ID: 1084626902

View in Genome Browser
Species Human (GRCh38)
Location 11:70314704-70314726
Sequence TTATGTGGTCCCTAAATACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084626902 Original CRISPR TTATGTGGTCCCTAAATACT AGG Intronic
903001948 1:20272701-20272723 TTATTTGATCCCTAACTACTTGG - Intergenic
915740140 1:158113134-158113156 TGATGTCATCGCTAAATACTAGG + Intergenic
917431597 1:174975110-174975132 ATAGGTGCTCCCTAAGTACTTGG - Intronic
917944943 1:179959951-179959973 TAATGTTGTCCATAAGTACTTGG + Intronic
918877916 1:190073573-190073595 TTATTTGGACCTTACATACTTGG + Intergenic
924187847 1:241514966-241514988 TTTTATGGTCCATAAACACTGGG - Intronic
1068567098 10:58588383-58588405 ATATGAGGACCCCAAATACTCGG - Intronic
1069733584 10:70635727-70635749 TTATATTGCCCCTAAATATTTGG - Intergenic
1071466308 10:85942763-85942785 CTATGTGTTGCCTGAATACTGGG + Intronic
1072636925 10:97184479-97184501 TAAGGTGGCCCCTTAATACTAGG + Intronic
1073822488 10:107280689-107280711 TTATGTGGTGGCAAAATATTTGG + Intergenic
1080086294 11:28286720-28286742 TTATGTGTTCCTTAACTTCTGGG + Intronic
1081436541 11:43033570-43033592 TTAGGTGCTCCATAAATATTTGG - Intergenic
1082638728 11:55628714-55628736 TTCTCTGGTCCCTCAAGACTAGG + Intergenic
1083700687 11:64475819-64475841 TCATGTGGACCCTAAATCCAAGG - Intergenic
1084626902 11:70314704-70314726 TTATGTGGTCCCTAAATACTAGG + Intronic
1085892179 11:80593611-80593633 TTATGTGCTCCCTATGTATTAGG + Intergenic
1086111576 11:83204411-83204433 ATATGTGGGACCTAAATATTGGG + Intronic
1087024676 11:93637794-93637816 TTATGTGCTGCCTAAATAGAAGG - Intergenic
1088475642 11:110235922-110235944 TTCTGTGTTCCCAAAGTACTTGG + Intronic
1088885982 11:114007393-114007415 TTGTGTGGTCCCTTAAATCTGGG + Intergenic
1094185506 12:27638259-27638281 TTCTGTGTTCCTTAAATTCTAGG - Intronic
1094401447 12:30064952-30064974 TTTTTTGGTCCCTAAAGCCTTGG - Intergenic
1097651939 12:62309479-62309501 TTATGGCTTCCCTAAATATTTGG - Intronic
1097965571 12:65576187-65576209 TTATATGTTCCCTAAATATTTGG - Intergenic
1098225617 12:68319523-68319545 TTATGAGGTTCCTAAATATAAGG - Intronic
1099377949 12:81916850-81916872 TTATGTCTTTCATAAATACTAGG + Intergenic
1100340165 12:93671153-93671175 TTCTGTGATCTCCAAATACTTGG + Intergenic
1100849852 12:98698037-98698059 TTATGTGGTCCCTCAATATGTGG + Intronic
1100852751 12:98730382-98730404 TGATGTGGTCTCTAGAAACTTGG - Intronic
1100867636 12:98874128-98874150 TTTTGTGGTACCTAAATATTTGG - Intronic
1108903621 13:55444015-55444037 TTATATGGTCTCTGAAAACTGGG + Intergenic
1110327366 13:74232187-74232209 TTATGTGCTTCCTAAAGAATGGG + Intergenic
1111462273 13:88560975-88560997 TAATGTGATGCCTAAAAACTAGG + Intergenic
1111820555 13:93208455-93208477 TTATGGTGACCCCAAATACTAGG - Intergenic
1113700126 13:112378599-112378621 ACATGTGGTACCTAAAGACTTGG + Intronic
1114277449 14:21159542-21159564 TTATGTGGTTCCCAAATATTTGG + Intergenic
1114277917 14:21164696-21164718 TTATGTGGTTCCCAAATATTTGG - Intergenic
1115819304 14:37197142-37197164 GTATGTGGTCACTAAGTATTTGG + Intergenic
1116010803 14:39349545-39349567 ATATGTGGTTACCAAATACTAGG + Intronic
1116055946 14:39863946-39863968 TTATGTGGTTCCTAAAAAGGTGG + Intergenic
1116122533 14:40738389-40738411 TTAAGTGTTCCTTAAATACTTGG - Intergenic
1116632945 14:47357072-47357094 CTTTGGGGTCCCTAATTACTTGG + Intronic
1116860707 14:49993501-49993523 TTGTTTGGTCCCTCAAAACTGGG + Intronic
1117906014 14:60588273-60588295 TTATGAGGTGACCAAATACTTGG + Intergenic
1118695072 14:68376636-68376658 CTATGTGGTCTCTGAATACCAGG - Intronic
1125483121 15:40093936-40093958 CTATGTGGTCGCTAAGTAATGGG - Intronic
1129049442 15:72767660-72767682 TTATTTAGTTCCTAAATATTTGG - Intronic
1129446479 15:75622480-75622502 TTAGGTGGACCCTAAAGAATGGG + Intronic
1129918612 15:79298338-79298360 TTATGTGTTCCTAAAATATTGGG - Intergenic
1137900643 16:52264306-52264328 TCCTTTGGTTCCTAAATACTAGG + Intergenic
1140070689 16:71647376-71647398 TTATGTGGTTTCAGAATACTGGG - Exonic
1148128218 17:45247663-45247685 TTATGGCGTCACTAAGTACTGGG - Intergenic
1148728592 17:49815678-49815700 TTATTTAGTGCCTACATACTAGG - Intronic
1150446284 17:65229173-65229195 TTATTTAGCCCATAAATACTGGG + Intergenic
1157603157 18:48907726-48907748 TTATGTGCTCACTATATAATAGG - Intergenic
925694527 2:6561918-6561940 TTATGGGGTGCCTAGATATTTGG + Intergenic
928485370 2:31725709-31725731 TTAAGTGGAAGCTAAATACTGGG + Intergenic
929272831 2:39992210-39992232 TTATCTGTTCCTTAAATATTTGG + Intergenic
929464388 2:42131610-42131632 TTATATGCTGCCTAAGTACTAGG + Intergenic
929679237 2:43972537-43972559 TTCTGTGGTTCCAAAACACTGGG + Intronic
931057362 2:58487536-58487558 ATATGTGGTCCTTAAACACCAGG + Intergenic
933279742 2:80319940-80319962 TTATCTGCTCCCAAAATAGTTGG - Intronic
942195636 2:173516472-173516494 TAATTTGGTGCCTAAATATTGGG + Intergenic
942945740 2:181670704-181670726 TGATGTGGGCCCCAAATCCTTGG + Intronic
944558062 2:200907183-200907205 AGATGTTGACCCTAAATACTTGG + Intergenic
944945547 2:204680142-204680164 TTATTTGTTCCTTAAATATTAGG + Intronic
945052171 2:205834487-205834509 TCAAGTGGTCCCCAAAGACTGGG - Intergenic
1169652710 20:7887454-7887476 GCATGTGGTCCCTAAATGTTTGG + Intronic
1170185185 20:13581357-13581379 TTTTGTGGTCACTAAATGCCTGG - Intronic
1171210597 20:23313688-23313710 ATATGTCACCCCTAAATACTTGG + Intergenic
1172047197 20:32088701-32088723 GTATGTGGTCAGTAAATATTTGG - Intronic
1172395243 20:34598918-34598940 TTATTTGGGCCCTAACTCCTGGG + Intronic
1184325244 22:43778190-43778212 TCATGTGGCTGCTAAATACTGGG - Intronic
950864436 3:16177521-16177543 TTATGTGGTGCCTATATGCTTGG + Intronic
955385126 3:58473212-58473234 CTATGAGCTCCATAAATACTTGG + Intergenic
956977945 3:74603335-74603357 ATATGTGGTCCTTAAATAGTGGG + Intergenic
957304049 3:78433024-78433046 TTAAGTGGTGCCTGACTACTTGG - Intergenic
957775421 3:84752261-84752283 TCATTTGGTTCCTAAAAACTTGG - Intergenic
959345219 3:105185928-105185950 TTATGTGGGAGCTAAATATTAGG - Intergenic
959616910 3:108358963-108358985 TTATGTGATCTTCAAATACTTGG + Intronic
960384161 3:117000607-117000629 TTATATGGTGCCTACCTACTTGG - Intronic
963656263 3:148055218-148055240 TTATTTGGTGCCTAAGTGCTAGG - Intergenic
964321374 3:155501469-155501491 GTCTGTGTTGCCTAAATACTGGG - Intronic
965272074 3:166629828-166629850 TTATGTGGTCCTAACATTCTTGG - Intergenic
966847806 3:184144116-184144138 TTATGTAGTTCCTAAAAACAGGG - Exonic
966970283 3:185039205-185039227 TCATTTGGTCTTTAAATACTTGG + Intronic
967640182 3:191853225-191853247 CTATCTGGTCCCTAAATGATGGG - Intergenic
971202543 4:24524365-24524387 TTTAGTGGTCCCTAAAAAATGGG - Intronic
971432926 4:26587722-26587744 TTATTTGCTCCTTAAATATTTGG + Intronic
971523716 4:27588618-27588640 TTATGGGTTCCATAAATAATAGG + Intergenic
971612452 4:28743203-28743225 TTATCTGTTCCCTAAAGATTTGG - Intergenic
972086148 4:35219200-35219222 TTATATGATCTCTAAATTCTGGG + Intergenic
974629659 4:64469116-64469138 TTATGTGATCCCAGAATAGTTGG - Intergenic
974729419 4:65842799-65842821 TTATTTGTTCCATAAATATTTGG + Intergenic
974851523 4:67410349-67410371 TTTTTAGGTCTCTAAATACTTGG + Intergenic
975655023 4:76632931-76632953 CTATGTGCTCTATAAATACTGGG - Intronic
978278598 4:106981967-106981989 TTATGTGCTCAATAAATATTGGG + Intronic
978278671 4:106983175-106983197 TTATGTGCTCAGTAAATACTGGG + Intronic
978704215 4:111686038-111686060 TTATGTCTTCCCTAACTACAAGG + Intergenic
980713890 4:136607564-136607586 AGAGGTGGTCCCTAAAGACTTGG + Intergenic
988947530 5:36221086-36221108 TTAAAGGGTACCTAAATACTAGG + Intronic
990017040 5:51076081-51076103 TTATGTGCTCTATAAATATTTGG + Intergenic
997923084 5:138001326-138001348 TTAAGAGCTCCCTATATACTAGG + Intronic
1000133985 5:158326495-158326517 TTATGTGCCTCCTAAACACTTGG + Intergenic
1004462528 6:15851493-15851515 TTATGTGGTAGCAAAACACTTGG + Intergenic
1007798528 6:44371606-44371628 TCATGTTTTCCTTAAATACTTGG + Intronic
1010836961 6:80600119-80600141 TTATGTGATCCATAAATAGCAGG + Intergenic
1012237004 6:96830515-96830537 TTATCTGCTCCCTTAATACCTGG - Intronic
1012756378 6:103237034-103237056 ATATTTGGTCCCAGAATACTTGG + Intergenic
1014558983 6:122867981-122868003 TTAGGTGCTCACTAAATATTAGG + Intergenic
1015235650 6:130967850-130967872 ATAAATGTTCCCTAAATACTAGG - Intronic
1016726654 6:147378139-147378161 TTATTTTTTCCCTAAATATTTGG - Intronic
1020969033 7:14910113-14910135 TAATGTAGTCCCTAGCTACTTGG + Intronic
1022310424 7:29191759-29191781 TTATGTGTTGCCTTAATTCTAGG - Intronic
1023487113 7:40699145-40699167 GTATGTGCTCCATAAATATTTGG - Intronic
1024780080 7:52837461-52837483 TTATATTGTCTCAAAATACTGGG + Intergenic
1026461204 7:70616616-70616638 ATATGTGGTCAATACATACTTGG + Intronic
1027026559 7:74856328-74856350 TTATTTGGTCTCCAAATATTTGG - Intergenic
1027061196 7:75087786-75087808 TTATTTGGTCTCCAAATATTTGG + Intergenic
1030175915 7:106653182-106653204 TCATTTGGTCACAAAATACTAGG + Intergenic
1031206849 7:118770095-118770117 TTAGGTGCTCAGTAAATACTTGG + Intergenic
1032069624 7:128795798-128795820 TTATGAGGTGCCTTTATACTTGG + Intronic
1032477958 7:132225231-132225253 ACATGTGGTGCCTAAACACTGGG + Intronic
1038794320 8:30696294-30696316 TTATGTTGTCGTTAAATACTAGG - Intronic
1039137116 8:34337801-34337823 TTAAGTGGGAGCTAAATACTCGG + Intergenic
1042358702 8:67857788-67857810 GTATGGGGTCCCCAAAGACTAGG - Intergenic
1043695801 8:83215717-83215739 TTAAGTGGAAGCTAAATACTGGG - Intergenic
1047127741 8:121981356-121981378 TTATTTCTTCCTTAAATACTTGG + Intergenic
1049473438 8:142786398-142786420 CTGTGTGGTCACCAAATACTAGG - Intronic
1051228428 9:14927613-14927635 TGATGGGGCCCCTGAATACTGGG + Intergenic
1052494158 9:29205623-29205645 TTATTTCTTCCCTAAATATTAGG + Intergenic
1055746569 9:79452989-79453011 TTATTTTTTCCCTAAATACTTGG + Intergenic
1056473959 9:86934933-86934955 TGATGTTGTGTCTAAATACTTGG - Intergenic
1056480643 9:87000794-87000816 TTAATTGCTCCTTAAATACTTGG + Intergenic
1058142354 9:101370612-101370634 TTATGTAGTCCCTACATTATGGG - Intronic
1062455221 9:136633521-136633543 TTATTTGTTCCCTAAATGTTTGG - Intergenic
1186302133 X:8211869-8211891 TTATGTAGTCACAACATACTTGG + Intergenic
1186472657 X:9833513-9833535 TTATGAGGTCCCTAATTAGGAGG - Intronic
1186696819 X:12043560-12043582 TCCAGTGGTCCCCAAATACTGGG + Intergenic
1190573135 X:51805209-51805231 ATATGTTGTCCATAAATATTTGG + Intronic
1193024596 X:76831904-76831926 TTATGTGGTGCTTAAATAATGGG - Intergenic
1194312444 X:92328846-92328868 TTATTTAGTCCTTAAATATTTGG - Intronic
1200413956 Y:2889130-2889152 TTATATGGGCCTGAAATACTAGG - Intronic
1200620711 Y:5442977-5442999 TTATTTAGTCCTTAAATATTTGG - Intronic