ID: 1084636766

View in Genome Browser
Species Human (GRCh38)
Location 11:70398320-70398342
Sequence GCAGCACACAGCCCGCGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084636766_1084636773 15 Left 1084636766 11:70398320-70398342 CCCCGCCGCGGGCTGTGTGCTGC 0: 1
1: 0
2: 1
3: 7
4: 138
Right 1084636773 11:70398358-70398380 TGCGCGCGCAACGCTACTTCCGG 0: 1
1: 0
2: 0
3: 0
4: 5
1084636766_1084636774 16 Left 1084636766 11:70398320-70398342 CCCCGCCGCGGGCTGTGTGCTGC 0: 1
1: 0
2: 1
3: 7
4: 138
Right 1084636774 11:70398359-70398381 GCGCGCGCAACGCTACTTCCGGG 0: 1
1: 0
2: 0
3: 0
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084636766 Original CRISPR GCAGCACACAGCCCGCGGCG GGG (reversed) Intergenic