ID: 1084617194

View in Genome Browser
Species Human (GRCh38)
Location 11:70244412-70244434
Sequence CTTGAGCCCTTGGGAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084617194_1084617202 21 Left 1084617194 11:70244412-70244434 CCTGCTTTTCCCAAGGGCTCAAG No data
Right 1084617202 11:70244456-70244478 TTCTAGCTCCTCGTGGTTTTCGG No data
1084617194_1084617201 14 Left 1084617194 11:70244412-70244434 CCTGCTTTTCCCAAGGGCTCAAG No data
Right 1084617201 11:70244449-70244471 TTGTCTCTTCTAGCTCCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084617194 Original CRISPR CTTGAGCCCTTGGGAAAAGC AGG (reversed) Intergenic
No off target data available for this crispr