ID: 1084608712

View in Genome Browser
Species Human (GRCh38)
Location 11:70187213-70187235
Sequence GGGTGCTCACACGTGCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 105}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084608697_1084608712 27 Left 1084608697 11:70187163-70187185 CCAATCCAGGGGGCACCAGCACC 0: 1
1: 0
2: 1
3: 15
4: 223
Right 1084608712 11:70187213-70187235 GGGTGCTCACACGTGCTTGCTGG 0: 1
1: 0
2: 1
3: 8
4: 105
1084608705_1084608712 2 Left 1084608705 11:70187188-70187210 CCGTGGCGGGAACCTGCTCAGCC 0: 1
1: 0
2: 1
3: 12
4: 131
Right 1084608712 11:70187213-70187235 GGGTGCTCACACGTGCTTGCTGG 0: 1
1: 0
2: 1
3: 8
4: 105
1084608702_1084608712 12 Left 1084608702 11:70187178-70187200 CCAGCACCGCCCGTGGCGGGAAC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1084608712 11:70187213-70187235 GGGTGCTCACACGTGCTTGCTGG 0: 1
1: 0
2: 1
3: 8
4: 105
1084608698_1084608712 22 Left 1084608698 11:70187168-70187190 CCAGGGGGCACCAGCACCGCCCG 0: 1
1: 0
2: 1
3: 25
4: 186
Right 1084608712 11:70187213-70187235 GGGTGCTCACACGTGCTTGCTGG 0: 1
1: 0
2: 1
3: 8
4: 105
1084608703_1084608712 6 Left 1084608703 11:70187184-70187206 CCGCCCGTGGCGGGAACCTGCTC 0: 1
1: 0
2: 2
3: 4
4: 63
Right 1084608712 11:70187213-70187235 GGGTGCTCACACGTGCTTGCTGG 0: 1
1: 0
2: 1
3: 8
4: 105
1084608704_1084608712 3 Left 1084608704 11:70187187-70187209 CCCGTGGCGGGAACCTGCTCAGC 0: 1
1: 0
2: 0
3: 16
4: 142
Right 1084608712 11:70187213-70187235 GGGTGCTCACACGTGCTTGCTGG 0: 1
1: 0
2: 1
3: 8
4: 105
1084608710_1084608712 -10 Left 1084608710 11:70187200-70187222 CCTGCTCAGCCGGGGGTGCTCAC 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1084608712 11:70187213-70187235 GGGTGCTCACACGTGCTTGCTGG 0: 1
1: 0
2: 1
3: 8
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084608712 Original CRISPR GGGTGCTCACACGTGCTTGC TGG Intronic
900985008 1:6068279-6068301 GCATGCACACACGTGCGTGCTGG + Intronic
905272691 1:36797185-36797207 TGGTCCTCACCCGTGCTGGCTGG + Exonic
905433921 1:37943964-37943986 GGGTGCTCACACTCGCTCGTTGG + Intronic
916961914 1:169897033-169897055 GGGTGGTCACAAGTTCTGGCCGG + Intergenic
917169234 1:172151690-172151712 GGGTGGTCTCAGGTGCTTCCTGG + Intronic
918434509 1:184497487-184497509 GGGTGCTCCCACCAGCTTTCAGG + Intronic
921814539 1:219548853-219548875 GGGTGCAAGCACTTGCTTGCTGG - Intergenic
1063592067 10:7405156-7405178 GGATGCTCACACTCACTTGCTGG + Intronic
1065817011 10:29491596-29491618 GGGTGGTCACAGATGGTTGCGGG - Intronic
1065955840 10:30692894-30692916 GGGTGGTCACAGATGATTGCGGG + Intergenic
1073441654 10:103555897-103555919 GGGTGCCCACATGTCTTTGCGGG - Intronic
1075732103 10:124642522-124642544 GGGTGCTCAGGCTGGCTTGCAGG + Intronic
1076485109 10:130810837-130810859 GGGCGCACTCAGGTGCTTGCAGG - Intergenic
1077027185 11:446094-446116 TGGTGCTCACACCTGCCTGTGGG - Intergenic
1077138138 11:1011746-1011768 GGGTGGCCACATGTGCTTGAGGG + Exonic
1080224963 11:29950079-29950101 GCTTGGTCACACCTGCTTGCAGG + Intergenic
1084608712 11:70187213-70187235 GGGTGCTCACACGTGCTTGCTGG + Intronic
1085419752 11:76345826-76345848 GGGTCCTTACATGTGCTTCCAGG - Intergenic
1089292681 11:117447732-117447754 GTGTGCTCACACATGCTGGCGGG - Intronic
1104586137 12:130049456-130049478 GGGTGCTCACACTCGCTGGAAGG - Intergenic
1104718882 12:131033680-131033702 GGGTGGCCACAGGGGCTTGCAGG + Intronic
1105578335 13:21673055-21673077 GCTTGCACACACGTGCTTGCCGG + Intronic
1108228568 13:48316160-48316182 GGGAGCTCTCACGTGCTTGCTGG + Intronic
1113933224 13:113979469-113979491 TGGTGCTCACCCGTGGCTGCGGG + Intronic
1119748678 14:77062473-77062495 GTGTGGTCACACCTGCTTGCTGG + Intergenic
1121864677 14:97351543-97351565 TGGTGCTGACACGAGCTGGCAGG + Intergenic
1122299054 14:100721734-100721756 GGGTGCTCCCAGGGGCTTGGAGG - Intergenic
1124139511 15:27064746-27064768 GGGTGTCCACAGGTGCTTTCAGG + Intronic
1127209691 15:56760411-56760433 GGGAGCTCAAACATGCTTGAAGG + Intronic
1132156913 15:99502294-99502316 GGGTGCTCAGAGGTGGTGGCAGG - Intergenic
1133791003 16:9009025-9009047 GGGTTCTCTCTCCTGCTTGCCGG - Intergenic
1134156036 16:11844155-11844177 GGATGCTCAGGTGTGCTTGCAGG - Intronic
1138107634 16:54297784-54297806 GAGTGCTCACAGGTTCCTGCTGG - Intergenic
1142237539 16:88929335-88929357 GGCTGCTCCCACGGGCCTGCGGG + Intronic
1143428729 17:6862961-6862983 GTGTGCACACATGTGCTGGCAGG + Intergenic
1146681468 17:34811304-34811326 GGGTGCTGACACAAGCTTGAGGG + Intergenic
1148152111 17:45403060-45403082 GGGTGGGCACACCTGCTTGCAGG - Intronic
1148293248 17:46475686-46475708 GGGTCCTCAGAGGTGCTTTCAGG + Intergenic
1148315434 17:46693389-46693411 GGGTCCTCAGAGGTGCTTTCAGG + Intronic
1150557550 17:66268034-66268056 GTGTGCTCATACATGCTTGAGGG + Intergenic
1152460441 17:80439450-80439472 GGGAGCCCACACTTGCTGGCGGG + Intergenic
1152830140 17:82492083-82492105 GGGTGCTCACGACTGCTGGCTGG + Intergenic
1155509216 18:26560310-26560332 GGGGGCTCACACGTGGCTGGAGG - Intronic
1156076300 18:33282887-33282909 GAGTGATCACTCCTGCTTGCAGG + Intronic
1157785191 18:50475260-50475282 GGGAGCTGACACGTATTTGCTGG - Intergenic
1160456725 18:79006892-79006914 GGGTGCCCAGACCTGCGTGCGGG - Intergenic
1164528551 19:29029611-29029633 GGCTGCTCACACCTGCCTGTGGG + Intergenic
1165798720 19:38534752-38534774 GGGTGTGCAGCCGTGCTTGCTGG - Exonic
1165825869 19:38705456-38705478 GTGTGCACACAGGTGCTTGCAGG - Intronic
928633879 2:33222460-33222482 GTGTGCACACATGTGCTTGCAGG + Intronic
931084443 2:58813875-58813897 AGGTGACCACATGTGCTTGCTGG - Intergenic
932735911 2:74254517-74254539 AGGTGCTCAAATGTGCTGGCTGG + Intronic
946253715 2:218429046-218429068 AGGTGCTCAAGCGGGCTTGCTGG - Intronic
947667613 2:231917051-231917073 GGGTGCTCACGCATGCCTTCAGG + Intergenic
1172877347 20:38173354-38173376 GGGTGCCGAGAAGTGCTTGCTGG + Intergenic
1175392971 20:58638736-58638758 TGGTGGTCACACGTGAGTGCTGG - Intergenic
1176972995 21:15288329-15288351 GGGTGCTCAAACGTTATTTCTGG + Intergenic
1178974465 21:37209297-37209319 GGGTGCTCCCATGGGCCTGCAGG - Intergenic
1180195711 21:46192290-46192312 AGGAGCTCACACTTGCTTGCTGG + Intronic
1180593811 22:16961143-16961165 TGGTGCTCACAGGTGCTGACAGG + Intergenic
1184047243 22:41979107-41979129 GGGTGCTCATATGTGCTTGTTGG + Intronic
1185149009 22:49153718-49153740 TGGGGCCCACAGGTGCTTGCTGG + Intergenic
952897666 3:38088924-38088946 AGCTGATCACACCTGCTTGCTGG + Intronic
961513997 3:127421663-127421685 GGGCACTCACAGGGGCTTGCTGG - Intergenic
963496185 3:146064443-146064465 GGGGTCTCACATGTGGTTGCAGG + Intergenic
966925230 3:184640252-184640274 GAGTGATCAGACGAGCTTGCTGG - Intronic
972830516 4:42809525-42809547 GAGTGGTCACAACTGCTTGCAGG - Intergenic
975314744 4:72938929-72938951 GGGGGCTCAGGCGTGCATGCTGG - Intergenic
976921506 4:90449543-90449565 GGCAGCTCACACGAGCCTGCAGG - Intronic
977041017 4:92018879-92018901 GGCTGATCACAAGTGCTTTCAGG - Intergenic
984918567 4:184744417-184744439 GGCTCCTCCCACGTGCTGGCAGG + Intergenic
985574275 5:666320-666342 GGATGCTCACACGGCCCTGCAGG + Intronic
986871509 5:12052692-12052714 GGCTGCTCAGAGTTGCTTGCTGG - Intergenic
991577766 5:68122616-68122638 GAGTGATCACTCCTGCTTGCAGG + Intergenic
992888773 5:81185099-81185121 GGGTGATCACAATTGCTAGCAGG - Intronic
997783334 5:136682457-136682479 GGGGGCTCACATGTGCTCACAGG + Intergenic
1002981583 6:2143441-2143463 GGGTGCTCCCACCTGGATGCTGG - Intronic
1004292088 6:14376740-14376762 GGCTGCTCAGTTGTGCTTGCTGG - Intergenic
1008291107 6:49717061-49717083 GGCTGCTCCCAAGTGCTAGCAGG + Intergenic
1010120356 6:72368855-72368877 GGGTGGTCACACTTGGTTGTTGG + Intronic
1012518927 6:100097006-100097028 GGATGCTCTCAGGTCCTTGCAGG + Intergenic
1017893221 6:158656356-158656378 GGCTGCACCCACCTGCTTGCAGG - Intronic
1018992807 6:168686958-168686980 GAATGCTCACAGGGGCTTGCTGG + Intergenic
1022518898 7:30993196-30993218 GGGAACTCACACGTGCCTCCAGG + Intronic
1023554385 7:41405659-41405681 GGGGAATCACACTTGCTTGCAGG - Intergenic
1028052299 7:86203003-86203025 GGTGGCTCACACGGGCCTGCTGG - Intergenic
1038775506 8:30527269-30527291 GGATGCTCACACCAGCTTCCAGG - Intronic
1038928376 8:32165878-32165900 ATGTGCTCACAGGTGCTTTCGGG - Intronic
1039264465 8:35809286-35809308 GAGTGGCCACACCTGCTTGCAGG + Intergenic
1048553943 8:135457502-135457524 GGGTGCTGGCAGGTGCTGGCGGG + Exonic
1049179545 8:141215082-141215104 GGATTCACTCACGTGCTTGCTGG - Intronic
1051888717 9:21922249-21922271 GGCCGCTCACAAGTGCTGGCAGG + Intronic
1057442724 9:95093678-95093700 GGGCCTGCACACGTGCTTGCCGG - Intergenic
1059149725 9:111938562-111938584 GGGTGCCCACAGCTGCTTCCGGG - Intergenic
1060337127 9:122735774-122735796 GAATGCTCACACGTGGTTGGTGG + Intergenic
1061536372 9:131252637-131252659 GGGTGCCCACACCAGCCTGCTGG - Intergenic
1061675756 9:132214622-132214644 GGGCGCACTCACTTGCTTGCTGG - Intronic
1189248288 X:39580425-39580447 GGCTGATTACACGTGCTGGCTGG - Intergenic
1189915295 X:45850838-45850860 GGGTGCTCCCTCGCGCTTTCGGG - Intergenic
1189940619 X:46117314-46117336 GAGTGATCACTCCTGCTTGCGGG - Intergenic
1190524046 X:51310741-51310763 GAGTGATCACTCCTGCTTGCAGG - Intergenic
1191038790 X:56057025-56057047 GGGTGCTAACAGGGGCTTGGGGG + Intergenic
1192926578 X:75760221-75760243 GAGTGATCACTCCTGCTTGCAGG + Intergenic
1196752943 X:119133593-119133615 GGGTGCTCACACCTGCTCCTAGG - Intronic
1197076798 X:122363308-122363330 GAGTGATCACTCTTGCTTGCAGG - Intergenic
1200684655 Y:6247496-6247518 AGGTGCTCACTCTTGCTTACAGG - Intronic
1200990184 Y:9338761-9338783 AGGTGCTCACTCTTGCTTACAGG - Intronic
1200992846 Y:9359076-9359098 AGGTGCTCACTCTTGCTTACAGG - Intronic
1200995499 Y:9379354-9379376 AGGTGCTCACTCTTGCTTACAGG - Intronic
1200998165 Y:9399700-9399722 AGGTGCTCACTCTTGCTTACAGG - Intronic
1201000673 Y:9468234-9468256 AGGTGCTCACTCTTGCTTACAGG - Intronic
1201003340 Y:9488564-9488586 AGGTGCTCACTCTTGCTTACAGG - Intronic
1201005996 Y:9508846-9508868 AGGTGCTCACTCTTGCTTACAGG - Intergenic
1201008654 Y:9529159-9529181 AGGTGCTCACTCTTGCTTACAGG - Intronic
1201968345 Y:19763060-19763082 GGTTGCACACACATGCATGCTGG + Intergenic