ID: 1084634997

View in Genome Browser
Species Human (GRCh38)
Location 11:70385960-70385982
Sequence CTGGCAAAAGATGCAGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084634993_1084634997 13 Left 1084634993 11:70385924-70385946 CCGTTAATCTTCAAACTTGAGTG No data
Right 1084634997 11:70385960-70385982 CTGGCAAAAGATGCAGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084634997 Original CRISPR CTGGCAAAAGATGCAGTTGT GGG Intergenic
No off target data available for this crispr