ID: 1084606199

View in Genome Browser
Species Human (GRCh38)
Location 11:70173557-70173579
Sequence CCATGGCCAGAGGTGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 593
Summary {0: 1, 1: 0, 2: 5, 3: 64, 4: 523}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084606190_1084606199 -5 Left 1084606190 11:70173539-70173561 CCCTCATACCACAGCCCTCCATG 0: 1
1: 0
2: 0
3: 26
4: 226
Right 1084606199 11:70173557-70173579 CCATGGCCAGAGGTGGAGCAAGG 0: 1
1: 0
2: 5
3: 64
4: 523
1084606185_1084606199 14 Left 1084606185 11:70173520-70173542 CCACGGGTGAGCCCCTTGCCCCT 0: 1
1: 0
2: 0
3: 24
4: 297
Right 1084606199 11:70173557-70173579 CCATGGCCAGAGGTGGAGCAAGG 0: 1
1: 0
2: 5
3: 64
4: 523
1084606186_1084606199 3 Left 1084606186 11:70173531-70173553 CCCCTTGCCCCTCATACCACAGC 0: 1
1: 0
2: 1
3: 30
4: 381
Right 1084606199 11:70173557-70173579 CCATGGCCAGAGGTGGAGCAAGG 0: 1
1: 0
2: 5
3: 64
4: 523
1084606191_1084606199 -6 Left 1084606191 11:70173540-70173562 CCTCATACCACAGCCCTCCATGG 0: 1
1: 0
2: 1
3: 33
4: 335
Right 1084606199 11:70173557-70173579 CCATGGCCAGAGGTGGAGCAAGG 0: 1
1: 0
2: 5
3: 64
4: 523
1084606188_1084606199 1 Left 1084606188 11:70173533-70173555 CCTTGCCCCTCATACCACAGCCC 0: 1
1: 0
2: 0
3: 40
4: 466
Right 1084606199 11:70173557-70173579 CCATGGCCAGAGGTGGAGCAAGG 0: 1
1: 0
2: 5
3: 64
4: 523
1084606187_1084606199 2 Left 1084606187 11:70173532-70173554 CCCTTGCCCCTCATACCACAGCC 0: 1
1: 0
2: 0
3: 25
4: 280
Right 1084606199 11:70173557-70173579 CCATGGCCAGAGGTGGAGCAAGG 0: 1
1: 0
2: 5
3: 64
4: 523
1084606189_1084606199 -4 Left 1084606189 11:70173538-70173560 CCCCTCATACCACAGCCCTCCAT 0: 1
1: 0
2: 5
3: 29
4: 247
Right 1084606199 11:70173557-70173579 CCATGGCCAGAGGTGGAGCAAGG 0: 1
1: 0
2: 5
3: 64
4: 523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084606199 Original CRISPR CCATGGCCAGAGGTGGAGCA AGG Intronic
900310721 1:2032051-2032073 CAGGGGCCAGAGGTGGAACACGG - Intergenic
900612320 1:3549354-3549376 CCATGGCCACAGGCAGACCAGGG + Intronic
900685770 1:3946668-3946690 CCAGGGCCAGACCTGGTGCATGG + Intergenic
900761740 1:4477186-4477208 CTATGGTGAGAGGAGGAGCAGGG - Intergenic
900996557 1:6126294-6126316 CCATACCCAGAGGTGGAGGGTGG - Intronic
901020273 1:6251766-6251788 CCATGGAGAGAAGTGGGGCATGG + Intronic
901635582 1:10668713-10668735 CCAGGGCCAGAGCTAGCGCAGGG - Intronic
901691872 1:10978903-10978925 CCATGGCCAGGGGTGCAGGCTGG + Intronic
901778696 1:11578195-11578217 CCATGTTCAGGGGTGGAGAATGG + Intergenic
902043032 1:13506169-13506191 CCCAGGGAAGAGGTGGAGCATGG + Intronic
902658112 1:17883363-17883385 CTAAGCCCAGGGGTGGAGCAGGG + Intergenic
903771332 1:25766286-25766308 CCAAGGCCAGGGGAGGAGGAAGG - Intronic
904976614 1:34461599-34461621 GCAGGGCCAGAGGTGGGGCAGGG + Intergenic
905017304 1:34786458-34786480 CCATGGCTCGGGGTGGAGCTAGG + Intronic
905028809 1:34868140-34868162 CCCTGGCCCGAGGGAGAGCATGG - Intronic
905058626 1:35120801-35120823 CCGCGGCCAGAGCCGGAGCAGGG + Intergenic
907284836 1:53372866-53372888 CCAAGGCCAGACGAGGAGCAGGG + Intergenic
907316832 1:53577614-53577636 CCAGGGCCACAGCTGTAGCAGGG - Intronic
908355501 1:63322713-63322735 CCAGGGCCAGAGGCCGAGGAAGG + Intergenic
908477972 1:64507522-64507544 GCATAGGTAGAGGTGGAGCATGG + Intronic
910160293 1:84265085-84265107 CAATGGACAGAGATGAAGCAAGG + Intergenic
910222171 1:84898606-84898628 CCATGGACAGGGGTGGGGGATGG + Intergenic
910295082 1:85636413-85636435 GCGTGGCCAGAGCAGGAGCAAGG - Intergenic
911146259 1:94555278-94555300 ATATGGCAAGAGGTGGGGCAGGG - Intergenic
911185496 1:94900038-94900060 CCTTGGACAGAGCTGGAGAAAGG + Intronic
911488212 1:98528598-98528620 ACATGGCCAGAAAAGGAGCAGGG - Intergenic
911560172 1:99395310-99395332 CCTTAGCCAGATGAGGAGCAAGG - Intergenic
911793923 1:102053507-102053529 CCTTGGCCAGAGCTGGAGCTGGG + Intergenic
912949660 1:114111931-114111953 CCCGGGCCTGAGGCGGAGCAGGG - Intronic
914380249 1:147109281-147109303 CCATGGCCATACATGGAGGAAGG + Intergenic
915005202 1:152629198-152629220 CAATGGGGAGAGGTGGAGCAAGG + Intergenic
915348208 1:155208751-155208773 CCATGGCGACAGGCGGCGCAGGG + Exonic
917978720 1:180256305-180256327 CCTTGGCCAGAGGACCAGCAGGG - Intronic
917982052 1:180275834-180275856 CTCTGGCCAGTGGTGGTGCAGGG + Exonic
918454448 1:184693795-184693817 CCCTGGCCTGAGGTGTTGCAGGG + Exonic
918706281 1:187666765-187666787 CCATGGCCACAGGGGGAGTCAGG + Intergenic
918998074 1:191788988-191789010 ACATGGCAAGAGATGGAACATGG - Intergenic
919822037 1:201479548-201479570 CCCTGGCAAGTGGTGGAGCCAGG - Intergenic
921195913 1:212757590-212757612 CCATGGCAAGAGATGGAGCAAGG + Intronic
921946046 1:220886917-220886939 CCAGGGCCAGGTGAGGAGCAGGG - Intergenic
922642076 1:227244592-227244614 CTATGGCCAGGGGTGAAGCAAGG + Intronic
923008686 1:230071570-230071592 GCATGACTTGAGGTGGAGCATGG + Intronic
923124586 1:231023847-231023869 CAATGCCCAGACTTGGAGCAAGG + Intronic
924855565 1:247871997-247872019 CCAAGGCCTGACGTGGAGGATGG + Intronic
1062867133 10:865255-865277 CCATGGACAGCTGTGGAACATGG + Intronic
1063624910 10:7679884-7679906 ACATGGCCAGAGCAGGAGCTAGG + Intergenic
1063840430 10:10065533-10065555 CCAAGGCCGGAGGTGGGGCTCGG - Intergenic
1065510617 10:26474906-26474928 CCATGGCCAGATCTGGACCTTGG + Intronic
1065845541 10:29739714-29739736 CCATAGCCAGAGATGGGCCACGG - Intergenic
1066696091 10:38078794-38078816 ACATGGCCAGAGCAGGAGCAAGG + Intergenic
1066961225 10:42230231-42230253 CCAAGGCCAGAGAAGGACCACGG + Intergenic
1066996447 10:42568744-42568766 ACAAGGCCAGAGTAGGAGCAAGG - Intergenic
1067348895 10:45457910-45457932 CCAAGGGAAGAGGAGGAGCAGGG - Exonic
1067796432 10:49325356-49325378 CCCTGGGCAGGGGTCGAGCATGG + Exonic
1068116212 10:52740239-52740261 ACATGGGCAGAGCTGGAGCCTGG + Intergenic
1068141942 10:53020078-53020100 CCGTGGACAGTGGTTGAGCAGGG + Intergenic
1068399373 10:56508805-56508827 CCATGGCCTGAGCTGGACCTTGG - Intergenic
1068889309 10:62132312-62132334 ACATGGCCAGAGAAGGAGGAAGG - Intergenic
1068891360 10:62151302-62151324 ACATGGCCAGAGCAGGAGGAAGG - Intergenic
1069132947 10:64728915-64728937 CAATGGTCAGAGGTGGAGGAAGG + Intergenic
1069615125 10:69801983-69802005 CCATGGGCAGAGGTGGGTCGTGG - Exonic
1069693736 10:70371894-70371916 CCCTGGCTAGAGCTGGAGCCAGG - Intronic
1071566306 10:86673086-86673108 TCCTGGGCAGAGGTGGAGCCTGG - Intronic
1072200879 10:93157795-93157817 ACATGGCAAGAGAAGGAGCAAGG - Intergenic
1073434839 10:103510147-103510169 CCAAGGCCAGGGCTGGAGCCTGG - Intronic
1073539936 10:104310008-104310030 CCAGGGACAGGGGTGGGGCAAGG + Exonic
1074302930 10:112249304-112249326 ACACAACCAGAGGTGGAGCAGGG + Intergenic
1074879910 10:117647713-117647735 TCATGGCCAGAGGTCCAGCCTGG - Intergenic
1075549484 10:123381650-123381672 TCAGGGCCACAGGAGGAGCAAGG + Intergenic
1075662059 10:124204605-124204627 CCATGGCCAGTGATAGAGAAGGG - Intergenic
1075727725 10:124619068-124619090 CCATGGCCACAGCTGCATCATGG - Intronic
1076631132 10:131853071-131853093 CCACGGGCAGAGGCAGAGCAGGG - Intergenic
1076761687 10:132608912-132608934 GCTGGGCCAGAGGTGGAGCTGGG + Intronic
1077120232 11:904021-904043 CCAGGAGCAGAGGTGGAGTAGGG - Intronic
1077141932 11:1028570-1028592 CCATGACCAGGGGAGGAGAAAGG - Intronic
1077280163 11:1740957-1740979 ACATGGCAAGAGTGGGAGCAAGG - Intronic
1077447666 11:2606501-2606523 ACATGGCAAGAGCAGGAGCAAGG - Intronic
1077533630 11:3108538-3108560 CTGTGGGCAGCGGTGGAGCAGGG + Intronic
1078080283 11:8199456-8199478 CAATGGCCAGCGGTGGAGGGAGG - Intergenic
1078101257 11:8331757-8331779 CCCTGGCCAGAGCTGCATCATGG - Intergenic
1078718124 11:13858969-13858991 ACATGGCCAGAGCAGAAGCAAGG + Intergenic
1078724051 11:13912652-13912674 ACATGGCCAGAGCAGGAGAAAGG - Intergenic
1078978580 11:16505772-16505794 CCATGGCTGGAGCTGGAGCTGGG - Intronic
1080255979 11:30290991-30291013 TCATGGCAAGAGTGGGAGCAAGG + Intergenic
1080603937 11:33848310-33848332 ACATGGCCAGAGCAGGAGGAAGG - Intergenic
1080607474 11:33875668-33875690 CAATGGCCTGAGGTGGAAGAAGG - Intronic
1080792057 11:35530195-35530217 CCAAGGCCAGAGATGGAGAAGGG + Intronic
1081068223 11:38575880-38575902 ACATGGCAAGAGCAGGAGCAAGG + Intergenic
1081243164 11:40731371-40731393 ACATGGCCAGAGCAGGAGCAAGG - Intronic
1081412337 11:42774518-42774540 CCATGGGCAGAGGAAAAGCAGGG - Intergenic
1083286280 11:61661208-61661230 ACATGGCCAGAGGGGGAGCAAGG + Intergenic
1083302107 11:61744800-61744822 CCATGGCCTGTCCTGGAGCAGGG - Exonic
1083329489 11:61890992-61891014 CCAGGGCCAGATGTGGGGTAGGG - Intronic
1083636335 11:64122869-64122891 CCAGGGCCGGAGGTGAAGGAGGG - Intronic
1083852116 11:65374306-65374328 CCATGTGCCCAGGTGGAGCAGGG + Intergenic
1083852123 11:65374332-65374354 CCATGTGCCCAGGTGGAGCAGGG + Intergenic
1084534792 11:69750375-69750397 CCAAGGCCAGAAGAGGTGCAGGG - Intergenic
1084606199 11:70173557-70173579 CCATGGCCAGAGGTGGAGCAAGG + Intronic
1084655133 11:70510609-70510631 TCCTGGACAGAGGAGGAGCAGGG - Intronic
1084772694 11:71354244-71354266 TGATGGACAGAGGAGGAGCATGG - Intergenic
1085042679 11:73335741-73335763 TCATGCTCAGAGGTGGAGGATGG - Intronic
1085509499 11:77081027-77081049 CCCTGGCCACAGGAGGAGGAGGG + Intronic
1085824208 11:79826103-79826125 CCAGGGCTAGAGGTAGAGGATGG - Intergenic
1086146802 11:83561046-83561068 ACAAGGCCAGAGCAGGAGCAAGG + Intronic
1086515176 11:87603787-87603809 AGATGGACACAGGTGGAGCAGGG + Intergenic
1087101108 11:94365529-94365551 ACATGGCGAGAGTGGGAGCAAGG - Intergenic
1087433220 11:98080028-98080050 ACATGGCCAGAGCAGGAGGAAGG - Intergenic
1087690693 11:101317622-101317644 CCATGGCCAGAGCTGAACCTGGG + Intergenic
1087779456 11:102287339-102287361 CCCCGCCCAGAGGTGGGGCAAGG + Intergenic
1088186941 11:107181087-107181109 ACATGGCCAGAGCTAGAGGAAGG + Intergenic
1088938913 11:114434279-114434301 ACATGGCCAGAGCAGGAGCAAGG + Intronic
1089316483 11:117594653-117594675 CCAAAGCCAGAGGAGGAGCAGGG - Intronic
1089560545 11:119341046-119341068 CCAGGGCCAGAGGAGAGGCAGGG + Exonic
1089617957 11:119705819-119705841 CCAAGGCCAGAGGCGGGGCAGGG + Intronic
1089838036 11:121389071-121389093 CCTTGGCAAGAAGTAGAGCAAGG - Intergenic
1090670096 11:128940031-128940053 CTATGGTCAGAGCTGGAGCAAGG - Intronic
1090854604 11:130600684-130600706 ACATGGCCAGAGCAGGAGGAAGG + Intergenic
1091314660 11:134605073-134605095 ACATGGCCAGAGAAGGAACAAGG + Intergenic
1091879047 12:3961817-3961839 ACACGGCCAGTGTTGGAGCACGG + Intergenic
1091944816 12:4529351-4529373 CCATGGTCATAGTTAGAGCAGGG + Intronic
1092914950 12:13181274-13181296 GCATGGCAGGGGGTGGAGCAAGG - Intergenic
1093698368 12:22189165-22189187 ACATGGCAAGAGTGGGAGCAGGG - Intronic
1093764021 12:22942135-22942157 ACATGGCCAGAGCAGGAGGAAGG - Intergenic
1094165227 12:27436458-27436480 CCATGGTCAGGGCTGGAGGAAGG - Intergenic
1094452530 12:30597776-30597798 ACATAGCAAGAGGGGGAGCAAGG + Intergenic
1095838698 12:46668730-46668752 GCATGACAAGAGTTGGAGCAAGG + Intergenic
1096136793 12:49209361-49209383 CCAGTGCCAGAGGTGGGGCTTGG - Intronic
1096229544 12:49889430-49889452 CCCTGGCCTGAGGCTGAGCAGGG - Intronic
1096413593 12:51394041-51394063 CAAAGGGCAGAGGTGGAGGAAGG - Intronic
1096585054 12:52614546-52614568 ACAGAGCCAGAGGTGGGGCAGGG + Intronic
1097902027 12:64882833-64882855 ACATGGGCAGAGGTGGAGGAGGG - Intergenic
1097978288 12:65710920-65710942 ACATGGTCAGAGCAGGAGCAAGG - Intergenic
1098391105 12:69970924-69970946 ACATGGCCAGAGCAGGAGGAAGG - Intergenic
1099672916 12:85717766-85717788 CCATGGCCTGAGGTGTACCTTGG + Intergenic
1099783986 12:87237141-87237163 TCATGGCAATAGGGGGAGCAGGG - Intergenic
1099960468 12:89392163-89392185 CCAGGGTCAGGGGTGGAGGAAGG + Intergenic
1099990236 12:89713738-89713760 ACATGGCCAGAGCAGGAGGAAGG + Intergenic
1100543630 12:95580957-95580979 TCATGACCAGAGCTGGAGCACGG - Intergenic
1101079544 12:101169259-101169281 CCTTGGCTAGAGATGAAGCAAGG + Intronic
1101469445 12:104982963-104982985 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
1101580678 12:106038734-106038756 CCATGGCCAGAAGAGGGGCATGG - Intergenic
1101673477 12:106897587-106897609 CCTTTCCCAGAGGTGGAGCCTGG + Intergenic
1101996308 12:109527727-109527749 CCAGGGCCAGAGAGAGAGCATGG + Intronic
1102058406 12:109914035-109914057 AGATGACCAGAGGTGGAGCTGGG - Intronic
1102390041 12:112542299-112542321 CCATGGGCAGAGCAGCAGCATGG - Intergenic
1102409793 12:112707814-112707836 CCATTGCCTGATGTGCAGCAAGG + Intronic
1102881178 12:116486295-116486317 CAATGGTCTGGGGTGGAGCAGGG + Intergenic
1103844540 12:123892304-123892326 CCATGGCCAGAGTGGGAGCAAGG + Intronic
1104134980 12:125928819-125928841 CCATGCTCAGAGCTTGAGCAAGG + Intergenic
1104578644 12:129992094-129992116 CCTTGGCCAGAGGAGGAAGAGGG - Intergenic
1104948658 12:132428849-132428871 CCTGGGCCTGGGGTGGAGCAGGG - Intergenic
1105727145 13:23174956-23174978 CCATGGTCACAGGTGGAGGATGG + Intergenic
1107130483 13:36888938-36888960 ACATGGCCAGAGGAGAAGAAGGG + Intronic
1107531568 13:41287292-41287314 ACATGGCCAGAGCAGGAGTAAGG + Intergenic
1107999034 13:45889777-45889799 CTAAGGCCAGAGGATGAGCAGGG - Intergenic
1108770375 13:53693504-53693526 ACATGGCAAGAGAGGGAGCAAGG - Intergenic
1109242135 13:59902336-59902358 ACATGGCCAGAGAAGGAGTAAGG - Intronic
1111679510 13:91426350-91426372 CCATGGCTGGAGCTGGAGCAGGG - Intronic
1112105091 13:96231492-96231514 ACATGGCCAGAGCAGGAGGAAGG + Intronic
1112463863 13:99626102-99626124 CCATGGCCGGTGGTGAAGCAGGG + Intronic
1113086225 13:106571869-106571891 ACATGGCCAGAGCCTGAGCAGGG - Intergenic
1113212594 13:108001122-108001144 CCATGGCCAGAGCTGTACCTTGG - Intergenic
1113346494 13:109483061-109483083 CCTTGGACAGAGGAGGAGCGGGG - Intergenic
1113488764 13:110676196-110676218 CCATGGGCAGCTGTGCAGCACGG + Intronic
1113707902 13:112446027-112446049 CAGTGGTCAGAGGTGGGGCAGGG + Intergenic
1114125806 14:19723921-19723943 ACATGGCAAGAGAGGGAGCAAGG + Intronic
1115916406 14:38320511-38320533 ACATGGCCAGAGCAGGAGGAAGG + Intergenic
1117209764 14:53483311-53483333 ACACGGCCAGAGCAGGAGCAAGG + Intergenic
1117411030 14:55451265-55451287 CAATGGCCAGATGTGGTGTAAGG + Intronic
1117496664 14:56312485-56312507 ACATGGCCAGAGCAGGAGGAAGG + Intergenic
1118138783 14:63056928-63056950 TCATACCCGGAGGTGGAGCATGG + Intronic
1118369515 14:65125535-65125557 GCATAGCCAGAGCTGGAGCAAGG + Intergenic
1118495375 14:66303568-66303590 ACATGGCGAGAGCAGGAGCAAGG - Intergenic
1118919923 14:70140540-70140562 CCAAGGTGTGAGGTGGAGCAAGG - Intronic
1120139309 14:80910490-80910512 ACATGGCCGGAGTAGGAGCACGG - Intronic
1120139925 14:80917994-80918016 CCCTGGGCAGAGGAGAAGCATGG - Intronic
1121260924 14:92565467-92565489 CCATGGGCAGAGCAGCAGCATGG + Intronic
1121855787 14:97268971-97268993 CCCTGGCCAGAGGTGGCCCTGGG - Intergenic
1121994140 14:98588857-98588879 CCAGTGTCAGAGGTGGAGCCTGG + Intergenic
1122043948 14:99010217-99010239 ACATGGCCAGAGCAGGAGGAGGG + Intergenic
1122075211 14:99231271-99231293 CCATGGGCAGCGCTGGAGCAAGG - Intronic
1122710266 14:103651664-103651686 CCAAGGCTAGAGGAGCAGCACGG - Intronic
1122832059 14:104403188-104403210 CCATGGCCAGAGAAGGAGGAAGG - Intergenic
1124132183 15:27000647-27000669 ACATGGCCAGAGCAGGAGCAAGG - Intronic
1124168455 15:27350642-27350664 CCAGGGCCAGCGCTGGAGGATGG + Intronic
1124204230 15:27703604-27703626 CCATGACCAGAGGCAGAGGAAGG - Intergenic
1124791803 15:32734702-32734724 CCTAGGGCAGAGGTGGAGCAGGG + Exonic
1126366686 15:47901811-47901833 TCCTGGCATGAGGTGGAGCATGG + Intergenic
1127330773 15:57937592-57937614 ACATGGCCAGAGCAGGAGGAAGG + Intergenic
1127518945 15:59724117-59724139 ACATGGCCAGAGCAGAAGCAAGG + Intergenic
1127960441 15:63886655-63886677 CCATGGCTTGAGAAGGAGCAAGG + Intergenic
1128453105 15:67818532-67818554 CCATGGACAGAGGGGGATGAGGG + Intergenic
1128997819 15:72309715-72309737 CCATGGGCAGAGGAGGGACATGG + Intronic
1129130051 15:73485625-73485647 TCATGGCAAGAGCAGGAGCAAGG - Intronic
1129255811 15:74333354-74333376 GCATCTTCAGAGGTGGAGCAGGG - Intronic
1129477123 15:75792971-75792993 ACATGGCCAGAGCTGGTGCCAGG + Intergenic
1129512524 15:76135360-76135382 ACATGGCCAGAGATGGTGCCGGG + Intronic
1130353820 15:83112480-83112502 CAGTGGCCATAGGTGCAGCAGGG + Intronic
1131364139 15:91823448-91823470 TTATGGCCAGAGCAGGAGCAAGG - Intergenic
1131371010 15:91881900-91881922 ACCTGGCCAGGGATGGAGCAGGG - Intronic
1131510417 15:93046803-93046825 CCTTGGCCGGGGCTGGAGCAGGG + Intronic
1131529080 15:93177056-93177078 CCAAAGTCAGAGGTGGAGGATGG + Intergenic
1131665208 15:94564254-94564276 ACATGGCCAGAGCAGGAGGAAGG + Intergenic
1132018805 15:98342344-98342366 CCATTGCAAGGGGTGGAGAATGG - Intergenic
1132495968 16:263585-263607 CCATGGCCACATCTGGACCAGGG - Intronic
1132572293 16:649415-649437 CCATGGCCCGAGGTAGCGCGCGG + Exonic
1133302642 16:4792151-4792173 CCAGGCCAAGAGCTGGAGCAGGG + Intronic
1133963763 16:10516701-10516723 ACATGGCCAGGGCAGGAGCAAGG - Intergenic
1134006174 16:10819925-10819947 CCATGGGCGGAGGTGGAGGCAGG + Intergenic
1135616514 16:23915258-23915280 CCATGGCCAGAAGCAGAGCAAGG - Intronic
1135748664 16:25038721-25038743 CCCTGGCCACAGGTGGAATATGG - Intergenic
1135850669 16:25960171-25960193 ACATGGCCAGAGAGTGAGCAAGG - Intronic
1135853328 16:25984257-25984279 CCATGGCCAGGGATGGGGGACGG + Intronic
1136862714 16:33712867-33712889 GCAGGGCCAGAGCTGGGGCAGGG - Intergenic
1138198983 16:55075042-55075064 CCATGGCCGGTGAAGGAGCAAGG + Intergenic
1138540812 16:57686287-57686309 ACATGGCGAGAGTGGGAGCAAGG + Intronic
1138800126 16:60016783-60016805 CCATGGCCAGAGTTGTACCTTGG + Intergenic
1139775826 16:69316569-69316591 CCATGGGGAGAGGGGGAGCTTGG + Intronic
1140343408 16:74188268-74188290 ACATGGCCAGAGTGGGAGCCGGG + Intergenic
1141125255 16:81396589-81396611 ACATGGCAAGAGAGGGAGCAAGG + Intergenic
1141145680 16:81528461-81528483 ATATGACCAGAGGTGGAGCGTGG + Intronic
1141918709 16:87120389-87120411 CAATGGCAGGAAGTGGAGCAGGG + Intronic
1142126162 16:88411676-88411698 CGGTGGCCTGAGGTGGCGCAGGG + Intergenic
1142235476 16:88920616-88920638 CAACGGCCACAGGTGGTGCATGG + Intronic
1203124190 16_KI270728v1_random:1561009-1561031 GCAGGGCCAGAGCTGGGGCAGGG - Intergenic
1142551654 17:744315-744337 TCATGGCCAGAGGCAGAGCCAGG + Intergenic
1143095640 17:4477008-4477030 CCCTGGACAGAGGTGGCGCCAGG - Intronic
1143332607 17:6148719-6148741 CCATGAAGAGAGGTGGGGCAAGG - Intergenic
1143518201 17:7430380-7430402 CCATGACCAGTGCTGGAGCAGGG - Intergenic
1143544363 17:7587902-7587924 CCAGGGCCAGAAGGGAAGCAGGG - Exonic
1143597213 17:7922533-7922555 CCCAGCCCAGAGGTGGAGGAGGG - Exonic
1143728770 17:8867946-8867968 CCATGTCCAGGGGTGGGGGATGG - Intergenic
1144121441 17:12157771-12157793 GCATGGCCAGAGCAAGAGCAAGG - Intergenic
1144584527 17:16480271-16480293 CCATGGCCCGGGGTGGGGGATGG - Intronic
1144863966 17:18323224-18323246 ACATGGGCAGAAGTGGAGCCTGG + Intergenic
1147051701 17:37800018-37800040 CCATTGCCTCAGGTGGAGTAGGG + Intergenic
1147720245 17:42535590-42535612 CCCAGGCCGGCGGTGGAGCAGGG - Intergenic
1147953067 17:44117703-44117725 CCCTGGGGAGAGATGGAGCAGGG + Exonic
1148680807 17:49472565-49472587 CCAGGGGCAGAGGTTGGGCATGG - Intronic
1149256761 17:54836275-54836297 CCATGGCCTGTGCTGGAGCCTGG - Intergenic
1149540368 17:57463713-57463735 CCAGGGCCAGGGGCAGAGCAGGG - Intronic
1151360742 17:73587295-73587317 CACTGGCCCGAGGTGGAGCCAGG + Intronic
1151766855 17:76137321-76137343 CACTGTCCAGAGGTGGGGCAGGG + Exonic
1151848418 17:76674474-76674496 CCAAGGCCAGGGGTGGGGCCTGG + Exonic
1151902223 17:77023940-77023962 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
1152408252 17:80109435-80109457 CGATGGCCAGAGGAGGAGGTGGG + Intergenic
1152522045 17:80862418-80862440 CCATGGCCAGACGTGGGGAGGGG - Intronic
1153311607 18:3682218-3682240 ACATGGCCAGAGCAGGAGCAAGG - Intronic
1153612092 18:6896531-6896553 CCTTGGAGAGAAGTGGAGCATGG - Exonic
1154031141 18:10755597-10755619 GCATGGTGAGAGGTCGAGCACGG + Intronic
1156543069 18:37936159-37936181 ACATAGCCAGAGTAGGAGCAAGG + Intergenic
1156561406 18:38129843-38129865 CCATAGGCAGAGGAGGAGCAGGG + Intergenic
1156949112 18:42871697-42871719 TCATGGCCAAAGGTGTAGAAGGG + Intronic
1157553510 18:48597576-48597598 ACATGGCCAGGGCAGGAGCAAGG - Intronic
1158215948 18:55101072-55101094 CCAAGGCCAGAGGAAGAGAAAGG - Intergenic
1158517667 18:58144341-58144363 ACGTGGCCAGAGCAGGAGCAAGG + Intronic
1158588117 18:58758285-58758307 CCATAGGCAGAGGTGTGGCATGG - Intergenic
1159420185 18:68208445-68208467 ACATGGCCAGAGAGGGATCAAGG + Intergenic
1159890171 18:73945472-73945494 TCATGGCCTGATGTGAAGCATGG - Intergenic
1160438171 18:78867167-78867189 CCACGCCCAGTGGTGGAGCTGGG - Intergenic
1160787472 19:907701-907723 CCATGGGCTGTGCTGGAGCAGGG - Intronic
1160910613 19:1472183-1472205 CCATGGCCCGAGGGGGAACCTGG + Exonic
1161268427 19:3375759-3375781 CCACGGCCGGAGGTGGCCCAAGG + Intronic
1161513237 19:4683179-4683201 GGATGGGCAGAGGTGGGGCATGG - Intronic
1161771712 19:6234309-6234331 CCCTGTCCGGAGGTGGAGGAGGG + Intronic
1162178282 19:8847800-8847822 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
1162337971 19:10073307-10073329 TCATGGCCAGGGGTGTGGCAGGG - Intergenic
1162782698 19:13014777-13014799 CCAGGGCCAGTGGCTGAGCACGG + Intronic
1163797449 19:19345733-19345755 CCATGGGGAGTGGTGGAGCTGGG + Intronic
1163834895 19:19567260-19567282 ACAAGGCCAGAGCTGGAGCAAGG - Intronic
1165094679 19:33403600-33403622 CCCTGGCCTCATGTGGAGCAAGG + Intronic
1165901877 19:39173081-39173103 CCACGGCCAGAGGGGGCCCAGGG + Exonic
1166356974 19:42233099-42233121 CCCTGGACAAAGGTGGGGCAGGG - Exonic
1167472078 19:49680833-49680855 CCTTAGCCAGAGGTCGGGCAGGG + Intronic
1167698326 19:51027604-51027626 CCCTGACCAGGTGTGGAGCAAGG + Exonic
1168182354 19:54670975-54670997 CCATGGAAAGAGGAGGAGGAAGG + Intronic
1168207835 19:54865359-54865381 ACATGGCAAGAGAGGGAGCAAGG + Intronic
925020933 2:567239-567261 CCCTGGCCAGAGGTGTCCCATGG - Intergenic
925082436 2:1081006-1081028 CCATGGCCCCAGGAGAAGCAAGG + Intronic
925546605 2:5023700-5023722 CCAAGGACAGGGGTGGAGAATGG - Intergenic
926055252 2:9770649-9770671 CCCTGGGAAGAGGTGGAGCTGGG + Intergenic
926500864 2:13650690-13650712 CCTTGGGCCGAGGTGCAGCAAGG - Intergenic
926660967 2:15465463-15465485 CCATTGCTAGAGGTAGAGAAAGG - Intronic
927326426 2:21810800-21810822 CCAATGCTGGAGGTGGAGCATGG + Intergenic
927944869 2:27129588-27129610 CCACGGCCAGCAGTGGAGCTTGG - Exonic
928175802 2:29033628-29033650 CCATGGCCAGGGGTGGCTCTGGG + Intronic
929177166 2:38991584-38991606 CCAGGGCAAGGTGTGGAGCAGGG + Intronic
929371994 2:41236706-41236728 CAATAGCCAAAGGAGGAGCAAGG + Intergenic
929781928 2:44962592-44962614 CCATGACCAGAGGTGGGGGTAGG - Intergenic
930013939 2:46958033-46958055 CCAAGGCCAGAGTCAGAGCATGG - Intronic
930842375 2:55861868-55861890 ACATGGCCAGAACAGGAGCAAGG + Intergenic
932576303 2:72964112-72964134 CCGAGGCCAGAGGCGAAGCAAGG + Intronic
933850715 2:86364542-86364564 ACATGGCCAGAGCAGGAGCAAGG + Intergenic
933878405 2:86643727-86643749 ACATGGCCGGAGCAGGAGCAAGG - Intronic
934857160 2:97736688-97736710 CCATGCCCAGACGTGGGGAAGGG + Intronic
934861753 2:97769487-97769509 ACATGACCAGCTGTGGAGCAGGG + Intronic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
937072102 2:119072357-119072379 CCTTGGACAGAGGTGGTGGAGGG + Intergenic
937223549 2:120355571-120355593 ACCTGGCCAGAGATGGTGCATGG - Intergenic
937223828 2:120356962-120356984 CCAGGGACAGAGGTGAGGCATGG + Intergenic
937315707 2:120930869-120930891 CCCTACCCAGAGCTGGAGCATGG - Intronic
937477352 2:122227408-122227430 CCAAGCCCAGAGGGGTAGCATGG + Intergenic
938070193 2:128304365-128304387 CCAGGGACAGAGATGGTGCATGG + Intronic
938140693 2:128792053-128792075 CCAAGGCCACAGGTGGACCTGGG + Intergenic
939441873 2:142260529-142260551 CTATGGCCAGAGCTTGAGCAAGG - Intergenic
939968357 2:148633289-148633311 CCAGGGCCAGATGTGGATCCAGG + Intergenic
940126442 2:150330997-150331019 CCATGGCCTGATGTGGCGCTGGG + Intergenic
940904504 2:159157079-159157101 GCAAGGCCAGAGAGGGAGCAGGG + Intronic
941645788 2:168039638-168039660 CCTTTGCCAGAGGTGGAGGGAGG + Intronic
942123776 2:172803401-172803423 CCATGGCCCGAGCTGTACCATGG + Intronic
943832310 2:192478469-192478491 CCACGGCTGGAGCTGGAGCAAGG - Intergenic
943839430 2:192560096-192560118 CCATAGCCAGAGGAGTAACATGG - Intergenic
944272231 2:197796488-197796510 CCATGGCCTGAGCTGTACCATGG + Intergenic
945495301 2:210501069-210501091 CCATGGCCAGAGCTGTACCTTGG + Intronic
946330424 2:219005914-219005936 CCATGGTGAGGGGTGGAGCATGG - Intronic
946534139 2:220608021-220608043 CCATGGCCAGAGGCGTATCTTGG + Intergenic
947413787 2:229871528-229871550 ACATGGCAAGAGTGGGAGCAAGG - Intronic
947523476 2:230865246-230865268 CCAGAGCCCGGGGTGGAGCAGGG + Intronic
948185067 2:236014583-236014605 GGAAGGGCAGAGGTGGAGCAGGG - Intronic
948468073 2:238161674-238161696 CAATGGCAAGAAGAGGAGCAGGG + Exonic
948547032 2:238740048-238740070 CCAGGGCAGGAGGTGGAGGAGGG + Intergenic
949058845 2:241944980-241945002 CCATGGCCAGGGAAGGACCAAGG + Intergenic
1168955725 20:1832954-1832976 CCTTGGCCAGTGGTGCAGCGGGG - Intergenic
1169291324 20:4355551-4355573 ACATGGCTAGAGCAGGAGCAAGG - Intergenic
1169621278 20:7509134-7509156 ACATGGCAGGAGATGGAGCAGGG + Intergenic
1170258118 20:14369391-14369413 CCAAGGAGAGAGTTGGAGCAGGG + Intronic
1170714339 20:18818956-18818978 ACATGGCCAAAGAAGGAGCAAGG + Intronic
1171144510 20:22769969-22769991 CCATGGCAAGAGACGGAGAAAGG + Intergenic
1171351629 20:24507171-24507193 TAATGGACAGAGGTGGAGGATGG - Intronic
1171409452 20:24936258-24936280 AGCTGGCCAGAGCTGGAGCAGGG - Intergenic
1171451505 20:25239142-25239164 ACATGGCCAGAGCAGAAGCAAGG + Intergenic
1172227850 20:33317128-33317150 CCATGGCAAGTGTTAGAGCAGGG - Intergenic
1172435461 20:34926030-34926052 CCATGGGTACAGATGGAGCATGG + Intronic
1172706603 20:36886805-36886827 CAATGGCCAGAAGTGCAGCCTGG - Intronic
1173909738 20:46657805-46657827 ACATGTCCAGAGCAGGAGCAAGG + Intronic
1174196365 20:48775445-48775467 CCATGGGCAGTGGGGCAGCAGGG + Intronic
1174361184 20:50029786-50029808 CCCTGTCCAGAGGTGGGCCAGGG + Intergenic
1175096982 20:56548969-56548991 ACATGGCCAGAGGAGGAGCAAGG - Intergenic
1176000822 20:62830513-62830535 CCAGGGCCAGAAGGGCAGCATGG + Exonic
1176119258 20:63446623-63446645 ACATGGCCAGAGCTGGGGCTGGG + Intronic
1176128485 20:63486512-63486534 CCACGGCAAGGGGTGAAGCAGGG + Intergenic
1176848183 21:13892500-13892522 CCATGGCTGGAGCTGGAGCTGGG + Intergenic
1179678701 21:43002521-43002543 CGATGGCCAGAGGCTGAGCTGGG - Intronic
1179722907 21:43325497-43325519 CCAGGGCCACATGTGGTGCAAGG - Intergenic
1179890887 21:44334561-44334583 CCGAGTCCAGAGGTTGAGCAGGG - Intronic
1180052156 21:45336125-45336147 CCATTGGCAACGGTGGAGCAGGG + Intergenic
1180127273 21:45801042-45801064 CCATTGCCAGAGTTGGAGAGTGG - Intronic
1180152385 21:45956832-45956854 CCATGGCAAGAACAGGAGCAAGG + Intergenic
1180947986 22:19707391-19707413 CCTGGGCCAGAGGTCGGGCAAGG + Intergenic
1181050055 22:20234191-20234213 CCAGGCCCAGAGGTGGGGCCAGG + Intergenic
1181625290 22:24118803-24118825 CCATGGCCCCTGGTGGAGCAAGG + Intronic
1182126668 22:27821058-27821080 CAATTTCCAGACGTGGAGCAGGG - Intergenic
1182979024 22:34650720-34650742 GCTTGGCCAGAGCAGGAGCAAGG + Intergenic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
1184248810 22:43248929-43248951 CCTTGCCCAGAGCGGGAGCATGG - Intronic
1184646045 22:45896027-45896049 CCATTGCCAGATCTGCAGCATGG - Intergenic
1184838704 22:47039892-47039914 CCATGGCTGGAGCAGGAGCAAGG + Intronic
1185132047 22:49044808-49044830 CCATGGACAGGAGAGGAGCAGGG - Intergenic
950018373 3:9769669-9769691 CCTGGGACAGAGGTGGAGAAAGG + Intronic
950171718 3:10843411-10843433 GCATGGCCAGAAGTAGAGGATGG - Intronic
950523794 3:13511680-13511702 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
952083797 3:29793844-29793866 CCATTGCTGGAGGTGGAGCTTGG + Intronic
952163821 3:30723949-30723971 CTAGGGCCATAGGGGGAGCATGG + Intergenic
953034919 3:39203125-39203147 GGATGGGCAGAGGTGGAGCGTGG + Intergenic
954504077 3:51051845-51051867 ACATGGCAAGAGTGGGAGCAAGG + Intronic
954612483 3:51953200-51953222 CCATGGACAGATCTGCAGCAAGG + Intergenic
954806939 3:53226040-53226062 TCATGGCTACAGGTGGAGAAAGG - Intronic
955061160 3:55492448-55492470 CCATAGGCAGAGCTGGACCAAGG - Intergenic
955955626 3:64286401-64286423 TCTTGGCCAGAGGTGGGGGAGGG + Intronic
958631315 3:96686641-96686663 CCACTGCCAGGGGTGGAGAAGGG + Intergenic
960011614 3:112840375-112840397 ACATGGCCAGAGCAGGAGGAAGG + Intronic
960970893 3:123139381-123139403 CCAGGCCCAGAGGAGGAGAAAGG - Intronic
962141350 3:132793877-132793899 ACATGGCAAGAGGGGGAGCAAGG + Intergenic
962494195 3:135923203-135923225 CAATGGGCAGAGGTGGTGGAGGG - Intergenic
963223666 3:142838442-142838464 ACATGGCCAGAGTAGAAGCAAGG - Intronic
963506823 3:146196651-146196673 CCACAGCCATAGGTTGAGCATGG + Exonic
963903444 3:150754328-150754350 ACATGGCAAGAGCAGGAGCAAGG + Intronic
964831842 3:160892306-160892328 ACATGGCGAGAGCAGGAGCAAGG + Intronic
965086319 3:164103501-164103523 ACATGGCCAAAGAAGGAGCACGG - Intergenic
965320326 3:167245696-167245718 ACATGGCCAGAGCAGGAGGAAGG - Intronic
965582029 3:170278826-170278848 ACATGGCAAGAGAGGGAGCAAGG + Intronic
966863533 3:184243749-184243771 CCATGGGCAGAGTTGGGGGAAGG - Intronic
967883485 3:194317762-194317784 ACATGGCAAGAGTAGGAGCAAGG + Intergenic
968022493 3:195405845-195405867 ACATGGCCAGAGCAGGAGCCAGG + Intronic
968331534 3:197874600-197874622 CCATGGACAGGGCTGGAGCTGGG - Intronic
968459796 4:718836-718858 GCCTGGCCAGAGATGGAGCAGGG + Intronic
968727666 4:2255813-2255835 CCATGCCCAGAGGGGGACCCAGG + Intronic
968772347 4:2515502-2515524 CGATGCCCAGACTTGGAGCAAGG + Exonic
968933996 4:3600494-3600516 GCATGGGCAGAGGTGCAGGAGGG - Intergenic
969057718 4:4412555-4412577 CCTTGGCCAAAGCTGGAGAAAGG + Intronic
969512074 4:7623829-7623851 CCAGGGCTGGGGGTGGAGCAAGG - Intronic
970402745 4:15733656-15733678 ACATGGCCAGAGAAGGAGGAAGG + Intronic
971568927 4:28184900-28184922 CCATGGCCAGAGCAGTAGCAAGG - Intergenic
972242093 4:37204191-37204213 CCATGGCCAGAGCTGTACCTTGG + Intergenic
973619819 4:52715069-52715091 ACATGGCCAGAGTAGGAGGAAGG - Intergenic
976589479 4:86834870-86834892 ACATGGCCAGAGAGGGAGCAAGG + Intronic
977902478 4:102438163-102438185 ACATGGCGAGAGTGGGAGCAAGG - Intergenic
978926062 4:114246222-114246244 CCAATGCTAGAGGTGGAGCCTGG - Intergenic
979104247 4:116664374-116664396 CCCTGGCCAGGAGGGGAGCAAGG - Intergenic
979361753 4:119773615-119773637 ACATGGTCAGAGCGGGAGCAAGG + Intergenic
979721446 4:123905125-123905147 CCATGGCCAGAGCTGTACCTTGG - Intergenic
980476844 4:133329196-133329218 ACATGGTGAGAGGGGGAGCAAGG + Intergenic
981259173 4:142699059-142699081 AAATGGACAGAGGTGGTGCATGG + Intronic
981826979 4:148954487-148954509 CCAGGGCCTGAGAGGGAGCATGG - Intergenic
982428990 4:155299712-155299734 ACATGGCCAGAGCAGGAGGAAGG + Intergenic
983737595 4:171082394-171082416 ACATGGCCAGAGAAGGAGCAAGG - Intergenic
983899934 4:173122856-173122878 CCAAGGCCTGAAGTGGAGTAAGG + Intergenic
984527766 4:180876861-180876883 GCATGGCAAGAGCAGGAGCAGGG - Intergenic
985617205 5:930338-930360 CCAAAGCTGGAGGTGGAGCATGG + Intergenic
985719637 5:1482430-1482452 CCAGGGGCAGGGATGGAGCAGGG + Intronic
986339875 5:6779802-6779824 CCATCACCAGAGCTGGAGGAGGG + Intergenic
986507811 5:8470872-8470894 CCATGGCTGGAGCTGAAGCAGGG + Intergenic
986631610 5:9779209-9779231 ACATGACAAGAGATGGAGCAAGG - Intergenic
987243430 5:16024381-16024403 CCATGGCCAGAGCAGGAGCAAGG - Intergenic
987709055 5:21486089-21486111 CCATGGCCTGAGGTGTACCTTGG + Intergenic
987777398 5:22385837-22385859 ACATGGCCAGAGCAGGAGAAAGG + Intronic
988428607 5:31092913-31092935 GCATGGCCTGCGGTGGAGCCAGG - Intergenic
988586178 5:32509395-32509417 ACATGGCCTGGGGTGGAGCAGGG + Intergenic
988750557 5:34188064-34188086 CCATGGCCTGAGGTGTACCTTGG - Intergenic
989067816 5:37481496-37481518 CCATGGCCTGAGGTGTATCTTGG + Intronic
989289604 5:39747974-39747996 ACAGGGCTAGAGGTGGAGGATGG - Intergenic
989373974 5:40740519-40740541 CCATGGCCACATATGCAGCAAGG + Intronic
991139511 5:63224077-63224099 CCCTGGACATAGGTGGAGGAAGG + Intergenic
991317613 5:65327144-65327166 ACATGGCAAGAGAGGGAGCAAGG - Intronic
991738823 5:69651262-69651284 CCATGGCCTGAGGTGTACCTTGG - Intergenic
991759375 5:69905165-69905187 CCATGGCCTGAGGTGTACCTTGG + Intergenic
991787961 5:70212953-70212975 CCATGGCCTGAGGTGTACCTTGG - Intergenic
991790398 5:70231003-70231025 CCATGGCCTGAGGTGTACCTTGG - Intergenic
991812189 5:70485617-70485639 CCATGGCCTGAGGTGTACCTTGG - Intergenic
991815147 5:70506094-70506116 CCATGGCCTGAGGTGTACCTTGG - Intergenic
991818283 5:70527379-70527401 CCATGGCCTGAGGTGTACCTTGG - Intergenic
991838602 5:70780231-70780253 CCATGGCCTGAGGTGTACCTTGG + Intergenic
991880407 5:71213317-71213339 CCATGGCCTGAGGTGTACCTTGG - Intergenic
991882846 5:71231343-71231365 CCATGGCCTGAGGTGTACCTTGG - Intergenic
992003391 5:72456151-72456173 CCATGCCCAGGGGTAGAGCCAGG - Intronic
992796718 5:80260117-80260139 CCATAGGCAGAGCTGCAGCATGG - Intergenic
994421181 5:99527432-99527454 CCATGGCCTGAGGTGTACCTTGG + Intergenic
994546871 5:101177652-101177674 ACATGGCCAGAGCAGGAGGAAGG - Intergenic
994584602 5:101690533-101690555 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
994671443 5:102766163-102766185 CCATGGACTGGGGTGGAGGAAGG + Intronic
994694587 5:103058099-103058121 CCATGGGCAGAGCAGCAGCATGG - Intergenic
995782189 5:115789308-115789330 ACATGGCGAGAGAGGGAGCAAGG - Intergenic
997512957 5:134465899-134465921 CGATGGGCAGAGGCGGAGCCTGG - Intergenic
999453174 5:151693829-151693851 CCATGGCCAGAAGGGCAGAATGG - Intergenic
999797782 5:155004385-155004407 CCATGGCCAGACCAGGTGCAAGG + Intergenic
1000294629 5:159902715-159902737 CCATGGACATCGGTTGAGCAAGG - Intergenic
1000677034 5:164133377-164133399 ACATGGCCAGAGAAGGAGCAAGG - Intergenic
1000767531 5:165310322-165310344 ACATGGCCAGAGCAGAAGCAAGG - Intergenic
1001471962 5:172020817-172020839 CCTTGGCCACAGCTGGAGAAAGG + Intergenic
1002212000 5:177604750-177604772 CCAGGGCAAGAGGAGAAGCAGGG + Intronic
1003276752 6:4660517-4660539 CCATGGCCAGGCGAGGAGCCTGG + Intergenic
1003323608 6:5075044-5075066 ACATGGCAAGAGAGGGAGCAAGG - Intergenic
1003938286 6:10998090-10998112 ACATGGCAAGAGAGGGAGCAAGG - Intronic
1004246811 6:13985855-13985877 ACATGGCCAGAGAGGAAGCAAGG - Intergenic
1004461629 6:15842073-15842095 CCCTCCCCAGAGGTGGAGCGAGG + Intergenic
1004565306 6:16790380-16790402 ACATGGCCAGGGAAGGAGCAAGG + Intergenic
1005200434 6:23338441-23338463 CAATGCTCAGAGGTGGAACAGGG - Intergenic
1005548630 6:26894369-26894391 CCATGGCCCGAGGTGTACCTTGG - Intergenic
1006452772 6:34114672-34114694 CCTTTGTCAGAGGTGGAGCCGGG - Intronic
1007836965 6:44681435-44681457 CCAAGCTCAGGGGTGGAGCATGG + Intergenic
1008223940 6:48888528-48888550 CCAGTGTCAGAGGTGGAGCCTGG - Intergenic
1008517357 6:52330636-52330658 ACATGGCAGGAGCTGGAGCAAGG + Intergenic
1008974467 6:57408560-57408582 CCAGGGCCAGGGGTGGAGGGAGG - Intronic
1009019384 6:57935476-57935498 CCATGGCCTGAGGTGTACCTTGG - Intergenic
1009163357 6:60310068-60310090 CCAGGGCCAGGGGTGGAGGGAGG - Intergenic
1009377957 6:62994629-62994651 CAATGGCTAGAGCTGAAGCATGG + Intergenic
1009930907 6:70176614-70176636 CCCTGGCCACAGGTGTATCATGG - Intronic
1010449296 6:75984852-75984874 ACATGGCAAGAGTGGGAGCAAGG - Intronic
1010785306 6:79993598-79993620 CCAGTGCTAGAGGTGGAGCCTGG + Intergenic
1011292586 6:85792140-85792162 CCATAGCCAGAGCAGCAGCATGG + Intergenic
1011438112 6:87360117-87360139 CCACGCACAGAGGAGGAGCAGGG - Intronic
1012097189 6:94977435-94977457 CCATGGCCAGAGCTGTACCTTGG + Intergenic
1012532520 6:100255037-100255059 CCAAGGGCAGGGGTGGAGGAGGG + Intergenic
1013045107 6:106477874-106477896 CCATGGAAAGATCTGGAGCACGG + Intergenic
1013052447 6:106549392-106549414 TCATGGCCACAGGTGGAGCCAGG + Intronic
1014558047 6:122856814-122856836 ACATGGCCACAGCAGGAGCAAGG + Intergenic
1014734744 6:125079048-125079070 CCTTGGCCAGAGGCAGAGAAAGG + Intronic
1015421789 6:133019411-133019433 ACATGGCCAGAGCAGGAGGAAGG + Intergenic
1016054539 6:139565676-139565698 ACATGGCCAGAGCAGGAGGAGGG + Intergenic
1016700374 6:147047698-147047720 ACATAGCGAGAGCTGGAGCAAGG - Intergenic
1018554148 6:165033325-165033347 ACATGGCAAGAGAGGGAGCAAGG + Intergenic
1018805066 6:167252852-167252874 CCAATGCCAGAGGTGGGGCCTGG + Intergenic
1018859586 6:167701151-167701173 GCAAGGCCAGACGGGGAGCACGG + Intergenic
1019105548 6:169664346-169664368 GCAACACCAGAGGTGGAGCAGGG + Intronic
1019265807 7:116848-116870 CCAGGGCCAGGGGTTGAGCCAGG - Intergenic
1019725074 7:2597374-2597396 CCAGGCCCAGAGGGGCAGCAAGG + Intronic
1021453672 7:20805872-20805894 ACATGGCCAGAGCAGGAACAAGG + Intergenic
1021758684 7:23881943-23881965 ACATGGCCAGAGCAGGAGGAAGG + Intergenic
1022468455 7:30666763-30666785 CCAGAGCGAGAGCTGGAGCAGGG + Intronic
1022735437 7:33071347-33071369 ACATGGCCAGAGAAGGAGCAGGG - Intergenic
1022800524 7:33772643-33772665 ACATGGCCAGAGGAGGAGGAAGG - Intergenic
1022939598 7:35220378-35220400 CCATGGCCAGCTCTGGAGGAGGG + Intronic
1023362034 7:39426755-39426777 TCACTTCCAGAGGTGGAGCATGG - Intronic
1023633237 7:42183961-42183983 CCATGGCCAGTGTCGGAGCTGGG - Intronic
1023765050 7:43502864-43502886 CTAGGGCCAGGGTTGGAGCATGG + Intronic
1023909287 7:44542045-44542067 CCCTGGGCCCAGGTGGAGCAGGG - Intergenic
1024059809 7:45689474-45689496 ACATGGCGAGAGCAGGAGCAAGG + Intronic
1024251905 7:47511982-47512004 CCATGGGAACAGGTGGAACAAGG - Intronic
1027590350 7:80111753-80111775 CCATGGCAAGAGAGGAAGCAGGG - Intergenic
1028216521 7:88140066-88140088 ACATGGCAAGAGAGGGAGCAGGG + Intronic
1028370582 7:90087334-90087356 CCGTGGCCAGCGCTTGAGCAAGG + Intergenic
1028792193 7:94865550-94865572 ACATGGCAAGAGTGGGAGCAAGG - Intergenic
1028844468 7:95463591-95463613 ACATGGCCAGAGCAGGAGGAAGG - Intergenic
1029278095 7:99419526-99419548 CCCAGGCCCGAGTTGGAGCACGG + Exonic
1031193639 7:118586711-118586733 CCATGACCTGAGCTGCAGCATGG - Intergenic
1031493903 7:122423158-122423180 CTATGGCCAGAGCTGGAGGAAGG - Intronic
1032191411 7:129767869-129767891 CCAAGGTGAGTGGTGGAGCAGGG - Intergenic
1032716482 7:134513198-134513220 CCAGGTCCAGAGGTGGACCAAGG - Intergenic
1033843615 7:145404496-145404518 CCATTGCCAGAGGTGGCACCGGG + Intergenic
1034376503 7:150649485-150649507 CCATGGTCAGAAGTTGAGCGGGG + Intergenic
1034631171 7:152531628-152531650 CCATTGGAACAGGTGGAGCAAGG - Intergenic
1034710902 7:153190696-153190718 CCAGGCCCAGAAGTGGCGCATGG - Intergenic
1035640047 8:1177999-1178021 CCGTGGCCAGTGGTGGTGAAGGG + Intergenic
1036717788 8:11142606-11142628 ACATGGCAAGAGCTGGAGCAAGG - Intronic
1037691334 8:21183719-21183741 CCATGAACCCAGGTGGAGCAGGG - Intergenic
1037961552 8:23102151-23102173 CCATGGACAGAGGAGGCCCAGGG - Intronic
1037962056 8:23105179-23105201 ACAGAGCCAGAGGGGGAGCACGG - Intronic
1037963125 8:23114789-23114811 TCTTGTCCAGAGGTGGAGCGTGG + Intronic
1038166142 8:25086877-25086899 CCAAGGCCAGCAGGGGAGCATGG - Intergenic
1038278521 8:26141866-26141888 ACATGGCCAGAGAGGGAGCAAGG - Intergenic
1039226115 8:35390116-35390138 ACATGGCCAGAGGAGAAGCAAGG + Intronic
1039613715 8:38938478-38938500 CCATGGCCGGAAGAGGAGCTGGG - Intronic
1039710321 8:40049647-40049669 TCATGGCAAAAGCTGGAGCAAGG - Intergenic
1040045649 8:42961036-42961058 ACATGGCAAGAGTAGGAGCAAGG + Intronic
1042004794 8:64168874-64168896 CCATGGACAGGGGAGCAGCATGG + Intergenic
1042978610 8:74500271-74500293 CCATGGACAAAGTTGGTGCATGG + Intergenic
1043533498 8:81175580-81175602 ACATGGCCAGAGCAGGAGCAAGG + Intergenic
1043564998 8:81538082-81538104 ACATGGCAAGAGCTAGAGCAAGG + Intergenic
1043887770 8:85622195-85622217 CCATTGCTGGAGGTGGAGCCTGG - Intergenic
1044228240 8:89744007-89744029 CCATGGCCAGAGCTGTACCTTGG + Intergenic
1044497334 8:92902437-92902459 ACATGGCCAAAGGTGAAGTACGG + Intronic
1044846699 8:96389036-96389058 CCATGGCCACAGCTGGAAAAAGG - Intergenic
1045211709 8:100106181-100106203 CCCTGCCCAGAGGAGGAGGAAGG - Intronic
1045430762 8:102112846-102112868 ACATGGCCAGAGAGGAAGCAAGG - Intronic
1045501944 8:102750088-102750110 CCAAGGCCAGAGGCGAAGTAGGG + Intergenic
1045598485 8:103685313-103685335 ACATGGCAAGAGAGGGAGCAAGG + Intronic
1046037041 8:108855015-108855037 CAATTGCCAGCAGTGGAGCAAGG + Intergenic
1046177716 8:110600750-110600772 TCATGGCAGGAGGTGAAGCAGGG + Intergenic
1046611386 8:116429461-116429483 CCATGGCCACAGCAGGAGGAAGG + Intergenic
1047924489 8:129669549-129669571 CCATGGCCTGAGTTGTATCATGG - Intergenic
1048378657 8:133844917-133844939 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
1048635575 8:136291827-136291849 ACATAGCCAGAGCAGGAGCAAGG + Intergenic
1049612546 8:143562197-143562219 CCGTGCCCACAGCTGGAGCAGGG + Exonic
1049691301 8:143960970-143960992 GCATGGCCAGACGTGGGTCACGG - Intronic
1050133918 9:2441742-2441764 CCATGGCCATTGTTGGAGAAGGG + Intergenic
1051198018 9:14585286-14585308 TAATGGCCAGATGTAGAGCAAGG + Intergenic
1051262336 9:15276723-15276745 CTAGGGTCAGAGGTGGAGCCAGG - Intronic
1051334512 9:16054174-16054196 CCATGGCCAGAGGGAGCGAAGGG + Intronic
1053201344 9:36153543-36153565 CCATGAACAGAGATGCAGCAAGG - Intronic
1053489678 9:38489155-38489177 CCAGGCCCAGAGGGGGTGCAGGG + Intergenic
1054456161 9:65431485-65431507 GCATGGGCAGAGGTGCAGGAGGG + Intergenic
1055561200 9:77523353-77523375 ACATGGCCAGAGCAGGAACAAGG + Intronic
1057014871 9:91642651-91642673 CCTTGGCCACTGGTGAAGCATGG + Intronic
1057880775 9:98791270-98791292 CCATGCCAAGAGGTGTGGCAAGG + Intronic
1058779232 9:108316851-108316873 CAATGGTCAGAGGTGGCCCAGGG + Intergenic
1059956036 9:119516790-119516812 CCATGCCCAGAGGTTCTGCATGG - Intronic
1060014970 9:120079102-120079124 CCATGTCTTGGGGTGGAGCAGGG + Intergenic
1060250873 9:121986069-121986091 CCTGGGCCAGAGGAGGAGCATGG - Intronic
1060344702 9:122806041-122806063 CCATGGACAGAGGTGGGGAATGG - Intronic
1060548098 9:124472318-124472340 CCATGGCCAGAGGGTGAGAAGGG - Intronic
1060969740 9:127731252-127731274 CCAGGGCCAGAGGTCCAGCAAGG + Exonic
1061057645 9:128232891-128232913 CCATGGCCAGTGCTGGAAGAGGG - Intronic
1061759866 9:132843162-132843184 CCATTGCTAGAGGTGGAGCCTGG + Intronic
1062372894 9:136249264-136249286 CCCTAGGGAGAGGTGGAGCAGGG + Intergenic
1062426174 9:136507246-136507268 CCATGGCCAGGGCAGGGGCAGGG - Intronic
1062572807 9:137193399-137193421 CGAGGGCCAGAGGGGCAGCAGGG - Intronic
1062607134 9:137353395-137353417 CCCTGGCAAGAGGAGGAGCGTGG - Intronic
1185666237 X:1767507-1767529 CCATGGAAAGAGTTGGAGCAGGG - Intergenic
1186626828 X:11303666-11303688 CCATGGCCAAATATGAAGCATGG - Intronic
1187387798 X:18864282-18864304 GCATGGGGAGAGGGGGAGCAGGG - Intergenic
1188348093 X:29093316-29093338 ACATGGCCAGAGCAGGAGGAGGG + Intronic
1189273195 X:39766214-39766236 CCATGGCCAGGGGAGTGGCAAGG + Intergenic
1189347421 X:40252589-40252611 CCAAAGCCAGAGTTGGGGCAAGG + Intergenic
1189654352 X:43226439-43226461 ACATGGCAAGAGAGGGAGCAAGG - Intergenic
1189931707 X:46018974-46018996 TAATGGCCAAAGGTGGAGCAGGG - Intergenic
1190808860 X:53864434-53864456 CTATGGCCTGAGCTTGAGCAGGG + Intergenic
1191717545 X:64204114-64204136 CCACTGCCAGAGGTGCACCATGG + Intronic
1192920048 X:75696817-75696839 CCATGGCCTGAGCTGTACCATGG + Intergenic
1193412806 X:81184287-81184309 ACTTGGCCAGAGCAGGAGCAAGG - Intronic
1193442791 X:81564126-81564148 ACATGGCCATAGTAGGAGCAAGG - Intergenic
1194113983 X:89873425-89873447 CCAGGGCCAGAGAGAGAGCAAGG - Intergenic
1194306665 X:92257129-92257151 ACATGGCCAGAAAAGGAGCAAGG + Intronic
1196096892 X:111809524-111809546 CCACTGCCAGAGGTGCAGGAAGG + Intronic
1197608991 X:128617298-128617320 ACATGGCAAGAGTGGGAGCAAGG + Intergenic
1197622669 X:128768280-128768302 CCATGGACAGAGGTTGAGAAGGG + Intergenic
1197730469 X:129805224-129805246 CCATAGCCAGAGGTGGGCCGAGG + Exonic
1198222258 X:134613375-134613397 CTATGGGCAGAGGCGGAGGAAGG + Intronic
1198460914 X:136862235-136862257 CCATGGACAGAGGAGAAGCTAGG + Intronic
1198773001 X:140150707-140150729 GCAGGCCCAGAGGTGGAGAATGG + Intergenic
1199738578 X:150709697-150709719 ACATGGCCAGAGTGGGAGCAAGG + Intronic
1200257711 X:154593446-154593468 ACATGGCCAGGGCAGGAGCAAGG - Intergenic
1200466722 Y:3528781-3528803 CCAGGGCCAGAGAGAGAGCAAGG - Intergenic
1200740763 Y:6851208-6851230 CCATGGCCAAAAATGAAGCATGG + Intergenic