ID: 1084622807

View in Genome Browser
Species Human (GRCh38)
Location 11:70285009-70285031
Sequence ATGTATTTCTTTATTTAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6372
Summary {0: 1, 1: 4, 2: 157, 3: 1657, 4: 4553}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084622807 Original CRISPR ATGTATTTCTTTATTTAAGA TGG Intronic
Too many off-targets to display for this crispr