ID: 1084636766 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:70398320-70398342 |
| Sequence | GCAGCACACAGCCCGCGGCG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 147 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 7, 4: 138} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1084636766_1084636773 | 15 | Left | 1084636766 | 11:70398320-70398342 | CCCCGCCGCGGGCTGTGTGCTGC | 0: 1 1: 0 2: 1 3: 7 4: 138 |
||
| Right | 1084636773 | 11:70398358-70398380 | TGCGCGCGCAACGCTACTTCCGG | 0: 1 1: 0 2: 0 3: 0 4: 5 |
||||
| 1084636766_1084636774 | 16 | Left | 1084636766 | 11:70398320-70398342 | CCCCGCCGCGGGCTGTGTGCTGC | 0: 1 1: 0 2: 1 3: 7 4: 138 |
||
| Right | 1084636774 | 11:70398359-70398381 | GCGCGCGCAACGCTACTTCCGGG | 0: 1 1: 0 2: 0 3: 0 4: 19 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1084636766 | Original CRISPR | GCAGCACACAGCCCGCGGCG GGG (reversed) | Intergenic | ||