ID: 1084634035

View in Genome Browser
Species Human (GRCh38)
Location 11:70378118-70378140
Sequence AGACTCTCCCTGCAAACTTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084634032_1084634035 14 Left 1084634032 11:70378081-70378103 CCAAAGGACATTCGTGGCTTAGC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1084634035 11:70378118-70378140 AGACTCTCCCTGCAAACTTCCGG 0: 1
1: 0
2: 0
3: 19
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084634035 Original CRISPR AGACTCTCCCTGCAAACTTC CGG Exonic
900763546 1:4488568-4488590 ACCCTCTCCCTGCATACTTTCGG - Intergenic
906516539 1:46442401-46442423 TGACTCTCCCTGCACACATGTGG + Intergenic
906580087 1:46929057-46929079 GGGCTCTCCCTGAAACCTTCTGG + Intergenic
908006120 1:59731322-59731344 AGACTTTCCCGGAATACTTCAGG + Intronic
908593493 1:65658821-65658843 AGATTCTCCCGGAAAATTTCAGG + Intergenic
909418972 1:75441368-75441390 GTACTCTCCCTGCAAACATTTGG - Intronic
910191369 1:84599237-84599259 TAGCTCTCCCTGCAAACTTGGGG + Intergenic
912519275 1:110234177-110234199 AGTCTCTCCCTGTAAAATGCAGG - Intronic
914686902 1:149988107-149988129 CTACTCACCCTGCATACTTCTGG + Intronic
918254740 1:182739131-182739153 AGACTTTCCCAGCACACTTGTGG - Intergenic
920050833 1:203163879-203163901 AGCCTCTCCCTTCACACTCCTGG + Intronic
920147880 1:203878321-203878343 AGACTGGTCCTGCAAACTCCTGG + Intergenic
920765643 1:208831004-208831026 ATTCTCTCCCTGTAAACTCCAGG + Intergenic
922160253 1:223074513-223074535 AGACTCTCCCTGGAAAGCTTGGG + Intergenic
922356645 1:224782704-224782726 ACACTCTCCCTCCAAAACTCAGG - Intergenic
922858958 1:228799073-228799095 AGAGTCTCACTTCAAACTGCTGG - Intergenic
923712159 1:236395972-236395994 AGACACGTCCTGCAAACCTCTGG + Intronic
924110933 1:240699429-240699451 AGACTTTCTCTGCCAAGTTCAGG + Intergenic
1063698976 10:8366256-8366278 AGACTGTCCTTGCATGCTTCAGG + Intergenic
1067567127 10:47347459-47347481 TGATTCTCCCTGCGAACTGCAGG + Intergenic
1067925660 10:50505774-50505796 AGACTTTCCCTGACCACTTCAGG - Intronic
1068671494 10:59727994-59728016 AGACTCACCCTGTTAATTTCTGG - Intronic
1070808010 10:79282072-79282094 AGTCTCTCCTTGCAACCTTTAGG + Intronic
1073090381 10:100932981-100933003 AGAGTCTCACTGAAAACTGCTGG - Intronic
1073470828 10:103721107-103721129 AGCCCCTCCCTGCAAAAGTCAGG + Intronic
1077666517 11:4115473-4115495 AGATTCTCCCTCAAAACCTCTGG + Intronic
1078088746 11:8250942-8250964 AGACTCTACCTGGAAACAGCAGG + Intronic
1078754233 11:14193682-14193704 AGACTCTGCCTTCAAAGCTCGGG + Intronic
1079387870 11:19996983-19997005 AGTCTCTCTCTCCAAACCTCAGG - Intronic
1080744888 11:35100038-35100060 ACATTCTCTCTGCAAACTACAGG + Intergenic
1080835045 11:35932652-35932674 AGCCTCTTCCTGCAAATTTCTGG - Intergenic
1083090193 11:60191643-60191665 AGAATCACCCTGATAACTTCTGG + Intergenic
1083374753 11:62210411-62210433 AGATTCTGGCTGCAAACTCCTGG + Exonic
1084634035 11:70378118-70378140 AGACTCTCCCTGCAAACTTCCGG + Exonic
1086973149 11:93105060-93105082 AGAATCACCCTGATAACTTCTGG - Intergenic
1088674196 11:112175764-112175786 AGAAGCTCCCAGCAACCTTCAGG - Intronic
1093889185 12:24499051-24499073 ATGCTCTCCCTGCACCCTTCAGG + Intergenic
1095516030 12:43006534-43006556 TGGCTCTCCATTCAAACTTCAGG + Intergenic
1095542789 12:43330189-43330211 AGAATCGCCCTGCAGAGTTCAGG + Intergenic
1095936106 12:47683286-47683308 TGTCACTCCCTGCAAATTTCGGG + Intronic
1098248702 12:68546417-68546439 AGAATCACCCTGATAACTTCTGG + Intergenic
1100355672 12:93826963-93826985 AGACTCTCCCAGAATACTGCAGG - Intronic
1102356969 12:112245534-112245556 AGGTTCTCCCTGAGAACTTCAGG - Intronic
1105542881 13:21329897-21329919 AGACTCTCCCTGAAGACATCAGG - Intergenic
1107002597 13:35566983-35567005 TGACTCTTCCAGGAAACTTCAGG + Exonic
1107432135 13:40349707-40349729 AGAGTCTGCCTCCAAGCTTCTGG - Intergenic
1107969614 13:45628640-45628662 AGAATCTCCCTGGAAACTGATGG + Intergenic
1108164275 13:47675962-47675984 AGACTCTCCTTCCAAAGTCCAGG - Intergenic
1109267120 13:60214623-60214645 AGATCCTCCATGCAATCTTCTGG + Intergenic
1109720111 13:66265168-66265190 AGACTCTGCTGGCAAACTTCTGG - Intergenic
1114055369 14:18963576-18963598 ATCCCCTCCCTGCAAACTGCAGG - Intergenic
1114107176 14:19438188-19438210 ATCCCCTCCCTGCAAACTGCAGG + Intergenic
1117434622 14:55704050-55704072 CGACTCTCCCTGCAGACCTTGGG + Intergenic
1121356428 14:93219247-93219269 AAAATCTGGCTGCAAACTTCAGG + Exonic
1121931299 14:97974963-97974985 ATCCTCTCCCCGCAAAGTTCAGG - Intronic
1202838229 14_GL000009v2_random:94767-94789 AGACCCTCCCAGCAGTCTTCTGG - Intergenic
1202907588 14_GL000194v1_random:84733-84755 AGACCCTCCCAGCAGTCTTCTGG - Intergenic
1123796750 15:23780335-23780357 ACACGCTCCTTGCAAACTTTTGG - Intergenic
1127641200 15:60917496-60917518 AGACACTCCCGGGAAACTGCTGG + Intronic
1128077408 15:64836272-64836294 AGACTGTCCTTGTAAGCTTCGGG - Intergenic
1128328959 15:66743192-66743214 CCACTCTCACTGCAAACTGCAGG - Intronic
1128766042 15:70251788-70251810 AGACTCTACCTGCAAGCTCCTGG - Intergenic
1130696417 15:86136148-86136170 AGAATCTCCCAGCCAAGTTCTGG + Intergenic
1134661183 16:15985855-15985877 GGATTCTCCCTGCAAGCTTCCGG - Intronic
1138200131 16:55082269-55082291 CAACTCACCCTGCACACTTCCGG + Intergenic
1140800879 16:78487417-78487439 AGAGACTCCCTTCAAACTTGTGG - Intronic
1141615996 16:85209712-85209734 AGACTCTCCCTCCCAGCCTCGGG - Intergenic
1142248029 16:88978708-88978730 AGACTCTCACTGCACACAGCTGG - Intergenic
1147176414 17:38658808-38658830 GGGCTCTCCGTGCAAACTCCAGG + Intergenic
1152040323 17:77898774-77898796 AGACTCTCCCTGCCCACTGATGG + Intergenic
1152388625 17:79990010-79990032 AGACTCTCCCTGTTGTCTTCTGG - Intronic
1152455261 17:80411968-80411990 AGAATCACCCTGATAACTTCTGG + Intergenic
1158550236 18:58429689-58429711 ACACTCTCACTGCAGGCTTCTGG + Intergenic
1159021356 18:63145657-63145679 AAACTTGCCTTGCAAACTTCTGG - Intronic
1160154452 18:76423010-76423032 AGGGTCTCCATGCAAACTCCAGG - Intronic
1164216599 19:23156055-23156077 AGAATCACCCTGGTAACTTCTGG - Intergenic
1168158146 19:54489844-54489866 AGACTCTCCCTCCAAAATGCAGG - Intergenic
925232339 2:2244812-2244834 AGGTTCTCCCTGCAAACTGACGG + Intronic
925870904 2:8269567-8269589 TGAATCTCCTTGCAAATTTCTGG - Intergenic
926335793 2:11861737-11861759 AGCCTCTCCCTGCACACTGAGGG - Intergenic
926426469 2:12743105-12743127 ACACTCTCCCTGAGAACATCTGG - Intergenic
927201703 2:20582364-20582386 AGCCACTCCCTGCACACCTCCGG - Intronic
927910982 2:26899588-26899610 AGCCTCTGCCTGCACACTTACGG - Intronic
931297599 2:60944203-60944225 AGAGGCTCCCTGCAACCTTGAGG + Intronic
934551678 2:95266806-95266828 AGACGCTCCCTGCCAAGGTCTGG - Intergenic
936881182 2:117252817-117252839 AGACTCCCTCTGCAAATTTAGGG + Intergenic
936891018 2:117370472-117370494 TGAGTCTCCCTGAAAACTTGGGG + Intergenic
938473386 2:131586338-131586360 ATCCCCTCCCTGCAAACTGCAGG - Intergenic
941381471 2:164798119-164798141 ATACTCTCACTGCAGAATTCTGG + Intronic
948986879 2:241531013-241531035 AGACTTTCCATGCAAAAATCAGG - Intergenic
1171020533 20:21580813-21580835 AGCCTCTCCCTGCACCCATCTGG + Intergenic
1172985875 20:38988806-38988828 CTACTCTCCCTGCAACCTTTGGG - Exonic
1173992234 20:47312354-47312376 AGCCTCACCATGCAAGCTTCTGG + Intronic
1176626890 21:9099071-9099093 AGACCCTCCCAGCAGTCTTCTGG - Intergenic
1178263744 21:31123705-31123727 AAATCCTCCCTGCAAAATTCTGG + Intronic
1180417321 22:12779275-12779297 AGACTCTCCCAGCAGTCTTCTGG - Intergenic
1180473849 22:15686128-15686150 ATCCCCTCCCTGCAAACTGCAGG - Intergenic
1184717416 22:46289939-46289961 AGGCTCTCCCTGCAGACCTCAGG + Intronic
949432491 3:3992746-3992768 AGTCTCACCCTGAAGACTTCGGG - Intronic
951249644 3:20380099-20380121 AGCCTCTCACTGAAAACTTCTGG + Intergenic
964185717 3:153940240-153940262 AGACTCTCACTGCTGACTTGTGG - Intergenic
964317969 3:155464285-155464307 AGACTCTCTATGCAAGCTTATGG + Intronic
964932703 3:162046068-162046090 AGAATCACCCTGATAACTTCTGG - Intergenic
965065596 3:163843581-163843603 AGACTCTCCCTGCCAAATCCTGG + Intergenic
967249192 3:187519613-187519635 AGAGTGTGCCTGCAGACTTCAGG + Intergenic
968189801 3:196659650-196659672 AGACTGTCCCTGCAACCGCCGGG - Intronic
968563029 4:1294998-1295020 AGACCCTCCCTGCACAGCTCTGG - Intronic
969605421 4:8199944-8199966 AGACCCTCCCTGGAATTTTCAGG - Intronic
971479261 4:27099645-27099667 TGACACTGCCTGGAAACTTCAGG + Intergenic
973364480 4:49198059-49198081 AGACTCTCCCAGCAGTCTTCTGG + Intergenic
973396594 4:49598631-49598653 AGACTCTCCCAGCAGTCTTCTGG - Intergenic
974480637 4:62438306-62438328 AGACTGTCCCTGCAAAGCCCAGG - Intergenic
975205966 4:71644436-71644458 AGAATCACCCTGATAACTTCTGG + Intergenic
976962846 4:91000812-91000834 AGACTCTGCCAGAAAACTCCTGG - Intronic
977043248 4:92039970-92039992 AGAATCACCCTGATAACTTCTGG - Intergenic
979891517 4:126102127-126102149 AGTCTCTACATGCAAGCTTCAGG - Intergenic
984391829 4:179144313-179144335 AGACTCTACCAACAATCTTCTGG + Intergenic
984496154 4:180499457-180499479 ACACTCTCCCTCCAACCTTCTGG + Intergenic
1202761809 4_GL000008v2_random:119240-119262 AGACCCTCCCAGCAGTCTTCTGG + Intergenic
986689515 5:10302572-10302594 AGAGTCTCGCTGCAACCTCCTGG - Intronic
993887678 5:93435574-93435596 ACACTGTTCCTGCAAACTACTGG + Intergenic
994163641 5:96584703-96584725 AGACTCCTCCTCTAAACTTCTGG - Intronic
1000237116 5:159372321-159372343 AGAATCACCCTGATAACTTCTGG + Intergenic
1000588005 5:163123440-163123462 CTACTCTCCCAGCAAATTTCAGG - Intergenic
1003409125 6:5847890-5847912 AGACTTTCCCTGAAGACATCAGG + Intergenic
1003742024 6:8951591-8951613 AGACTAGCTGTGCAAACTTCAGG + Intergenic
1005462238 6:26080189-26080211 AGACTCACCCTGATAACTTCTGG + Intergenic
1008543874 6:52568845-52568867 ACTCTGTCCCTGCAAAATTCAGG + Intronic
1008632559 6:53377121-53377143 AGACTCTCAGTGCAAACATCTGG - Intergenic
1009627787 6:66159594-66159616 TGTCTCTCCCTCCAAATTTCCGG - Intergenic
1011414133 6:87100078-87100100 AGACTTCCCCTGCAAAATTAGGG - Intergenic
1012426305 6:99118568-99118590 CAACTCTCCCTGTAAACTACTGG - Intergenic
1013627333 6:111951045-111951067 AGAGTCACCCTGCATCCTTCAGG + Intergenic
1014286498 6:119504590-119504612 AAACACTACCAGCAAACTTCAGG - Intergenic
1015249368 6:131110915-131110937 ATAATCTCCCAACAAACTTCAGG + Intergenic
1019118164 6:169782699-169782721 AGTCTCACCCTGCAGTCTTCTGG + Intergenic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1020679793 7:11222306-11222328 AAACTTTCCCTCCAAACATCAGG + Intergenic
1021774989 7:24044803-24044825 AGACTCTCCCTGAGAGCTACTGG + Intergenic
1024746891 7:52418010-52418032 AGACGCTCACTGCAAACCTAAGG + Intergenic
1024827449 7:53407986-53408008 AGATTTTCCCAGCTAACTTCTGG - Intergenic
1028430897 7:90745449-90745471 GAACTCTCCCAGAAAACTTCAGG - Intronic
1031323260 7:120360111-120360133 TAACTCTCCATGCAAAATTCTGG + Intronic
1031908049 7:127483318-127483340 AGACTCTCACTGCATACATGTGG - Intergenic
1035232415 7:157473715-157473737 ATACTTTCCCAGCAAAATTCAGG + Intergenic
1037670306 8:21009721-21009743 TGAGTCTCCCTGAAAACTTGGGG - Intergenic
1038089974 8:24241776-24241798 AGAATCACCCTGATAACTTCTGG + Intergenic
1038714407 8:29979116-29979138 AAAATCTCACTGCAAACCTCTGG + Intergenic
1039410870 8:37354032-37354054 AGGCTATCTCTGCAAACCTCAGG + Intergenic
1039613480 8:38937120-38937142 AGACTCTGCCTGCATACCACAGG - Intronic
1040521066 8:48176522-48176544 AATCTCTCCATGCAAACTTCAGG + Intergenic
1046337009 8:112803805-112803827 AGAGGATGCCTGCAAACTTCTGG - Intronic
1049744645 8:144258120-144258142 AGACTCTCCCTGCCAGTTTCTGG + Intronic
1049827784 8:144680985-144681007 AGACTACCCCTGCAAAATCCTGG + Intergenic
1051192810 9:14533087-14533109 AGATTCTCCCTGCAGTATTCAGG - Intergenic
1052508387 9:29383126-29383148 AGAATCACCCTGATAACTTCTGG + Intergenic
1053123682 9:35563222-35563244 AGACTCTCCCTGGGAACCTCAGG + Exonic
1053146676 9:35716822-35716844 AGACACTCTCTGAAAACTTTTGG + Intronic
1053852840 9:42307239-42307261 TGACTCTCCCAGCACACCTCTGG + Intergenic
1054571198 9:66812763-66812785 TGACTCTCCCAGCACACCTCTGG - Intergenic
1055706885 9:79015376-79015398 AGACTCACCCTTCAGAATTCAGG + Intergenic
1056205006 9:84311444-84311466 AGAGTCTCACTGCAGACTTTGGG - Intronic
1056920563 9:90784520-90784542 AGACTCTGCCTGCAGACTGCTGG + Intergenic
1059012748 9:110480262-110480284 AGACTGTCCCTGAATTCTTCAGG - Intronic
1203542578 Un_KI270743v1:104121-104143 AGACCCTCCCGGCAGTCTTCTGG + Intergenic
1187024035 X:15414608-15414630 TGACTTTCCCTGCTAATTTCAGG - Intronic
1187851214 X:23593261-23593283 AGACTCCCACGGCTAACTTCTGG - Intergenic
1191639531 X:63415178-63415200 AGAATCACCCTGATAACTTCTGG + Intergenic
1195146005 X:102018196-102018218 AGACTGTCCCTGACAACTTTGGG + Intergenic
1196459756 X:115917968-115917990 AGAATCACCCTGATAACTTCTGG - Intergenic
1198491632 X:137147203-137147225 AGGCTCTCCCTGCCTACTCCAGG - Intergenic
1199672783 X:150160868-150160890 AGACTCTCCCAGAAAACACCTGG - Intergenic
1200766336 Y:7083718-7083740 AGATTCTCCCAGCAGCCTTCTGG + Intronic
1201163461 Y:11184891-11184913 AGACCCTCCCAGCAGTCTTCTGG - Intergenic
1202046151 Y:20738780-20738802 AGATTCTCCCAGCAGCCTTCTGG + Intergenic
1202152211 Y:21853791-21853813 AGACTCACACTGGCAACTTCTGG - Intergenic