ID: 1084611759 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:70207701-70207723 |
Sequence | GGGACAGTGTCCTGCGGCCT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1084611759_1084611761 | -10 | Left | 1084611759 | 11:70207701-70207723 | CCAAGGCCGCAGGACACTGTCCC | No data | ||
Right | 1084611761 | 11:70207714-70207736 | ACACTGTCCCCAGTAAGCCGTGG | No data | ||||
1084611759_1084611763 | -3 | Left | 1084611759 | 11:70207701-70207723 | CCAAGGCCGCAGGACACTGTCCC | No data | ||
Right | 1084611763 | 11:70207721-70207743 | CCCCAGTAAGCCGTGGACCCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1084611759 | Original CRISPR | GGGACAGTGTCCTGCGGCCT TGG (reversed) | Intergenic | ||