ID: 1084628123

View in Genome Browser
Species Human (GRCh38)
Location 11:70324599-70324621
Sequence AAAGGTATGAAAAGTATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 433}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084628123_1084628127 24 Left 1084628123 11:70324599-70324621 CCTGAAATACTTTTCATACCTTT 0: 1
1: 0
2: 3
3: 44
4: 433
Right 1084628127 11:70324646-70324668 TCAGCATGATCACACATTAATGG 0: 1
1: 0
2: 1
3: 15
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084628123 Original CRISPR AAAGGTATGAAAAGTATTTC AGG (reversed) Intronic
901131809 1:6966592-6966614 AAAGGTTTCAAAAGTGTTTAGGG - Intronic
901258714 1:7855572-7855594 AAAGGTTTGAAAAGGACTTCAGG + Intergenic
901924376 1:12556682-12556704 AAAGGAATGATAAGGATTTGTGG + Intergenic
902423646 1:16302103-16302125 GAAGGTATGAATAGTATATTAGG + Intronic
902483174 1:16723151-16723173 AAAGGCCTGAAAAGTAACTCAGG + Intergenic
902600201 1:17535764-17535786 AAAGGAACAAAAAGGATTTCTGG - Intergenic
902853996 1:19186299-19186321 AAAGGAATGAAAAGTAACCCAGG + Intronic
902913244 1:19617194-19617216 AAAGGTATGAAAGGTAAATGTGG - Intronic
904195701 1:28783851-28783873 GAAGGTATGAAATGGATTCCAGG + Intergenic
904354892 1:29932611-29932633 AAAGGTGGGAAAAGTTTTACAGG + Intergenic
904376240 1:30084191-30084213 AAGGGTATGAAAGATATGTCGGG + Intergenic
905467668 1:38167629-38167651 ACAGATGTGAAAAGTATTTCCGG - Intergenic
906464584 1:46065344-46065366 ATAAATATGAAAAGTATTACTGG + Intronic
907578753 1:55552927-55552949 AAGGGTAGGAAACTTATTTCAGG + Intergenic
907727473 1:57033103-57033125 AGAGGTTTGAAAAATATTGCTGG + Intronic
908231078 1:62105653-62105675 AAAGGTCTAAAATGTATTCCTGG + Intronic
909580569 1:77228853-77228875 GGAGGGAAGAAAAGTATTTCAGG - Intergenic
910378631 1:86600887-86600909 AAGGGTATGAAAATTTTTTCTGG - Intergenic
911251316 1:95579709-95579731 AAAGGTTTGGAAAGTCCTTCAGG - Intergenic
911648580 1:100361608-100361630 AAAGGAAAGAAAAAGATTTCAGG + Intronic
913405192 1:118483276-118483298 ATAGGTAGGAAAAGCATTTCAGG - Intergenic
914228099 1:145738801-145738823 AGAGGGAGGAAAAGTTTTTCTGG - Exonic
915856423 1:159391780-159391802 AAAGATATGCAAATTATTTCAGG + Intergenic
916241327 1:162642805-162642827 TAACAAATGAAAAGTATTTCAGG - Intronic
917027035 1:170655726-170655748 AAAGGCAAGAAAAGAATGTCAGG + Intergenic
917625145 1:176838344-176838366 ACATGTAAGAAAAGTATTTTGGG + Intronic
918157055 1:181858308-181858330 AAAGGTATGGTAATTAATTCCGG + Intergenic
918940678 1:190992513-190992535 AAAAGAATGAAAAGTATTGAGGG - Intergenic
919346520 1:196386566-196386588 AAAGGTAAGTAATATATTTCTGG + Intronic
920672939 1:208018346-208018368 AAGGGTCTGAAAAGGATTTGGGG - Intergenic
921248685 1:213275694-213275716 AAAGAAATGATAAGTATTTGAGG - Intergenic
921255225 1:213332779-213332801 GTAGGTATGAAAAGTATATAAGG - Intergenic
923169244 1:231398056-231398078 AATGCTATGAGAATTATTTCTGG + Intronic
923688289 1:236169410-236169432 AATGGTCAGAACAGTATTTCTGG - Intronic
924723624 1:246646393-246646415 AAATGTAAGAAAAGTAGTACTGG - Intronic
1064686068 10:17863569-17863591 TAAGGCCTGAAAAATATTTCTGG + Exonic
1065349169 10:24780488-24780510 AAATATATGAAAAATATTTCAGG + Intergenic
1066419654 10:35252617-35252639 TGAGGTATGAAAAATATTGCTGG + Intronic
1068088332 10:52402097-52402119 AAAGGTATTATGAATATTTCTGG - Intergenic
1068183456 10:53553292-53553314 CAAGGTATGAAAACTTTTTTTGG + Intergenic
1068189506 10:53632696-53632718 CAGGGTATGGCAAGTATTTCAGG - Intergenic
1068729512 10:60340710-60340732 AAAGGTAATAATAGTATCTCTGG - Intronic
1071013367 10:80965585-80965607 AAAGTTTTGAAAATTATTCCTGG + Intergenic
1072103276 10:92249716-92249738 AAGGGTATAAAAAATATTTTTGG + Intronic
1072599109 10:96907327-96907349 AAAGGTATTCAAAATATTTTTGG + Exonic
1072868933 10:99095864-99095886 AAAAGTGTGAAAAGTATACCAGG - Intronic
1074872691 10:117589419-117589441 TCAGGGATTAAAAGTATTTCAGG + Intergenic
1075151481 10:119936715-119936737 AACGGTATTATAACTATTTCTGG - Intronic
1076557677 10:131339028-131339050 AAAGATATGAATGGAATTTCTGG + Intergenic
1077758050 11:5057347-5057369 AAAGATATAAAAAATATTTGGGG + Intergenic
1078299114 11:10107648-10107670 AAAGGAATGCCAAGTATTGCTGG - Intronic
1078861820 11:15255325-15255347 ATAGATATGAAAATTATTTCAGG + Intergenic
1078957779 11:16221124-16221146 AAAACTATGAAAATTATTTCAGG - Intronic
1079199146 11:18359960-18359982 AAAATTATGAAAAGTAGCTCAGG + Intronic
1079841226 11:25401954-25401976 AAAGGTTTGAAAGGTCTTTGGGG + Intergenic
1080300127 11:30775028-30775050 AAACGTATGAAAAGAAGTCCAGG - Intergenic
1080649425 11:34210305-34210327 GAAGGGATAAAAAGGATTTCAGG - Intronic
1081024192 11:37988348-37988370 AAAGGTTTGAAAACTAGTTTTGG + Intergenic
1081188826 11:40078863-40078885 AAAGGGAAGAAAAGTATTGATGG - Intergenic
1081273390 11:41116046-41116068 AAAGACATGAAAAGTAATACAGG - Intronic
1081460301 11:43266658-43266680 ACAGGTAGGTAAAGTATTTAAGG + Intergenic
1084628123 11:70324599-70324621 AAAGGTATGAAAAGTATTTCAGG - Intronic
1085924163 11:80995612-80995634 AAAAATATTAACAGTATTTCTGG + Intergenic
1086165846 11:83776752-83776774 AAAAGGAGGAAGAGTATTTCAGG - Intronic
1086346990 11:85907013-85907035 AAAGTAATTAAAACTATTTCTGG + Intronic
1086855758 11:91863476-91863498 AATTGTAGGAAGAGTATTTCAGG - Intergenic
1089145913 11:116329635-116329657 ATGGGTAGGGAAAGTATTTCCGG + Intergenic
1089247082 11:117129669-117129691 AAAGAAATGATAAGTATTTGTGG - Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1089412145 11:118253581-118253603 AAATGTATGGACAGTTTTTCCGG - Exonic
1090175724 11:124647661-124647683 AGAGGCTTGAAAAGTACTTCAGG + Intronic
1091103113 11:132894153-132894175 ACATTAATGAAAAGTATTTCAGG - Intronic
1091567637 12:1660895-1660917 AGAAGTATTAAAAGTATTTTAGG - Intergenic
1092048589 12:5451582-5451604 AAGGGTATTGAAGGTATTTCTGG - Intronic
1092639829 12:10493777-10493799 AAAGGTAGGTACAGTATTCCTGG - Intergenic
1093197011 12:16141586-16141608 AAAGGTAATAGAATTATTTCAGG + Intergenic
1093679127 12:21980627-21980649 AAAGGAATAAAAGGTATTTCAGG + Intergenic
1093755567 12:22848328-22848350 ATAGGGAGGAAAAGCATTTCAGG - Intergenic
1094671538 12:32574865-32574887 GAAGGTAAGAAAAGGATTTAAGG + Intronic
1094714743 12:33001808-33001830 AAAGAAATGATAAATATTTCAGG - Intergenic
1094720587 12:33059103-33059125 AAAGGGATGAAATGCATCTCAGG - Intergenic
1095370998 12:41467141-41467163 AAAGATATGAACAATATTTGTGG - Intronic
1095543277 12:43336262-43336284 AAAAGTAAGAAAAATATTTCTGG + Intergenic
1097118176 12:56714338-56714360 TAAGATTTGAAAAGGATTTCAGG - Intronic
1098301458 12:69058523-69058545 AAAGGAATAAAAAGTGTTTGAGG - Intergenic
1099073829 12:78080488-78080510 AAGGGTAGGAAAAGTATCTCTGG - Intronic
1099179720 12:79462898-79462920 AATAGTATGAAAAATATTACAGG - Intergenic
1099493818 12:83319733-83319755 AGAATTATGAGAAGTATTTCTGG + Intergenic
1099575532 12:84375246-84375268 ATATGAATGAATAGTATTTCCGG + Intergenic
1099705360 12:86145751-86145773 AAAAGAATGAAAATTATTTTAGG + Intronic
1100921671 12:99495020-99495042 CAAGGGAGGAAAAGTATCTCAGG + Intronic
1101341249 12:103842911-103842933 TTAGGTATGAAAAGTAATTGAGG - Intronic
1101665728 12:106811769-106811791 GAAGGTATGAAAGGTGTTTGAGG + Intronic
1102374880 12:112414114-112414136 AAGGGTTTGAAGAGTATTCCAGG + Intronic
1102666206 12:114575454-114575476 CAAGACATGAAATGTATTTCTGG - Intergenic
1103262839 12:119603425-119603447 AATAGTAAGAAAACTATTTCTGG + Intronic
1104342552 12:127964669-127964691 AAAGATGTGAAAAGTATGTAGGG + Intergenic
1104375281 12:128260569-128260591 CATGATAGGAAAAGTATTTCAGG + Intergenic
1106241328 13:27915989-27916011 AAAAGTATGAAAGGACTTTCAGG - Intergenic
1106276970 13:28218973-28218995 AACAGAATGAAAAGTATGTCAGG - Intronic
1106644758 13:31620569-31620591 AAAGAAATGAAAAGTGTTTGAGG - Intergenic
1106761181 13:32869398-32869420 CATAGTATGAAAAGTATTCCCGG - Intergenic
1106945556 13:34823877-34823899 AGAGGAATGATATGTATTTCAGG - Intergenic
1107140776 13:36996706-36996728 ATATGTATGAAAGGTATTTTAGG + Intronic
1107407052 13:40124429-40124451 AGAGGTCTGAAAAGGTTTTCTGG - Intergenic
1108726494 13:53188559-53188581 CAAGGTATGAAATGCATTACTGG - Intergenic
1108961128 13:56231753-56231775 AAAGGAATGAAATGAAGTTCTGG - Intergenic
1109658013 13:65420157-65420179 AAAGGTATGAGAAATATTTGGGG + Intergenic
1109748575 13:66659657-66659679 AAATGTTTAAAAAGTCTTTCAGG - Intronic
1109786309 13:67179939-67179961 AAATGTATGATCTGTATTTCAGG + Intronic
1109969264 13:69743903-69743925 AAAAGTTTGAAAATTATTTTTGG + Intronic
1110255904 13:73433705-73433727 AAAGGCATGAATAGTATTTCTGG + Intergenic
1110309132 13:74026816-74026838 AAAGGTAGGAAAAAGATTCCAGG + Intronic
1110769908 13:79330305-79330327 AAAACTATGAAAAGTAATTGTGG + Intronic
1111270549 13:85877503-85877525 AAAGGTAAAAAGAGTAATTCTGG - Intergenic
1111394875 13:87652200-87652222 AAACTTATGAAAGTTATTTCAGG + Intergenic
1112073330 13:95879847-95879869 AAAGGTATTAAATTTATGTCTGG - Intronic
1112158514 13:96844430-96844452 AAAGGAATGAAAATTTTATCAGG + Intergenic
1112892441 13:104254889-104254911 TCAAGTATGAAAAATATTTCAGG + Intergenic
1113117917 13:106893150-106893172 AAAAGTTTGAAAGGTATTGCAGG + Intergenic
1113159105 13:107359104-107359126 AGAGGAATGAACAGAATTTCAGG - Intronic
1113498582 13:110754729-110754751 AAAGGTTAGAAAAGTATTCGTGG + Intergenic
1113832738 13:113309446-113309468 AAAAGACTGAAAAGTATTTCAGG - Intronic
1114602013 14:23964508-23964530 AAATGTATGCTAAGTATTTGGGG + Intronic
1114606185 14:23999626-23999648 AAATGTATGCTAAGTATTTGGGG + Intronic
1114826247 14:26084079-26084101 AAAGGGCTGAAAAGTTTTCCAGG - Intergenic
1115834310 14:37380927-37380949 AAAGGTTGGAAAAGCATTCCAGG - Intronic
1116138790 14:40960865-40960887 AAAGGTATGAAATTATTTTCTGG + Intergenic
1116793451 14:49364427-49364449 AAAGACATTAAAAATATTTCAGG + Intergenic
1117570912 14:57048335-57048357 AAAGGAATGATAAATATTTGAGG - Intergenic
1118238491 14:64033846-64033868 AAACTTATGAAAATTATTTGAGG - Intronic
1118568379 14:67167992-67168014 AAAGTTATGAGAAGAATTTGAGG - Intronic
1119058750 14:71451744-71451766 AAAAAAATGAAAAGTATGTCAGG + Intronic
1119166835 14:72501659-72501681 ATACGTATGTAAAGTATTTCTGG + Intronic
1119222352 14:72919287-72919309 AAAGCTATAAAAATTATTTTAGG + Intergenic
1119405633 14:74397071-74397093 AAGGAAAGGAAAAGTATTTCAGG + Intergenic
1119446997 14:74673345-74673367 AAAATAATGAAATGTATTTCTGG - Intronic
1119977931 14:79045960-79045982 AAAGGAAAGATAAATATTTCAGG + Intronic
1120248631 14:82035186-82035208 AAAGAAATGATAAGTATTTGAGG + Intergenic
1121366210 14:93313181-93313203 AAAGTTCTGAAAACTATTTTAGG - Intronic
1122426140 14:101607119-101607141 AGAAGTATCAAAAGTTTTTCAGG + Intergenic
1122621967 14:103063653-103063675 AAAGATAAGAAAACTATTTCTGG + Intergenic
1123784950 15:23662199-23662221 AAAGGTTTGGAAAGGACTTCTGG - Intergenic
1124159897 15:27258718-27258740 AAAGATATGATAAATATTTGAGG - Intronic
1124817338 15:33008218-33008240 AAAGATAGGACAAGTAGTTCAGG + Intronic
1126265878 15:46753385-46753407 AAAGGTATGGAATTTATTCCTGG - Intergenic
1126622902 15:50657833-50657855 AAAGGTAAATAAATTATTTCAGG + Intronic
1126874829 15:53029998-53030020 AAAGGGATCCAAAGTGTTTCAGG - Intergenic
1127310401 15:57747076-57747098 AAAGGGATGAGAAGAACTTCTGG - Intronic
1127905075 15:63370469-63370491 AAAGATAGGAAAAGCATATCTGG + Intronic
1128221835 15:65974768-65974790 AAAGGGAGGAGAAGTCTTTCTGG + Intronic
1129736642 15:77970027-77970049 AAAGGAAAGAAAAACATTTCAGG - Intergenic
1129849435 15:78783623-78783645 AAAGGAAAGAAAAACATTTCAGG + Intronic
1130884228 15:88080000-88080022 AAAGACATGAAAAATATTTACGG - Intronic
1131728998 15:95259472-95259494 GAAGGTATTCAATGTATTTCTGG + Intergenic
1133088478 16:3384517-3384539 ACAGGGATGAAAAGGACTTCAGG - Exonic
1133121979 16:3614351-3614373 AAATGTAAGTAAATTATTTCAGG - Intronic
1134229270 16:12416436-12416458 AAAGAAATGAGAAGTATTTGAGG + Intronic
1135206270 16:20486896-20486918 AAAGGAAAGAAAAGTAAGTCAGG + Exonic
1135262823 16:20996168-20996190 AAAACTATGGAAAGAATTTCAGG - Intronic
1137743725 16:50805407-50805429 AAAGGTAAGCAAACTGTTTCTGG - Intergenic
1138317922 16:56086319-56086341 AAAAATAGGAAAAGTGTTTCAGG + Intergenic
1138404851 16:56783043-56783065 CAAGGTATTAAAAGTATTGCAGG - Intronic
1138909359 16:61377718-61377740 CAAGGAATGACAAGGATTTCTGG - Intergenic
1138918191 16:61493948-61493970 AGAGGAGTGAAGAGTATTTCCGG + Intergenic
1140855416 16:78973736-78973758 AAGTAAATGAAAAGTATTTCTGG + Intronic
1141292389 16:82731498-82731520 AAACATCTGAAAAGTATTTTGGG + Intronic
1142941334 17:3382119-3382141 TAGGGTAGGAAGAGTATTTCAGG + Intergenic
1142942291 17:3391276-3391298 ATAGGTATAAAAAATATATCAGG + Intergenic
1144169537 17:12646618-12646640 AAAGGTATGAATGATGTTTCTGG - Intergenic
1144228595 17:13176133-13176155 AAAGAAATGATAAATATTTCAGG + Intergenic
1144766641 17:17736667-17736689 GAAGAGATGAAAAGCATTTCTGG + Intronic
1146166565 17:30594246-30594268 AAAAGTATGAAAGGTATATGGGG + Intergenic
1147030704 17:37633269-37633291 AAAGGTTAGAAAAATATTTTGGG - Exonic
1148523007 17:48299972-48299994 AAAGGTAGGCTCAGTATTTCAGG + Intronic
1149037412 17:52150322-52150344 AAAGGTATAGAAAGTGTTTGAGG - Intronic
1150172547 17:63014036-63014058 AAAAGTATGAAAAGTATGTAAGG - Intronic
1150310489 17:64124999-64125021 ATAGGTATGAAGTTTATTTCTGG + Intronic
1152001085 17:77645725-77645747 GAAGGGAAGAAAAGTCTTTCTGG - Intergenic
1153097647 18:1426713-1426735 AAAGCTACTAAAAGTATTTTAGG + Intergenic
1155753264 18:29455951-29455973 AAAGGAATAAAAGGTATTTCAGG - Intergenic
1156576518 18:38323177-38323199 AAAGGGATGAATAATATTTTGGG + Intergenic
1156618317 18:38815900-38815922 AAAGTTCTGAAAACTATTTTAGG + Intergenic
1157137025 18:45066198-45066220 AAAGCTCTGAAAGATATTTCAGG + Exonic
1159205807 18:65250461-65250483 AAAGAAATTAAAAGTATTTTTGG - Intergenic
1159699001 18:71600499-71600521 AAAGGTGTGCACAATATTTCTGG - Intergenic
1162354342 19:10172113-10172135 ATAAGTTTGAAAAGTATTTTAGG + Intronic
1165259693 19:34601981-34602003 AAAATTTTAAAAAGTATTTCTGG + Intronic
1165536849 19:36455346-36455368 AAAGGAATGAAAAGGACTTTTGG - Intronic
925514324 2:4663620-4663642 AGAGGTAACAAAAGCATTTCTGG + Intergenic
926700922 2:15802822-15802844 AAAGTTGGGAAAAGTATGTCTGG + Intergenic
927835197 2:26391476-26391498 CAAAGTATGAAAGGTCTTTCAGG + Exonic
928189619 2:29150918-29150940 AAAAATATGAAAAGTAAATCAGG - Intronic
928584338 2:32743326-32743348 AAAGGTAGACAAAATATTTCAGG - Intronic
928942724 2:36742699-36742721 AAAGGAAGGAAAAGTATTCCAGG - Intronic
929303994 2:40338783-40338805 AAAGGTATCATATGTATTACAGG + Intronic
929733869 2:44524668-44524690 AGGGATATAAAAAGTATTTCTGG - Intronic
930072584 2:47379729-47379751 AAAGGAATTAAAAATATTTAAGG - Intronic
930479524 2:51928367-51928389 AAAGGTAAGAAACATATTTCAGG - Intergenic
931631240 2:64302185-64302207 AAAGAAATGAAAAATATTTGAGG - Intergenic
932385572 2:71329746-71329768 AATGATATTTAAAGTATTTCAGG + Intronic
933153590 2:78945844-78945866 ATAGATATGAACAGAATTTCTGG - Intergenic
933346523 2:81092916-81092938 AAAAGAATGATAAGTATTTCGGG + Intergenic
934710422 2:96510495-96510517 AAAGGAATGAAAGGCATTTCAGG + Intergenic
935715443 2:105935391-105935413 AAAGGTATGAAACCCACTTCAGG - Intergenic
936501428 2:113069887-113069909 AAAGGAATCAAAAGAATCTCTGG + Intronic
936958381 2:118046703-118046725 AAAGTTAAGAAAAATATTTTAGG + Intergenic
937107126 2:119326786-119326808 AAATGTATCCTAAGTATTTCAGG + Intronic
937676806 2:124599845-124599867 AAAAATAGGAAAAGTATTTAAGG - Intronic
939192802 2:138936296-138936318 AGAGGTAGGAAAAGTCTTCCTGG - Intergenic
940851869 2:158694852-158694874 AAACATATGAAAAGTAATTTTGG - Intergenic
941207933 2:162597711-162597733 AAAGAAATGAAAAGTATGTAAGG + Intronic
941470318 2:165877275-165877297 AAATGTTTGAAAAGAATTACTGG + Intronic
941691940 2:168509241-168509263 CATGTTATGAAAAGTAATTCAGG - Intronic
941755146 2:169177217-169177239 AAAGGTCTGAAATATATTTTGGG - Intronic
942093981 2:172520737-172520759 AAAGGTATCAATAGCATTTTGGG + Intergenic
942334135 2:174862788-174862810 CAAGATATGAAAGGTATTTCTGG + Intronic
943048662 2:182889454-182889476 AAAGAAATGATAAGTATTTGAGG - Intergenic
943114049 2:183644261-183644283 AGATGTATGAAATGTATTTGTGG - Intergenic
943252800 2:185550642-185550664 AAAGGTATTTAAAGCAGTTCTGG - Intergenic
943938302 2:193955720-193955742 AAACCTGTGAAAAATATTTCTGG + Intergenic
944331589 2:198474508-198474530 AAAAGAGTGAAAATTATTTCAGG - Intronic
945900150 2:215528043-215528065 AAAGGTTTGGAAAAGATTTCAGG - Intergenic
946111178 2:217418966-217418988 AAAGTGATTAAAAGTATTTGAGG + Intronic
1169918863 20:10711933-10711955 AAAGGTATGGAAAGCATATGGGG + Intergenic
1170197227 20:13701969-13701991 AAAGTTCTGAAATGGATTTCTGG - Intergenic
1170214960 20:13881939-13881961 AAAGAAATGACAAGTATTTGTGG + Intronic
1170779676 20:19413081-19413103 AAAGGGCTGAAAATTACTTCAGG - Intronic
1173758237 20:45537337-45537359 GAAGGTCAGAAAAGTTTTTCTGG - Exonic
1174657430 20:52183243-52183265 CAAGGTGGGAAAGGTATTTCAGG + Intronic
1174770621 20:53296721-53296743 AAAGATAAGAGATGTATTTCTGG - Intronic
1174937556 20:54887809-54887831 AAAGCTATTAAAAGTATTCCTGG + Intergenic
1176661778 21:9643183-9643205 AAAGCCATGAAGAATATTTCCGG + Intergenic
1177056922 21:16317837-16317859 AAAGGTCTTAAAAGTATATGAGG + Intergenic
1177101761 21:16906709-16906731 AAATGTAGGGAAAGTACTTCAGG + Intergenic
1177537779 21:22451363-22451385 AAAGGTTTTCAAAGAATTTCAGG - Intergenic
1178066373 21:28908673-28908695 CATGGCATGAAAAATATTTCTGG - Intergenic
1178120487 21:29465047-29465069 AAAGGTAAGTAAAGAATTTAGGG + Intronic
1178146246 21:29743816-29743838 GAAGCTATGAAATGAATTTCAGG + Intronic
950934348 3:16823445-16823467 AAAACTATTAAAAATATTTCTGG - Intronic
951349638 3:21590893-21590915 ATAAGTATGAAAAATGTTTCAGG + Intronic
951460151 3:22942822-22942844 AGAGCTATAAAAAGGATTTCTGG - Intergenic
951584265 3:24199107-24199129 TAATGTATGAAAAGTACTTTCGG - Intronic
952234838 3:31468506-31468528 AAAGCTATGAAAAGCCTGTCAGG + Intergenic
954536503 3:51363030-51363052 CAAAGTATGAAAAGTAAATCGGG + Intronic
955550802 3:60083049-60083071 AAAGTTAGGAAATGTCTTTCTGG - Intronic
956800227 3:72750993-72751015 GAAGCTATTAAAAGTATTACAGG + Intronic
958474755 3:94567274-94567296 AAAGGGATGAAATATATTTTGGG - Intergenic
958612318 3:96443013-96443035 GAAGTTTTGAAAACTATTTCAGG + Intergenic
958708825 3:97692253-97692275 ATAGGTATGCAAAGTTTGTCTGG + Intronic
959022735 3:101206343-101206365 AAAGGAATGAAATTTATTTAAGG - Intergenic
959455013 3:106548843-106548865 AAATAAATGAAAAGTATTTGAGG - Intergenic
960373149 3:116865541-116865563 AAAGGAAGGAAGATTATTTCTGG - Intronic
960445535 3:117744654-117744676 AGAGAGATGAAAAGAATTTCAGG + Intergenic
960489137 3:118290602-118290624 AAACGTAGGAAAAATTTTTCTGG - Intergenic
961418973 3:126784630-126784652 AAAGGTGTGAAAAGTTTCTGTGG - Intronic
963167966 3:142224798-142224820 AAAGATATGAAAAGTTATTGAGG + Intronic
963783048 3:149506433-149506455 AAAGGGATGAAACGAATTTGTGG + Intergenic
963899575 3:150721078-150721100 AAAGGAAGGACAAGTATTTAAGG - Intergenic
964059809 3:152507515-152507537 AAAAAGATGAAAAGTTTTTCGGG - Intergenic
964181268 3:153889466-153889488 AAATGTATGCAAAAGATTTCAGG - Intergenic
964796862 3:160507666-160507688 AAAGGGATGAAAGGTGTTCCAGG - Intronic
966081962 3:176016103-176016125 GAATGTATGAAAAGTTTTTAAGG + Intergenic
966185030 3:177219612-177219634 AAAAGTAGGAATAGTATTTAGGG + Intergenic
966326883 3:178766493-178766515 ACATGTATGAAAAATATTTGTGG - Intronic
966743079 3:183251956-183251978 AATGGTTTCAAAAGTATGTCTGG - Intronic
967026833 3:185571835-185571857 AAAGGTAGGAAAAGAATAGCAGG - Intergenic
967391370 3:188958989-188959011 AAAGGTATGAAATGTATGAACGG + Intronic
967601027 3:191389599-191389621 AAAGGTAAGAAGAGTATGTATGG + Exonic
967995824 3:195165550-195165572 AAAGGTCAGAGAGGTATTTCTGG - Intronic
968136185 3:196221126-196221148 AATGCTAAGAAAACTATTTCAGG + Intronic
969910499 4:10440600-10440622 TAAGGAATTAAAAGTGTTTCTGG - Exonic
970113163 4:12661537-12661559 AAAGCTAAGAAAAGCTTTTCTGG - Intergenic
971577575 4:28295518-28295540 AGAATTTTGAAAAGTATTTCAGG - Intergenic
971765711 4:30828188-30828210 TGATGTATAAAAAGTATTTCAGG + Intronic
973031992 4:45356585-45356607 AAATATATGAACAATATTTCTGG + Intergenic
973205974 4:47560531-47560553 AAAGGTATGAAAGGTGCTGCTGG + Intronic
973628503 4:52796323-52796345 AAAGAAATGATAAGTATTTGAGG + Intergenic
973726930 4:53786380-53786402 AAATGTATGAAAAGTACCTTGGG - Intronic
974014899 4:56640118-56640140 AAAGGTATGAAGAATATTAAGGG + Intergenic
975089171 4:70380429-70380451 TAAAGCATGATAAGTATTTCAGG + Intronic
975171810 4:71240660-71240682 AAAAGTAAAAAAAGTATGTCAGG + Intronic
975360207 4:73460872-73460894 AAAGGTTAGATAAGTATTTTAGG + Intergenic
976873845 4:89830442-89830464 AAAGGAATGATAAATGTTTCAGG + Intronic
976920988 4:90442748-90442770 AAAGATATGTTAAATATTTCTGG - Intronic
977087281 4:92618099-92618121 AAACATAAGAAAAATATTTCAGG - Intronic
977116926 4:93040370-93040392 TGAGATTTGAAAAGTATTTCTGG + Intronic
977364385 4:96048845-96048867 AAAGAAATGACAAGCATTTCAGG - Intergenic
978398218 4:108305159-108305181 AAAGCCATGAAAGGAATTTCAGG - Intergenic
979605350 4:122632654-122632676 AAAGATAAGAAAAGCATTTTTGG + Intergenic
980618379 4:135264365-135264387 AAAAGTCAAAAAAGTATTTCAGG + Intergenic
980752214 4:137106318-137106340 AAAGGAATGAAATGTATTTCTGG - Intergenic
980925736 4:139135553-139135575 AATGTTATGAAAAATAATTCAGG - Intronic
981030749 4:140122940-140122962 GATAGTAAGAAAAGTATTTCAGG - Intronic
981031916 4:140134230-140134252 AAAGTTAGGGGAAGTATTTCTGG - Intronic
981487223 4:145300313-145300335 AAATGAATAAAATGTATTTCAGG + Intergenic
981914790 4:150022136-150022158 AAAGGCATGAGAAGTCTTTTGGG - Intergenic
981918437 4:150060283-150060305 AAAGTTATGAGAAGAATTTGTGG - Intergenic
982321438 4:154081484-154081506 AAAGAAATGATAAATATTTCAGG - Intergenic
982364130 4:154556657-154556679 AAAGGTATGCAAACAATTTTGGG - Intergenic
982558808 4:156902811-156902833 AATGCTAGGAAAAATATTTCAGG - Intronic
982928369 4:161368652-161368674 AAAGATAAGAAAAATATTTAGGG - Intergenic
983052165 4:163061303-163061325 AAAGCTATGAGAAATATTTGAGG - Intergenic
983126440 4:163958016-163958038 ACAGATATGAAGAGTCTTTCGGG - Intronic
983363930 4:166762037-166762059 AAAGGTAAAAGAGGTATTTCTGG + Intronic
983954504 4:173681556-173681578 AAACAAATGATAAGTATTTCAGG - Intergenic
984302790 4:177944792-177944814 AAATGTAAGAAAAATATTCCAGG - Intronic
984352191 4:178609838-178609860 AAAGATAGGCAAAATATTTCAGG + Intergenic
986071899 5:4293618-4293640 TAAGGTATAAAAAGTTTTACAGG + Intergenic
986420690 5:7578436-7578458 GAAGGTGTGAAAGATATTTCAGG - Intronic
986440677 5:7778899-7778921 AAAGACATGAAAACAATTTCAGG - Intronic
986589617 5:9355069-9355091 AAAGGTCTGGATAGTATTTTAGG + Intronic
986599331 5:9455990-9456012 AAAGGGATGAAAAGAATTTCAGG + Intronic
986981581 5:13453966-13453988 AACGCTTTGAAAAGTATTGCTGG + Intergenic
987514389 5:18887338-18887360 AAATGTAAGATAAGTTTTTCTGG - Intergenic
987624700 5:20383402-20383424 AAAGCTCTGAAAATTATTCCTGG - Intronic
988790211 5:34601009-34601031 AAGGGTAAGAAAAGTATTTTAGG + Intergenic
989232332 5:39101002-39101024 AAATGTGTGAACAGTATGTCAGG + Intergenic
989343283 5:40401166-40401188 AAAGAAATGATAAGTATTTGAGG - Intergenic
989544342 5:42655251-42655273 AAAGGTGTGAAAAATATTAAAGG - Intronic
989602949 5:43216868-43216890 CAAGGTAGGAAAAGGATTTTGGG + Intronic
989716969 5:44475664-44475686 AAAGTTTTGAAAAGCATTTGAGG + Intergenic
990038063 5:51346851-51346873 AAAAATATGAAAAGTATTGTTGG - Intergenic
991511212 5:67378418-67378440 AAATGAATGAAAATTATGTCAGG + Intergenic
993078193 5:83262524-83262546 AAAGCTTTGCAGAGTATTTCAGG - Intronic
993087071 5:83376469-83376491 GAAGCTTTGAAAACTATTTCTGG + Intergenic
993096143 5:83480479-83480501 AAAGTGTTCAAAAGTATTTCAGG + Intronic
993220402 5:85088257-85088279 AGAGATATGAAAATCATTTCTGG + Intergenic
993344358 5:86764125-86764147 AAAGGTGTCAAAAGAAATTCAGG - Intergenic
993921146 5:93804039-93804061 AAAGGAATCAAATGTATTTATGG - Intronic
995166044 5:109042803-109042825 AAAGGCATGACACGTATTTAGGG + Intronic
995780971 5:115774879-115774901 AAAAGTATGACTTGTATTTCTGG + Intergenic
996043041 5:118837979-118838001 AAATATATGAAAAATATTACTGG + Intronic
996399629 5:123047311-123047333 AAAGAAATGACAAATATTTCAGG + Intergenic
996592044 5:125158998-125159020 AATGTTAAGAAAAATATTTCTGG + Intergenic
997305421 5:132832199-132832221 AAAAATATTAAAAGTCTTTCAGG - Intergenic
997815335 5:137011579-137011601 AAAGGTATGTAATAAATTTCAGG - Intronic
998783783 5:145687025-145687047 AAAAGTATGAAAATAATTACAGG + Intronic
1000138047 5:158372471-158372493 AAAGGTAGAAAAAATATTTCAGG - Intergenic
1000712592 5:164599602-164599624 AAAGGTATGAAAAATAAGGCCGG - Intergenic
1002809645 6:615154-615176 AGAGGTTTGAAAAGTATATGTGG + Intronic
1002892304 6:1345904-1345926 AAATGTGTGAAAAATCTTTCTGG - Intergenic
1003365529 6:5471376-5471398 AAAGGTAAGAGAAGGATTCCTGG - Intronic
1003508129 6:6756658-6756680 AAACGTATGAAAAGTAACTTTGG - Intergenic
1004942761 6:20578306-20578328 AGAGGTAGGAAAAATTTTTCTGG - Intronic
1005108609 6:22252892-22252914 AAAGAAATGAAAAGAAATTCGGG - Intergenic
1005137108 6:22582118-22582140 AAAAGTATGGAGAGTATTTTTGG + Intergenic
1006769264 6:36538371-36538393 AGAGGCATGAAAACTTTTTCTGG + Intronic
1007026198 6:38577208-38577230 AAAGCCATGAGAAATATTTCTGG - Intronic
1007755953 6:44099716-44099738 AAAGGTATGAAAGTTAATACAGG - Intergenic
1008210858 6:48723866-48723888 AAAAAAATCAAAAGTATTTCAGG - Intergenic
1008358797 6:50589897-50589919 CAAGGAATGAGAAGGATTTCTGG + Intergenic
1008637708 6:53427847-53427869 AATGTTATGACAATTATTTCTGG - Intergenic
1008833558 6:55799452-55799474 AAAAGTTTAGAAAGTATTTCTGG + Intronic
1009400219 6:63245804-63245826 AAAGTAATCACAAGTATTTCTGG - Intergenic
1009404908 6:63300190-63300212 AGAGCTATGAAAAGGATGTCTGG - Intronic
1009884173 6:69604549-69604571 AAAAGTAGGAAAGGCATTTCAGG - Intergenic
1011795283 6:90946597-90946619 AAAGCTTTGAAAAGTACTTGAGG - Intergenic
1012459618 6:99445951-99445973 AAGGGTCTGAAAAGCATTTTGGG + Exonic
1013187241 6:107770477-107770499 AAATGTATGGAAATTATTTTAGG - Intronic
1013187328 6:107771243-107771265 AAATATATGGAAATTATTTCAGG - Intronic
1013188427 6:107782210-107782232 AGAGGTAGGAAAAGTTTTCCTGG + Intronic
1013772395 6:113642370-113642392 AAAGGAAAGAAATGTATTTAAGG + Intergenic
1014204785 6:118645916-118645938 ATTGGTATGAAAAGTAATTTGGG + Intronic
1014834999 6:126151177-126151199 AAATGTATGTAAAGCACTTCAGG + Intergenic
1015651274 6:135463678-135463700 AAAGGTATAAAAAGTATTCTAGG + Intronic
1016012490 6:139152756-139152778 AAAGGTCTTAAAAATATTTGAGG + Intronic
1016470000 6:144365214-144365236 AAAGGCATGAAATTTATTTCAGG - Intronic
1017081077 6:150669498-150669520 TAAGGTATTAAAAGTAATTTAGG - Intronic
1017268877 6:152482864-152482886 ACAGGTATGGAAAATATCTCAGG + Intronic
1018164823 6:161083284-161083306 AAAAATGTGAAATGTATTTCAGG - Intronic
1018718028 6:166550084-166550106 CAAGGTAGGAAAAATATTTATGG + Intronic
1020337051 7:7070187-7070209 AAAGTTATGAACAATATTACAGG - Intergenic
1020421995 7:8017227-8017249 AATGGTGTGAAAAATATTTTTGG + Intronic
1021049929 7:15970619-15970641 AAAAGTATGAAATATTTTTCAGG + Intergenic
1021850170 7:24800435-24800457 AAAAGTAACAAAATTATTTCTGG - Intronic
1022021653 7:26405326-26405348 AAAGGCATATAAAGTATTTGAGG - Intergenic
1022338961 7:29450620-29450642 AGAGGTGTGAAAAGAATTTTTGG - Intronic
1022402689 7:30055600-30055622 AAAAGTAAAAAAAGTATTTGAGG + Intronic
1022425260 7:30262589-30262611 GAATGTATGCAAAGTAATTCAGG + Intergenic
1022457557 7:30572254-30572276 AAAGTTATAAAAGGTATTTCTGG + Intergenic
1023501134 7:40850492-40850514 AAGGGTATAAAATGAATTTCTGG + Intronic
1023555202 7:41414960-41414982 AAAGGTGTGAAAACTTTTTTTGG + Intergenic
1023625923 7:42115115-42115137 AAAAGTAGGAAAATTATTTGGGG - Intronic
1023683971 7:42716655-42716677 AAAGTCATGAAAACTCTTTCAGG - Intergenic
1024519430 7:50291422-50291444 AAAAAAATGAAAAGTATTTGAGG - Intergenic
1024731000 7:52253742-52253764 AAAGGTAGCAAAGGTGTTTCTGG + Intergenic
1024970716 7:55067185-55067207 AAAGGTCAGCAAAGGATTTCAGG + Intronic
1025739867 7:64185541-64185563 AAAGGAATAAAAGATATTTCTGG + Intronic
1027331701 7:77103001-77103023 AAAGCTAGGAAAAGCATTTCAGG + Intergenic
1027504780 7:79002590-79002612 ATAATTATGAAAAGTATATCTGG + Intronic
1027703229 7:81495170-81495192 AAAGATATGAAAAATATTGTAGG - Intergenic
1027830725 7:83173881-83173903 ATAGGAAGGAAAAGTATTCCAGG - Intergenic
1027999330 7:85471047-85471069 ACAGGTATGATAAATATTTCAGG - Intergenic
1028416722 7:90588540-90588562 TTAGGTATGACAAGTATTTATGG - Intronic
1028539992 7:91932373-91932395 GAAGGTATGAAAGGTAATTCTGG - Intergenic
1028708895 7:93884266-93884288 AATTGTATGAAAAGTTTTTGGGG - Intronic
1028999690 7:97140057-97140079 AAAGGTAGGAAAAATATATTCGG - Intronic
1029784070 7:102768334-102768356 AAAGCTAGGAAAAGCATTTCAGG - Intronic
1029864470 7:103612143-103612165 TAAAATATGAAAAGTATTACAGG + Intronic
1030718703 7:112843264-112843286 AATAGTATGATAACTATTTCAGG - Intronic
1031188506 7:118515282-118515304 AATGGCATGAAAAGTATTTTGGG - Intergenic
1031301966 7:120070714-120070736 AAGGGTATGATAAGCATTTCTGG - Intergenic
1031423865 7:121582552-121582574 AAATTTATGTATAGTATTTCTGG - Intergenic
1031449850 7:121901826-121901848 AAAGGAATGAAAAGTGTTTGAGG - Intronic
1031472200 7:122180246-122180268 AAAGAAATGATAAGTATTTGAGG - Intergenic
1031850940 7:126862524-126862546 AAAGTTAAGAAAAGTATGTAGGG - Intronic
1031994139 7:128217581-128217603 GAATGTATGAAAAATATCTCTGG + Intergenic
1032648176 7:133848638-133848660 GAAAGTATGAAAGATATTTCAGG - Intronic
1032810614 7:135412124-135412146 AAAGTCTTGAAAATTATTTCTGG + Intronic
1032842845 7:135727576-135727598 AAAGGTTTAAGAAGTCTTTCTGG - Exonic
1033151963 7:138922584-138922606 AAATGTTTTAAAAATATTTCTGG - Intronic
1033201795 7:139379351-139379373 AAAGGCAGGAAATGCATTTCTGG - Intronic
1035512361 8:201679-201701 AAAGGTAAGAAATGTAAATCTGG + Intergenic
1035813275 8:2511580-2511602 AACTTTGTGAAAAGTATTTCTGG - Intergenic
1036739989 8:11351638-11351660 AAAGCTATGACAAAAATTTCTGG - Intergenic
1037057539 8:14461060-14461082 AAAGATATGAAAAGGAATTCAGG + Intronic
1037697605 8:21239373-21239395 AAAGAAATGATAAGTGTTTCAGG - Intergenic
1038272722 8:26088966-26088988 AAAGTTATGAAAAGAAATACTGG - Intergenic
1038724535 8:30068778-30068800 AAATTTACGAAACGTATTTCCGG - Intronic
1039343607 8:36678829-36678851 AAAGAAAAGAAAAGTATTTTGGG + Intergenic
1040096587 8:43450421-43450443 AATGATGTGAAAAGTATGTCTGG - Intergenic
1041808397 8:61880963-61880985 AAAGATACGAACAGTAATTCTGG - Intergenic
1041985053 8:63911432-63911454 AAAGGTATGAAATATGATTCAGG + Intergenic
1042019283 8:64353249-64353271 AAAGGAATGAAAAGGATGTCTGG - Intergenic
1042399334 8:68328306-68328328 AAAGATATGTAAAGTATATGTGG - Intronic
1042456230 8:69007158-69007180 AAAGCTATTAAAATTATTTAAGG - Intergenic
1042516814 8:69667747-69667769 AAAGGTAGAAAAAATATTTCAGG - Exonic
1043010607 8:74877731-74877753 AAAGGTAGGAAACCAATTTCTGG + Intergenic
1043963874 8:86449496-86449518 AAAAATATTAAAAGTATTTTGGG - Intronic
1044260423 8:90113384-90113406 AAGGTTATAAAAAGTATTGCTGG - Intergenic
1046277257 8:111980092-111980114 AAAGTTAAGAATAGCATTTCAGG + Intergenic
1046990447 8:120446704-120446726 AAAGTTATGAAAATTATTCTAGG + Intronic
1047406797 8:124592175-124592197 AAAAGTATGATGAGAATTTCGGG - Intronic
1050427776 9:5529589-5529611 CAAGGTATAAAAAATATTTCTGG - Intronic
1050799457 9:9591786-9591808 AAAGAAATGATAAGTATTTGAGG - Intronic
1050824231 9:9924556-9924578 AAAGGCAAGGAAAGTGTTTCGGG - Intronic
1050915522 9:11125736-11125758 TAAGGTAAGAAAAGTATTGTAGG - Intergenic
1050984575 9:12066104-12066126 AATGCTCTGAAACGTATTTCTGG + Intergenic
1051045869 9:12872957-12872979 AAATGTATGCAAAGTAATTGTGG + Intergenic
1051191688 9:14519420-14519442 AAAGGTAAGCAAAGTCTTTGTGG + Intergenic
1051202138 9:14638449-14638471 AAACTTAGGAAAAATATTTCAGG + Intronic
1051214241 9:14779179-14779201 AGAGGTGTGAAACATATTTCTGG - Intronic
1052085212 9:24256608-24256630 AAAGGTATAAGAGATATTTCTGG + Intergenic
1052381222 9:27773224-27773246 ACAGATGTCAAAAGTATTTCTGG - Intergenic
1054762675 9:69017065-69017087 CCAGGTATGATAAGTATTTCTGG - Intergenic
1055412071 9:76041539-76041561 AAATGTATGTAAAGAATTTATGG + Intronic
1057235200 9:93352319-93352341 ATAGGGATGACAAGTATTTTTGG - Intergenic
1057416371 9:94866935-94866957 AAATGCATGAAACTTATTTCTGG + Intronic
1058282975 9:103141103-103141125 AAAGCTATGATAAATGTTTCAGG + Intergenic
1059845838 9:118275780-118275802 AAAGATATGAAAAGCATTCCAGG - Intergenic
1060336557 9:122729147-122729169 AGAAGAATAAAAAGTATTTCTGG + Intergenic
1060540421 9:124426286-124426308 AAAGTTATGAAAGTTATTCCCGG - Intergenic
1203639339 Un_KI270750v1:145026-145048 AAAGCCATGAAGAATATTTCCGG + Intergenic
1186101691 X:6164197-6164219 AAAGGTATCACAACTAGTTCTGG + Intronic
1186530725 X:10292634-10292656 CAAGGAATGAAAAGTAGGTCAGG + Intergenic
1186718998 X:12282338-12282360 AAAAGAATTAAAAGTATTTTGGG - Intronic
1187060652 X:15783868-15783890 AAAGAAAAGAAAAATATTTCTGG - Exonic
1187309869 X:18131736-18131758 AAAGAAATGATAAGTATTTGAGG + Intergenic
1188098683 X:26054966-26054988 ACAGGCATGAAAAGTAGTTTTGG + Intergenic
1188145022 X:26601183-26601205 AAAGATTTGAAAAGTTTATCAGG + Intergenic
1188757647 X:33983890-33983912 AAAGGTATACAAAATATTTGTGG - Intergenic
1189526299 X:41825852-41825874 AAAGATAGGGAAATTATTTCAGG - Intronic
1192044059 X:67653490-67653512 AAAGGTAGGAAGAGAACTTCAGG + Intronic
1192512641 X:71733296-71733318 ATAGGAATGAAAAGTATTCCAGG - Intergenic
1192514056 X:71748213-71748235 ATAGGAATGAAAAGTATTCCAGG + Intergenic
1192574459 X:72231797-72231819 AAAGAAATGATAAGTATTTGAGG + Intronic
1193677433 X:84473031-84473053 AAAAGAAAGAAAAGTAATTCGGG + Intronic
1194285395 X:92004725-92004747 AAAGGATGGAAAAATATTTCAGG - Intronic
1195087038 X:101422508-101422530 CAGGGTCTGAAAAGTATCTCAGG + Intronic
1195413244 X:104592013-104592035 AAAGGCATGAGAATTATTTTAGG + Intronic
1195785806 X:108521444-108521466 AAAGATATTAAAAATATCTCTGG + Intronic
1195813900 X:108864466-108864488 AAAGACATGATAAATATTTCAGG - Intergenic
1195864513 X:109414781-109414803 AAGGGAAGGAAAAGTATTTTAGG + Intronic
1196975960 X:121157936-121157958 AAAGGTAGAAACAGTATCTCAGG - Intergenic
1197310017 X:124893433-124893455 AAAGATATGAAAAGTGTGTTTGG + Intronic
1197597918 X:128489280-128489302 AAAGGTTCAAGAAGTATTTCTGG + Intergenic
1197965958 X:132061917-132061939 AAAGGTGAGAAATGTGTTTCTGG + Intergenic
1198192628 X:134325040-134325062 AAATGTATGGAAAATACTTCAGG - Intergenic
1199013354 X:142782423-142782445 AAAGGAAGGAAGAGTATGTCTGG + Intergenic
1200602966 Y:5229264-5229286 AAAGGATGGAAAAATATTTCAGG - Intronic