ID: 1084629310

View in Genome Browser
Species Human (GRCh38)
Location 11:70335879-70335901
Sequence CCATACACACAAATGGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084629310_1084629317 24 Left 1084629310 11:70335879-70335901 CCATGCCCCATTTGTGTGTATGG 0: 1
1: 0
2: 0
3: 8
4: 175
Right 1084629317 11:70335926-70335948 CTAGAATGAGAGTAGGTAAGTGG 0: 1
1: 0
2: 0
3: 12
4: 181
1084629310_1084629316 17 Left 1084629310 11:70335879-70335901 CCATGCCCCATTTGTGTGTATGG 0: 1
1: 0
2: 0
3: 8
4: 175
Right 1084629316 11:70335919-70335941 TTATTCTCTAGAATGAGAGTAGG 0: 1
1: 0
2: 1
3: 25
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084629310 Original CRISPR CCATACACACAAATGGGGCA TGG (reversed) Intronic
900489405 1:2939415-2939437 CCATCCCCACAGATGGGGGAAGG + Intergenic
900541277 1:3204224-3204246 CCACACACACTACAGGGGCACGG - Intronic
906796824 1:48702879-48702901 CCACAAACAGAACTGGGGCAGGG + Intronic
907938764 1:59066864-59066886 CCATACATACGCATGGGGAAGGG - Intergenic
910375269 1:86562084-86562106 ACACACACACACATGGTGCAAGG + Intronic
911730583 1:101288240-101288262 CCATACACATGTGTGGGGCATGG + Intergenic
912274449 1:108241607-108241629 CCATGCACAGAAATGTGGCCAGG + Intronic
912286818 1:108378251-108378273 CCATGCACAGAAATGTGGCCAGG - Intronic
912293770 1:108452734-108452756 CCATGCACAGAAATGTGGCCAGG - Intronic
912861615 1:113218722-113218744 CTACACACAGAAATGGGGGAAGG + Intergenic
915019596 1:152766464-152766486 CCATACAGACATATGGGAGATGG + Intronic
915748688 1:158184155-158184177 CCAGAGACACAGATGTGGCAAGG - Exonic
916039066 1:160946888-160946910 CCATGCACACACATGGTGAAGGG + Intronic
920505805 1:206514334-206514356 CCATGCCCTCAAATGGGGCCAGG - Intronic
920650219 1:207832039-207832061 TCATAAACACAAGTGGGGCAGGG + Intergenic
923442583 1:234035174-234035196 GCATACAGAGAAAGGGGGCATGG + Intronic
1073221230 10:101875904-101875926 CCAATCACACTAATGGGGCTGGG + Intronic
1073798569 10:107015344-107015366 ACACACACACAAATAGAGCAGGG + Intronic
1073828072 10:107348844-107348866 CCATACACTAAGATGGAGCAGGG - Intergenic
1076495805 10:130896937-130896959 CCATTCACACAGATTGGGTATGG + Intergenic
1079034796 11:17012815-17012837 ACATACACACATATGAGGCAGGG + Intronic
1081063123 11:38504497-38504519 ACACACACACAAATTGGCCAGGG + Intergenic
1081474504 11:43413018-43413040 ACACACACACAAATGGGGGCAGG + Intronic
1083751072 11:64760862-64760884 CTATGCACACAAATGGGGTGAGG - Intergenic
1084001094 11:66295750-66295772 CCAGCCACACACAAGGGGCAGGG + Exonic
1084629310 11:70335879-70335901 CCATACACACAAATGGGGCATGG - Intronic
1085594338 11:77794384-77794406 CCATACAAATACATGGGGCCAGG + Intronic
1086572490 11:88301511-88301533 CAAAACTCACAAATGAGGCAAGG - Intronic
1089643724 11:119864439-119864461 CAATAAATACAAATGTGGCAGGG + Intergenic
1090648312 11:128784321-128784343 CCCTAAACACAAAAGGGCCAAGG - Intronic
1091370498 11:135053687-135053709 CCAGAAACACAAATGGTGGAAGG - Intergenic
1092367884 12:7892074-7892096 CCAAACACACAAGATGGGCATGG + Intergenic
1092611525 12:10178188-10178210 CTATAGACACAAATGTGGCCGGG - Intronic
1092706022 12:11285720-11285742 CCACACACACTAATTGGACAGGG + Intergenic
1094602708 12:31923863-31923885 CCATACAGACAAGCTGGGCAGGG - Intergenic
1096524587 12:52202887-52202909 CCACACACACCACAGGGGCAGGG - Intergenic
1100312269 12:93407320-93407342 CCATATACTCTAATGGGGAAGGG - Exonic
1101769257 12:107733410-107733432 CCATTCAGACAAAGGGGGCCTGG - Exonic
1102155006 12:110718115-110718137 ACATACACATAAATGGGATATGG - Intergenic
1103221703 12:119251730-119251752 CCATTCACACCAATGAGGCGAGG + Intergenic
1104068337 12:125324031-125324053 ACACACACACAACGGGGGCAGGG + Intronic
1105615846 13:22011440-22011462 CCGCACACAGAAATGTGGCAGGG - Intergenic
1106522721 13:30512016-30512038 CCATAGACATAATTGGGGCCAGG + Intronic
1108280585 13:48857184-48857206 ACACACACACAAAAGGGGCTGGG + Intergenic
1110003398 13:70234444-70234466 CCATAAAGCCAAATGGGGAAAGG + Intergenic
1111237526 13:85429192-85429214 CCATCCACACAGATGGTACAGGG + Intergenic
1112007953 13:95270449-95270471 TCAGACCCACAAATGGGCCAAGG - Intronic
1112768396 13:102771522-102771544 TCACACACACAGATGGGGAAAGG - Intronic
1113637495 13:111929643-111929665 ACAAACACATAAATGGGGAAGGG + Intergenic
1114724912 14:24925817-24925839 CCCTACACAAAAATGGGAAAGGG + Intronic
1115028847 14:28771074-28771096 AAATATACACAAATGGGGAATGG + Intergenic
1118152589 14:63205423-63205445 CTAGACACACAAATGGTGAAAGG + Intronic
1118720673 14:68591608-68591630 CCACACACACACAGGGGGCCTGG - Intronic
1124217075 15:27816481-27816503 CCATACTTACGAATGGGACATGG - Intronic
1125350864 15:38766357-38766379 ACACACACACAAATGAGGAAAGG - Intergenic
1126747144 15:51837606-51837628 CCCTACACAGAAATGGACCAAGG + Intronic
1128686518 15:69690326-69690348 CCAGACACAGGACTGGGGCAAGG - Intergenic
1129468428 15:75737394-75737416 CCATAAACCAAAATGAGGCAGGG - Intergenic
1129565282 15:76615523-76615545 ACACACACACAAATGAGGCCAGG + Intronic
1129727143 15:77907103-77907125 CCATAAACCAAAATGAGGCAGGG + Intergenic
1130485865 15:84398231-84398253 CCATATACAAAAATGAAGCAGGG - Intergenic
1137577805 16:49615152-49615174 ACACACACACACACGGGGCAGGG + Intronic
1137703096 16:50512169-50512191 CCAAGAACACAAATGGGGGAAGG - Intergenic
1138768372 16:59631742-59631764 CCATTTACAAAAGTGGGGCAAGG + Intergenic
1139108225 16:63855487-63855509 TCATATACACAAGTGAGGCAGGG + Intergenic
1144791114 17:17859961-17859983 CCACACACACAAAGGGTGAAGGG + Intronic
1147644163 17:42023919-42023941 CCAGACACTGAAATGGGGCTGGG - Exonic
1148950114 17:51303310-51303332 CCACACACACAAAGGTGGTATGG + Intergenic
1151530872 17:74703910-74703932 CCACACACACAAATGGCTCATGG + Intronic
1152189607 17:78880352-78880374 CCATGCCCACAATTGGGGGAGGG + Intronic
1152322944 17:79618538-79618560 ACATCCACACAAAAGGGACAAGG - Intergenic
1154336394 18:13469051-13469073 CCAAACACAAAAATGGGCAAAGG + Intronic
1156451814 18:37270848-37270870 CCATTCACCCCAATGGGGGATGG + Exonic
1156545432 18:37959204-37959226 CCATCCACACAATAGGAGCAGGG + Intergenic
1157822574 18:50784496-50784518 ACACACACACAGAAGGGGCATGG + Intergenic
1159983068 18:74809756-74809778 CCATACACTCTAATGGTACATGG - Intronic
1160973236 19:1779703-1779725 CCAGACACACAGATGCGACACGG - Exonic
1162125996 19:8499812-8499834 TCAAACACACAGAAGGGGCATGG + Intronic
1166898284 19:46037843-46037865 CCATGCACACAAGAGGGGAAAGG + Intergenic
1167534466 19:50040942-50040964 ACATTCACACAAATGGGTGAAGG - Intronic
925496650 2:4457692-4457714 CCATACACACATATTGCTCAGGG + Intergenic
925631986 2:5903821-5903843 CCATCCACACAAATAAAGCAGGG - Intergenic
926476361 2:13327618-13327640 ACATACACACAAATAGGACCTGG - Intergenic
928067280 2:28177484-28177506 GCAAACACACAAATGAGGAAGGG + Intronic
930465986 2:51750287-51750309 CCATACAGTAAAATGGGGGAAGG - Intergenic
930576908 2:53161915-53161937 ACATACACACACACAGGGCAGGG - Intergenic
931857769 2:66321624-66321646 CCAAACACAGAAATGGGCAAAGG + Intergenic
932762044 2:74444380-74444402 CAATACAAACAAATGAGCCAGGG + Intergenic
933978609 2:87531893-87531915 CCATACACACAACTTGGACTTGG - Intergenic
934705833 2:96479586-96479608 ACACACACACAAATGGGCAAAGG - Intergenic
935557011 2:104520947-104520969 CAATACACACAAAGGGGCAAGGG - Intergenic
936315222 2:111418909-111418931 CCATACACACAACTTGGACTTGG + Intergenic
936477334 2:112850657-112850679 CCACACACACAAACGTGGTATGG + Intergenic
938170170 2:129069191-129069213 CGATTCCCACAGATGGGGCAGGG + Intergenic
938682835 2:133709661-133709683 CGGTACACACAAATGGAGCCAGG + Intergenic
938820266 2:134950479-134950501 AAATACACACAAACCGGGCATGG + Intronic
939178103 2:138773508-138773530 CTACACACACAAATGAGGAATGG + Intronic
942207331 2:173632501-173632523 CCTGACACACAAATAGGGCCAGG + Intergenic
943678457 2:190741881-190741903 ACACACACACACACGGGGCAGGG + Intergenic
946728872 2:222689536-222689558 CCATAAACACACATGGGCCTGGG - Intronic
947536447 2:230942808-230942830 CCATCCACAAGAATGGGGTAAGG + Intronic
948697716 2:239741680-239741702 CCATCCACACACATGGAGCTGGG + Intergenic
1170467379 20:16635163-16635185 CCATAAACACATAAAGGGCAAGG - Intergenic
1173304694 20:41837080-41837102 CCATAAAAACAAATGGAGCCCGG - Intergenic
1173429322 20:42972156-42972178 CCAAACAAACAAATGGGGTTGGG - Intronic
1174074626 20:47924675-47924697 GCATTCAGACAAATGGGGGAGGG - Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1177426740 21:20933269-20933291 ACTTACACTAAAATGGGGCAAGG - Intergenic
1178597615 21:33968799-33968821 CCATACACCCATTTGGGGCTTGG + Intergenic
1184047491 22:41980598-41980620 CCATCCATACAATTGGGGTATGG - Intronic
1185144092 22:49120136-49120158 CCTGATAGACAAATGGGGCAAGG - Intergenic
1185186152 22:49401699-49401721 CCAGACACACCACTGGGGCTTGG - Intergenic
1185331635 22:50254651-50254673 CAAAAAACAAAAATGGGGCAAGG + Intronic
949788290 3:7765624-7765646 CTATACACACAAATGTCTCAGGG - Intergenic
953170565 3:40503053-40503075 CAAGACACACACATGGAGCAGGG - Intergenic
954381696 3:50222222-50222244 ACATACACACAAATGGGGTGGGG + Intergenic
955006892 3:54977065-54977087 CCAAAGAAACAAATGGGGTAAGG + Intronic
955181758 3:56678713-56678735 CAAAACATACAAATGGGGCTGGG + Intronic
957240535 3:77655592-77655614 GCATAATCACAAATGGGTCACGG + Intergenic
959704127 3:109324392-109324414 CCACACACACAAAAAGGGCCAGG - Intergenic
963537512 3:146545965-146545987 ACTTACTCACAAATGGGTCATGG + Intergenic
964063223 3:152551196-152551218 ACACACACACACAAGGGGCAGGG + Intergenic
966643272 3:182214464-182214486 CCATTCACAGAAAGGGTGCAGGG + Intergenic
967454104 3:189661652-189661674 CCAGACATACAAAGAGGGCAAGG - Intronic
969045642 4:4334654-4334676 CCATTCCCACCAATGGTGCATGG - Intergenic
972703076 4:41513450-41513472 CCGGATACACAAATGGGGCAAGG - Intronic
975075384 4:70200912-70200934 CCACACACACATATGTGGAAAGG - Intronic
976777600 4:88723063-88723085 GCACACAGACAAATGGGGCTTGG - Intergenic
979820034 4:125159812-125159834 CCATACATACAAATGTATCAGGG + Intergenic
982302628 4:153895444-153895466 CAATACACAAAAGTGGGGGAAGG - Intergenic
995749267 5:115437201-115437223 ATATACACACACATGGGGAATGG + Intergenic
999367110 5:151030307-151030329 ACACACACACAAATTGGTCATGG + Exonic
1001470720 5:172010574-172010596 CCCCACACACAAAGGGGGCTGGG + Intergenic
1003497062 6:6673422-6673444 CTAGACAGACAGATGGGGCAGGG - Intergenic
1003563676 6:7204334-7204356 CTATGCAAACAAATGGGGGATGG - Intronic
1004608780 6:17218971-17218993 CCAGGCCCACAAATGTGGCAGGG - Intergenic
1005395903 6:25381853-25381875 CCCTCCCCAGAAATGGGGCAGGG + Intronic
1006473997 6:34243743-34243765 CCCCACACACAACTAGGGCAGGG - Intronic
1007173859 6:39883241-39883263 TCCTACACAGAGATGGGGCAAGG + Intronic
1008131593 6:47725513-47725535 TCAGACACATAAATGGGGTATGG + Intergenic
1008414398 6:51223062-51223084 GAATACACACAAATGGTACAGGG - Intergenic
1008621831 6:53278530-53278552 CCCCACCCATAAATGGGGCAGGG + Intronic
1012124116 6:95405806-95405828 ACAAACATACAAATGGGGAAAGG + Intergenic
1013990439 6:116248795-116248817 CAATACAAAGAAATGGAGCAGGG + Exonic
1014478359 6:121903365-121903387 CCATCCACAAAACTGTGGCAAGG + Intergenic
1015217469 6:130766920-130766942 CTCTCCACACAAATGGGGCTGGG + Intergenic
1016795399 6:148112158-148112180 CCATCAACAAGAATGGGGCAGGG - Intergenic
1019001340 6:168755514-168755536 CGACATAGACAAATGGGGCAGGG - Intergenic
1019611474 7:1939011-1939033 ACACACACACACATGGGCCAGGG + Intronic
1020669399 7:11087723-11087745 CCACACACACAGATGAAGCATGG - Intronic
1024462587 7:49673608-49673630 AAATCCACACAAATGGGGCTTGG - Intergenic
1026852458 7:73733673-73733695 ACACACACACAAATGTGGCTGGG + Intergenic
1027726451 7:81811726-81811748 CCACACACACATATAGGACATGG + Intergenic
1028526190 7:91789643-91789665 CCATTTCCACAAATGTGGCATGG + Intronic
1028926367 7:96360924-96360946 CTATACACATAAATGGAGCAGGG + Intergenic
1029986595 7:104928481-104928503 ACAAACACACATATGGGGGAAGG + Intergenic
1034233246 7:149548873-149548895 TCATAAACACAGAAGGGGCAGGG - Intergenic
1034281690 7:149859172-149859194 CCATACACACCAGAGGGGGAAGG - Intronic
1034347999 7:150398668-150398690 CCACACACACACCTTGGGCAGGG - Intronic
1037562257 8:20085631-20085653 CCATAGAAACCAAGGGGGCAGGG + Intergenic
1037875474 8:22545017-22545039 CCATACCCACAGATGGGCCCTGG - Intronic
1039569390 8:38574986-38575008 CTACACACACGAATGAGGCACGG - Intergenic
1042484030 8:69331971-69331993 CCATCCACACAAGTGGTTCAGGG + Intergenic
1043517020 8:81004133-81004155 CAAAACACACAGATGGTGCACGG + Intronic
1044134785 8:88572960-88572982 TCAGACAGACAAGTGGGGCAAGG - Intergenic
1046591797 8:116215796-116215818 CCAAACACAAAAATGTGGAAGGG + Intergenic
1048951277 8:139498909-139498931 CTACACACACAGATGGGGCAAGG - Intergenic
1053028759 9:34756392-34756414 CCATACAAAAAAATCGGGCCAGG - Intergenic
1061061359 9:128251931-128251953 CCATAAACCAAAATGAGGCAGGG + Intronic
1187241711 X:17519956-17519978 CCATAAGCACAAATGGGGGTGGG - Intronic
1187252051 X:17607430-17607452 CCATCCACAAAAATGAGGAAGGG + Intronic
1190403054 X:50058179-50058201 GCATTCAAAGAAATGGGGCAGGG - Intronic
1191641700 X:63434001-63434023 CCAGCCACTCATATGGGGCAGGG - Intergenic
1193474780 X:81949639-81949661 ACATACACACAAAAGTGGTATGG + Intergenic
1193652797 X:84159210-84159232 CAATAGACAAGAATGGGGCAGGG - Intronic
1193976419 X:88125217-88125239 CCATACAGACAAGTTTGGCATGG + Intergenic
1195299385 X:103512083-103512105 CCATAGACTCAAAAGGAGCAAGG + Intronic
1195756172 X:108201084-108201106 CCATAGAAATAAAGGGGGCATGG - Intronic
1199070701 X:143471726-143471748 ACATTCACATAAATGGGGGAAGG + Intergenic
1199579316 X:149345523-149345545 CCGTACACACAGAAGGGGCATGG - Intergenic
1199866433 X:151853958-151853980 CCATAAAGACAAAAGTGGCAGGG - Intergenic
1201241902 Y:11965481-11965503 CCATAAATACAGATGGGGTATGG + Intergenic
1202368365 Y:24181851-24181873 CCATATACAAAAATGAAGCAGGG - Intergenic
1202502420 Y:25488266-25488288 CCATATACAAAAATGAAGCAGGG + Intergenic