ID: 1084620817

View in Genome Browser
Species Human (GRCh38)
Location 11:70269400-70269422
Sequence GCTGTTGGTGTGAGGCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084620817_1084620823 2 Left 1084620817 11:70269400-70269422 CCTGGCTGCCTCACACCAACAGC No data
Right 1084620823 11:70269425-70269447 TGGCCAGTGGACACTGGCGATGG No data
1084620817_1084620822 -4 Left 1084620817 11:70269400-70269422 CCTGGCTGCCTCACACCAACAGC No data
Right 1084620822 11:70269419-70269441 CAGCAGTGGCCAGTGGACACTGG No data
1084620817_1084620825 18 Left 1084620817 11:70269400-70269422 CCTGGCTGCCTCACACCAACAGC No data
Right 1084620825 11:70269441-70269463 GCGATGGTGTCCTGACATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084620817 Original CRISPR GCTGTTGGTGTGAGGCAGCC AGG (reversed) Intergenic
No off target data available for this crispr