ID: 1084633769

View in Genome Browser
Species Human (GRCh38)
Location 11:70375911-70375933
Sequence TCTAATGTGGAGTCAATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084633769_1084633774 3 Left 1084633769 11:70375911-70375933 CCATCCATTGACTCCACATTAGA 0: 1
1: 0
2: 1
3: 10
4: 154
Right 1084633774 11:70375937-70375959 CCTGATTTAAAATATTATTATGG 0: 1
1: 0
2: 4
3: 28
4: 513
1084633769_1084633776 28 Left 1084633769 11:70375911-70375933 CCATCCATTGACTCCACATTAGA 0: 1
1: 0
2: 1
3: 10
4: 154
Right 1084633776 11:70375962-70375984 CAATGTAGTCATAGCAGTGAGGG 0: 1
1: 1
2: 1
3: 17
4: 148
1084633769_1084633775 27 Left 1084633769 11:70375911-70375933 CCATCCATTGACTCCACATTAGA 0: 1
1: 0
2: 1
3: 10
4: 154
Right 1084633775 11:70375961-70375983 TCAATGTAGTCATAGCAGTGAGG 0: 1
1: 0
2: 1
3: 9
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084633769 Original CRISPR TCTAATGTGGAGTCAATGGA TGG (reversed) Intronic
905455017 1:38082779-38082801 TGTCATCTGGAGTCATTGGAAGG - Intergenic
908070158 1:60451656-60451678 TCTAATGTTAAGTGCATGGATGG - Intergenic
913261097 1:116998831-116998853 TCTAATCTGGAGAGAATGAATGG - Intergenic
914360695 1:146933315-146933337 TCTAATTTGAAGTCTCTGGACGG + Intergenic
914491889 1:148157324-148157346 TCTAATTTGAAGTCTCTGGACGG - Intergenic
918122205 1:181549915-181549937 TCTACTGTGAAGACAATAGAGGG + Intronic
918692640 1:187500954-187500976 TCTAATCTGGAGGTCATGGAAGG + Intergenic
921195881 1:212757294-212757316 TATAATGGGGAGCCACTGGAGGG + Intronic
923068230 1:230539457-230539479 TCTAATTTAGAGTCATTTGAAGG + Intergenic
1063771810 10:9212278-9212300 CGGTATGTGGAGTCAATGGATGG - Intergenic
1065278096 10:24106393-24106415 TAGAATGTAGAGTAAATGGATGG + Intronic
1065386969 10:25143527-25143549 TCTAAGATGGAGTCAACGGCTGG + Intergenic
1066209115 10:33219211-33219233 TATAATGAGGAGTCAATGAGAGG - Intronic
1067768931 10:49109767-49109789 ACTAATGTGTAGCCAAAGGAGGG + Intronic
1068728282 10:60327152-60327174 TCAAGTGTGGCATCAATGGAGGG + Intronic
1070516779 10:77215208-77215230 TTGGATGTGGAGTGAATGGAAGG - Intronic
1071886755 10:89959969-89959991 TCTAATGCTGAGTCATTCGAGGG - Intergenic
1074150152 10:110752029-110752051 TCTTATGATGAGTCAATGTAGGG - Intronic
1074251907 10:111759399-111759421 TATAATGTGGAGCCAGTGGAGGG - Intergenic
1078300576 11:10127471-10127493 TGGACTGTGGAGGCAATGGAGGG - Intronic
1079920324 11:26425845-26425867 TGTACTTTGGAGTAAATGGATGG + Intronic
1082861661 11:57862853-57862875 TCAGATGTGGAGACACTGGATGG + Intergenic
1084105681 11:66978719-66978741 TCTAGAGTGGAGTCTATGGGGGG + Intergenic
1084633769 11:70375911-70375933 TCTAATGTGGAGTCAATGGATGG - Intronic
1084927321 11:72523850-72523872 TATGATGTGCAGTCAAAGGAGGG - Intergenic
1085081870 11:73641601-73641623 TCAAATTGGGAGTTAATGGAAGG + Intergenic
1085762136 11:79250648-79250670 TCTAATGTTGGGTTAATAGAAGG - Intronic
1086156395 11:83671432-83671454 TCCTATGAGCAGTCAATGGAAGG + Intronic
1086604182 11:88675327-88675349 TTTAATATTGAGTAAATGGACGG + Intronic
1086812233 11:91324506-91324528 TGTAAGGTGGATTCAATGAACGG + Intergenic
1087669798 11:101092444-101092466 TCTAATGTGTAGTCAAAATAAGG - Intronic
1088981874 11:114871456-114871478 TAGAATGTGGAGACAATGGCTGG - Intergenic
1089003885 11:115074767-115074789 ATTAATGAGGAGTCAATGTATGG - Intergenic
1090253551 11:125267307-125267329 TCGTATCTGGAGTGAATGGAAGG + Intronic
1095577546 12:43757970-43757992 TCTATTGGGTGGTCAATGGATGG + Intronic
1095728212 12:45474970-45474992 TCTCATGTGAACTCAGTGGAAGG - Intergenic
1097318644 12:58201257-58201279 TCTAGAATGGAGTCAATGGAGGG + Intergenic
1098717497 12:73849688-73849710 TCTTATGTGGTTGCAATGGAAGG + Intergenic
1100407860 12:94286695-94286717 ACTAATGTGGACTAATTGGAGGG - Intronic
1102281964 12:111625560-111625582 TCAAATGTGAAGTCATTGGAAGG + Intergenic
1107769092 13:43770896-43770918 TCTAGTGTGAAATAAATGGATGG + Intronic
1109004553 13:56855264-56855286 CCTGTTGTAGAGTCAATGGACGG - Intergenic
1113380263 13:109797567-109797589 TCTGAGCTGAAGTCAATGGAAGG - Intergenic
1113507377 13:110826538-110826560 TCTAATGATGATTCAATTGATGG + Intergenic
1115085524 14:29510798-29510820 CCTAATGGGGAGGCATTGGATGG - Intergenic
1117742126 14:58829547-58829569 TCTAGTATGGAGTTAATTGAAGG - Intergenic
1118596204 14:67437474-67437496 TCTAATGGGAAGTGATTGGAGGG + Intergenic
1123962305 15:25416876-25416898 TCCAACCTGCAGTCAATGGAGGG + Intronic
1124198203 15:27652405-27652427 TATCATGTGGAGTCTAAGGAAGG - Intergenic
1125139691 15:36390297-36390319 ACTAATGCTGAGTCAATAGATGG - Intergenic
1125281901 15:38050915-38050937 TGAAATGTGAAGTCACTGGAGGG - Intergenic
1126395824 15:48216148-48216170 TCAAAGGTGTAGTCAATGTAGGG - Intronic
1129557682 15:76529865-76529887 TATGATGAGGAGTCACTGGAGGG + Intronic
1132137777 15:99360360-99360382 TCTAATGTGGGGGCAAAGAAGGG - Intronic
1133253803 16:4503476-4503498 TCTGATTTGGAGTCAAGAGAAGG + Intronic
1133629208 16:7603177-7603199 TTTAATGTAGAGTCTATGGAAGG + Intronic
1135878031 16:26223135-26223157 TCTAAAGGGGAGTCAGTGGTTGG - Intergenic
1136539738 16:30922769-30922791 TCTCAAGTCGAGACAATGGAAGG - Intergenic
1137542934 16:49377354-49377376 TCCAGTGTGGAGTCACAGGAAGG - Intronic
1137749576 16:50849558-50849580 TGTCAGGTGGAGTCTATGGAAGG + Intergenic
1141795768 16:86272900-86272922 TGGAATGTGGATGCAATGGATGG + Intergenic
1145217495 17:21062924-21062946 TCTAATCAGGAGTAAATGGTAGG + Intergenic
1146706479 17:35004101-35004123 TATAATTTGGAGTGACTGGAGGG + Intronic
1147959099 17:44155269-44155291 TCCAATCTGGAGTCAAGGAAAGG - Exonic
1148291271 17:46452479-46452501 TCTAATTTGGATTCCATGGATGG + Intergenic
1148313458 17:46670182-46670204 TCTAATTTGGATTCCATGGATGG + Intronic
1148584991 17:48771302-48771324 TAGAATGTGAAGTTAATGGATGG + Intronic
1149265555 17:54924046-54924068 TATAATGGGAAGCCAATGGAGGG - Intronic
1154341352 18:13505030-13505052 TCTGGTGTGGGGACAATGGATGG - Intronic
1156693030 18:39731382-39731404 TCTAATATGAAGTCATTGTATGG - Intergenic
1156816598 18:41318995-41319017 TCTAAGGACAAGTCAATGGAAGG - Intergenic
1157674536 18:49559497-49559519 TTTAATGTGGAGACACAGGAGGG + Intergenic
1157964942 18:52197627-52197649 TCTAAGGTGGAGTCAGGAGATGG + Intergenic
1160311874 18:77800538-77800560 TCCACTGTAGAGTCAAAGGATGG + Intergenic
1164296579 19:23915465-23915487 TCTAATTTGTATTCCATGGAAGG + Intronic
1164842692 19:31405349-31405371 TCCCATCTGGAGGCAATGGAGGG + Intergenic
925988158 2:9232355-9232377 TCTAATGTGGCCTCCAAGGAAGG - Intronic
926637886 2:15203376-15203398 CCTAATGTTAAGTCCATGGAAGG + Intronic
926858589 2:17283814-17283836 GCTAATGGGGAGTCACTGAATGG + Intergenic
927523004 2:23712440-23712462 TCTAATGAGGCGGCAGTGGATGG - Intergenic
928020066 2:27697426-27697448 CCTAATGTGGAGCCCATGGTGGG + Intergenic
928043801 2:27906657-27906679 CCTAAAGTGAAGTCATTGGAGGG - Intronic
929248120 2:39724537-39724559 TCTGATGTGGAGTCAAAACAAGG + Intergenic
930661371 2:54057783-54057805 TCAAATGAGGAGTCAAAGCAGGG + Intronic
933220432 2:79681338-79681360 TCTGATGTGGTCTCACTGGAAGG - Intronic
933982615 2:87565365-87565387 TGAAATGTGAAGTCACTGGATGG + Intergenic
935623524 2:105149303-105149325 ACAAATGTTGAGTGAATGGATGG + Intergenic
936311225 2:111385428-111385450 TGAAATGTGAAGTCACTGGATGG - Intergenic
937106273 2:119316779-119316801 TTTAATGAGGACTCTATGGAAGG + Intronic
939290149 2:140183290-140183312 TCCAATGTGGAGCCAGGGGAAGG - Intergenic
939455907 2:142435200-142435222 TTTAATATGCAGTCAATGTATGG - Intergenic
941162891 2:162055238-162055260 TCCAATATGGAGGCTATGGATGG - Intronic
942944699 2:181659488-181659510 AATAATGGGAAGTCAATGGAAGG - Intronic
944380043 2:199098010-199098032 CCTAATGGGAAGTCAATGAACGG + Intergenic
947436830 2:230080169-230080191 TCTAATGTGTAGCCAAGGCAGGG - Intergenic
948340951 2:237251203-237251225 CATAATGTGGAATTAATGGAAGG - Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1171213499 20:23335010-23335032 TCTAATGAGCAGCCTATGGAAGG + Intergenic
1177489820 21:21808213-21808235 TGTAATCTAGGGTCAATGGAAGG + Intergenic
949874777 3:8618995-8619017 TCTAGTGTGGTGTCTATGTAAGG - Intergenic
951002052 3:17574253-17574275 CTTAATTTGGAGGCAATGGAAGG - Intronic
952232381 3:31445430-31445452 TCTAATGTGGAGTCCAGGTTAGG + Intergenic
952233269 3:31453782-31453804 ACATATGTGGAGCCAATGGATGG - Intergenic
953138621 3:40206114-40206136 GCTGATATGGAGTCCATGGATGG - Intronic
954884522 3:53860212-53860234 TCTAATGTGGAGGCACGGTAAGG + Exonic
959610481 3:108288533-108288555 TAAAATGTGAAGTCAAGGGATGG + Intergenic
963400856 3:144796937-144796959 TCTAGTGTGGATTGAATGGCTGG - Intergenic
970590344 4:17554716-17554738 TAAAATGTGGAGTCTAGGGAAGG - Intergenic
976129438 4:81869457-81869479 TCCAATGTGGAGTCATTGGAGGG - Intronic
977722348 4:100254383-100254405 TTTATTGTGGAGTAAAGGGAAGG + Intergenic
981835386 4:149047462-149047484 TCTAATGTGAAGTCATTTGGGGG - Intergenic
984386693 4:179069135-179069157 TCCACCGTAGAGTCAATGGAAGG + Intergenic
986433655 5:7706555-7706577 TCTAATCTGGAGTGACTGGAAGG + Intronic
987425587 5:17769107-17769129 GCTAAGGTGGGGTTAATGGATGG - Intergenic
988090269 5:26530260-26530282 TGCATTGTGCAGTCAATGGAAGG - Intergenic
990998347 5:61756346-61756368 TTTTATGAGGACTCAATGGAAGG + Intergenic
993230873 5:85234350-85234372 TCTAATGTGAAGCAAAGGGAGGG - Intergenic
995406989 5:111809411-111809433 TCTAATGTGGCAGCATTGGAAGG + Intronic
995545878 5:113230017-113230039 GCTAATGTGTAGTCAAAGGATGG + Intronic
997584408 5:135035846-135035868 ACTAACGTGGAGGGAATGGAAGG - Intronic
998527358 5:142854973-142854995 TATGATGTGGAGGCAAGGGAAGG - Intronic
998551338 5:143080735-143080757 TGTAATGGGGAGCCACTGGAGGG + Intronic
999682342 5:154072073-154072095 TCTAATGTGCAGCCAAGGGTGGG - Intronic
1001325283 5:170719382-170719404 TCAAAAGTGGAGTCAGAGGACGG + Intronic
1006979214 6:38133149-38133171 TCTTCTGTGGAGTCCATGGTTGG + Intronic
1011433781 6:87315907-87315929 TGTAATGGGAAGTCTATGGAGGG - Intronic
1011599754 6:89049054-89049076 TCTAATGGGGAGTTATTGGCTGG - Intergenic
1013581108 6:111535613-111535635 TCTAAAGTGGAATCCAGGGAGGG - Intergenic
1016999053 6:149983069-149983091 TCTAAAGTGTAGTGAATGAATGG + Intergenic
1017374163 6:153748177-153748199 TGTAATGTGGAGTGAATGGCAGG + Intergenic
1019936626 7:4262341-4262363 TTTGATGTGAAGTCATTGGAAGG - Intronic
1026251851 7:68678223-68678245 TGAAATGTAGAGTAAATGGAAGG - Intergenic
1034351861 7:150421253-150421275 TCTGACGTTGAGTGAATGGATGG + Intergenic
1034490835 7:151392342-151392364 CCTAATGAGGAGTCAGTGGTGGG - Intronic
1035603300 8:911834-911856 GGAAATGTGGATTCAATGGAAGG - Intergenic
1038391569 8:27206897-27206919 TCTAATCTGAAGGCAATGGGAGG - Intergenic
1041749202 8:61240408-61240430 GCTATTGTGGAGTCACAGGAAGG - Intronic
1042382320 8:68131167-68131189 TGTAGTGTGGAATGAATGGAGGG + Intronic
1043975295 8:86578664-86578686 AATAAGGTGGAGTGAATGGACGG - Intronic
1044235597 8:89826599-89826621 TTTAATGTGGGCTCAAGGGAAGG + Intergenic
1047133148 8:122045158-122045180 TGTAATGTGAAGCCATTGGAAGG + Intergenic
1048108540 8:131440446-131440468 TGAAATGGGGAGTCACTGGAAGG + Intergenic
1048573694 8:135674928-135674950 TGGAATGTGGAGGCAATGGCTGG - Intergenic
1050513321 9:6416361-6416383 TCAAATGTGGAGTCAAGGCTGGG - Intronic
1051444149 9:17122369-17122391 TGATATGTGGAGTGAATGGAGGG + Intergenic
1052188676 9:25630222-25630244 TCTTAAGTGGAGTGAATGGGAGG + Intergenic
1052616095 9:30843798-30843820 TGAAATTTGGAGGCAATGGATGG - Intergenic
1052619419 9:30886959-30886981 TCTATTGTGGAGTGGACGGAGGG - Intergenic
1054759429 9:68991497-68991519 TCTAATGTTGAGGCAAAGTAGGG + Intronic
1055123917 9:72696616-72696638 TCAAATGTTGTGTCAATGCAAGG - Intronic
1055146953 9:72947323-72947345 TCTATTGTGAAGTAACTGGAAGG + Intronic
1055521463 9:77085303-77085325 TCTAAAGTAGAATCAATGTAAGG + Intergenic
1058874988 9:109236389-109236411 CATAATGTTAAGTCAATGGATGG - Intronic
1186167860 X:6845877-6845899 CCTAAAGTGGAGTCTGTGGATGG + Intergenic
1187284655 X:17893369-17893391 TCAAATGTGAAATAAATGGAGGG + Intergenic
1187377696 X:18770987-18771009 TCTAATGTGCAGTCAAGGTTGGG + Intronic
1187851928 X:23599508-23599530 TCTAGTGGGCAGTCAAGGGAAGG + Intergenic
1190120096 X:47651966-47651988 TCTAAACTGGAGTCAAGGGAGGG - Intronic
1192082349 X:68060647-68060669 TCAAATGTTAAGTCAATGCAAGG + Intronic
1195024363 X:100861444-100861466 TATATTGAGGAGTAAATGGAAGG - Intronic
1195416192 X:104621836-104621858 TCTCATATGCTGTCAATGGATGG + Intronic
1198244615 X:134818015-134818037 TCAAAGATGGAATCAATGGACGG + Intronic
1198517810 X:137426986-137427008 TCTATTGTGGAGGGAAAGGAAGG + Intergenic
1198537182 X:137598108-137598130 TCTAATGTGAATACACTGGAGGG - Intergenic
1199900422 X:152167179-152167201 TGGAATGTGGAGTGTATGGAAGG + Exonic
1201501180 Y:14644518-14644540 TCTGAAGTGTAGTCAATGTATGG + Intronic