ID: 1084617201

View in Genome Browser
Species Human (GRCh38)
Location 11:70244449-70244471
Sequence TTGTCTCTTCTAGCTCCTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084617198_1084617201 4 Left 1084617198 11:70244422-70244444 CCAAGGGCTCAAGGGAAGAATCC No data
Right 1084617201 11:70244449-70244471 TTGTCTCTTCTAGCTCCTCGTGG No data
1084617194_1084617201 14 Left 1084617194 11:70244412-70244434 CCTGCTTTTCCCAAGGGCTCAAG No data
Right 1084617201 11:70244449-70244471 TTGTCTCTTCTAGCTCCTCGTGG No data
1084617197_1084617201 5 Left 1084617197 11:70244421-70244443 CCCAAGGGCTCAAGGGAAGAATC No data
Right 1084617201 11:70244449-70244471 TTGTCTCTTCTAGCTCCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084617201 Original CRISPR TTGTCTCTTCTAGCTCCTCG TGG Intergenic
No off target data available for this crispr