ID: 1084611759

View in Genome Browser
Species Human (GRCh38)
Location 11:70207701-70207723
Sequence GGGACAGTGTCCTGCGGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084611759_1084611761 -10 Left 1084611759 11:70207701-70207723 CCAAGGCCGCAGGACACTGTCCC No data
Right 1084611761 11:70207714-70207736 ACACTGTCCCCAGTAAGCCGTGG No data
1084611759_1084611763 -3 Left 1084611759 11:70207701-70207723 CCAAGGCCGCAGGACACTGTCCC No data
Right 1084611763 11:70207721-70207743 CCCCAGTAAGCCGTGGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084611759 Original CRISPR GGGACAGTGTCCTGCGGCCT TGG (reversed) Intergenic