89698785 TTTAGTCACCACTCTATGCTAGG + Intronic
1012412464 6:98974656-98974678 CTTGGTCACCTTTGGATGATAGG - Intergenic
1017642129 6:156504671-156504693 CTTGGAAACCAGAGGATGCTGGG - Intergenic
1024326931 7:48116204-48116226 ACTGGTCACCGGTGGATGCAGGG + Intergenic
1024326948 7:48116288-48116310 ACTGGTCACCAGTGGATGTAGGG + Intergenic
1024326989 7:48116503-48116525 GCTGGTCACCAGTGGATGTAGGG + Intergenic
1026596250 7:71736399-71736421 TTGGGTCATCTGTGGTTGCTGGG - Intergenic
1028467111 7:91164872-91164894 TTGGATCACCAGGGGATACTGGG - Intronic
1028985956 7:97008070-97008092 TTTGGTCACAAAAGGATTCTAGG - Intronic
1029634226 7:101773208-101773230 TTTTCTCACCTGTGGATGATGGG - Intergenic
1031077639 7:117228156-117228178 AATGGACTCCAGTGGATGCTTGG - Intronic
1032403738 7:131641168-131641190 TTAGGTCTCTAGTGGATTCTGGG + Intergenic
1033560308 7:142524618-142524640 ATTGGTGACCAGTGGAAGGTGGG - Intergenic
1034404911 7:150896793-150896815 CCGGGTCACCAGTGGAAGCTGGG + Intergenic
1034564760 7:151904348-151904370 TTGGGTCACCGATGGCTGCTGGG + Intergenic
1035528802 8:335374-335396 TTTGGTGACCAGCGGAAACTAGG + Intergenic
1037567492 8:20130068-20130090 TGTGGCCACAAGTGGGTGCTGGG + Intergenic
1037885954 8:22596458-22596480 GTTGGTCAGCAGAGGAGGCTGGG + Intronic
1038331880 8:26615477-26615499 TTCAGTGTCCAGTGGATGCTGGG + Intronic
1041209754 8:55537159-55537181 TGTGGTAACCAGTTGGTGCTTGG - Exonic
1043884784 8:85586756-85586778 TTTTGTCACCATTTGATGCTGGG - Intergenic
1045844598 8:106618701-106618723 TTTTGTCACCACTGTATTCTGGG + Intronic
1048166151 8:132063052-132063074 TTTGGTGTCCAGGGGATGTTTGG - Intronic
1048700376 8:137082017-137082039 TCTGGTTACCAGGGGATGCAAGG - Intergenic
1057382473 9:94581607-94581629 TTTTGTCCCATGTGGATGCTGGG - Intronic
1060939583 9:127535783-127535805 TTTGCTCACCACTGGATCCTGGG + Intronic
1185629916 X:1508287-1508309 TGTGGTCCCCAGGGGACGCTGGG + Intronic
1192788059 X:74354099-74354121 TGTGGTGACCAGTTGGTGCTGGG - Intergenic
1193274837 X:79573112-79573134 TTAGGTAATGAGTGGATGCTGGG + Intergenic
1195212283 X:102661177-102661199 CTTGGTACCCAGTGGATGCATGG - Intergenic
1198765673 X:140077177-140077199 ATTGGTCCCAAGTGGATGCCAGG + Intergenic
1198928500 X:141825800-141825822 ATTGGTCACCAGGTGATGCAGGG + Intergenic