ID: 1084610862

View in Genome Browser
Species Human (GRCh38)
Location 11:70202281-70202303
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084610862_1084610867 -8 Left 1084610862 11:70202281-70202303 CCTCCTCACCTCCAGACCCACGG No data
Right 1084610867 11:70202296-70202318 ACCCACGGCATTGCTGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084610862 Original CRISPR CCGTGGGTCTGGAGGTGAGG AGG (reversed) Intergenic
No off target data available for this crispr