ID: 1084639981

View in Genome Browser
Species Human (GRCh38)
Location 11:70419813-70419835
Sequence CTTTGAGTATCAAGGCAAAA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 210}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084639981 Original CRISPR CTTTGAGTATCAAGGCAAAA CGG Exonic
901345727 1:8540015-8540037 CATTAAGTGTAAAGGCAAAATGG - Intronic
912018855 1:105078179-105078201 TTTTGACTATCAAGTAAAAAAGG + Intergenic
915302128 1:154957729-154957751 CTTTGAGTACCATGGCAATGAGG + Exonic
917023654 1:170616924-170616946 CTTTGAGAAGCATGGCAAATAGG - Intergenic
920048258 1:203147521-203147543 CTTTGAGTAGCAAGGCCCAGTGG - Intronic
920746981 1:208638176-208638198 CTTTGAATAGCAAGGGAATAAGG - Intergenic
922578663 1:226680789-226680811 CTATGGGCTTCAAGGCAAAAGGG - Intronic
924570447 1:245233404-245233426 CTTTGAGTAGCAAGGTACTAAGG - Intronic
1063306877 10:4910668-4910690 TTATGAGTGGCAAGGCAAAATGG - Intergenic
1066153280 10:32647983-32648005 ATATGAGTATCAACTCAAAATGG - Intronic
1066604197 10:37143286-37143308 ATTTGAGTATCAGGGCATACTGG + Intronic
1067315564 10:45158157-45158179 ATTTGAGTATCAGGGCATACTGG + Intergenic
1068811408 10:61259496-61259518 GTTTGAGTAGCAAAGCTAAAAGG - Intergenic
1069669781 10:70192425-70192447 CTGGGAGTCTCAAGGCAGAAAGG - Intergenic
1070176541 10:73975411-73975433 CTTGGAGAAGCAATGCAAAATGG + Intergenic
1073580588 10:104662206-104662228 CTGAGAGTATCAGAGCAAAAGGG + Intronic
1073808610 10:107127686-107127708 CTTTGAGCATGAGGGCAGAAGGG - Intronic
1074110088 10:110416884-110416906 CTTTGAGAATCAAGGCCTACTGG + Intergenic
1076581263 10:131513505-131513527 CTTTGAGTCTCTAGTGAAAATGG - Intergenic
1078451626 11:11444640-11444662 CTTTCAGTACCAAGAAAAAAAGG + Intronic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1082145543 11:48663325-48663347 CTTTGAGTTCAATGGCAAAAAGG + Intergenic
1083710620 11:64546236-64546258 CTTTGAGTAGCAAGGGTAGAGGG + Intergenic
1084177472 11:67430743-67430765 TTTTGATTGTCAAGGCAAGAGGG + Intronic
1084639981 11:70419813-70419835 CTTTGAGTATCAAGGCAAAACGG + Exonic
1085809209 11:79665375-79665397 CTTTGTGTATCCAGGTAAGATGG + Intergenic
1086948931 11:92871315-92871337 CTTTGAGTAGCAAGGGTTAAGGG - Intronic
1088717508 11:112561671-112561693 CTTTGAGGATCAAGGAAACTGGG - Intergenic
1093868590 12:24258328-24258350 CTTTGAGCAGCAATGAAAAATGG + Intergenic
1096626869 12:52901240-52901262 ATTAGAGGATGAAGGCAAAAGGG + Intronic
1096885915 12:54719210-54719232 CTTGGAGGCTAAAGGCAAAAGGG - Intergenic
1096928427 12:55175246-55175268 ATTGGAGTATTAAGGAAAAAGGG - Intergenic
1097600278 12:61683206-61683228 CTTTTAGACTCAAGGCAAAAGGG + Intergenic
1098781767 12:74695987-74696009 CTTTGAGTATAAATAAAAAATGG - Intergenic
1102061006 12:109931015-109931037 CTGTGAGTAGCATGGGAAAAGGG - Exonic
1102832384 12:116015669-116015691 CAATGAGTTTCAAGGCAAAAGGG + Intronic
1107086225 13:36430852-36430874 CTTTGAATATGAAGGAAACACGG - Intergenic
1108428843 13:50333781-50333803 CTTTGAGGATCAAGGGGAAGTGG - Intronic
1111178733 13:84635100-84635122 CTTAGAGTTTGAAGGCAAGATGG + Intergenic
1111905907 13:94255887-94255909 CTTTGAGTAGCAAGGCTCTAGGG - Intronic
1112067371 13:95807969-95807991 CTTTGTGTAACAAGGCTTAAAGG + Intronic
1112433356 13:99372618-99372640 CTCTGAGTCTAAAGGGAAAATGG + Intronic
1116991523 14:51282105-51282127 TTTTGAATATCAAGGGAGAAAGG - Intergenic
1117445628 14:55801328-55801350 CTTGGAGTTTAAAGGCAAGATGG - Intergenic
1117488354 14:56221644-56221666 CTTTGAGCATCTACACAAAAAGG - Intronic
1118845108 14:69542067-69542089 GTTTGAGTGTCTAGGAAAAAGGG + Intergenic
1119529214 14:75347920-75347942 CTTTGACTATAAGGGAAAAAGGG + Intergenic
1119615321 14:76095209-76095231 CCTTGAGTCTAGAGGCAAAATGG + Intergenic
1120217284 14:81693877-81693899 CTTGCAGTATCACAGCAAAAAGG - Intergenic
1120443557 14:84566214-84566236 CTTGGAGTAGCAGGGCCAAAAGG + Intergenic
1120476423 14:84993996-84994018 ATTTGAGAATAAAGGTAAAATGG - Intergenic
1120845082 14:89118294-89118316 CTTTGAGAATCAGGGAAACAGGG - Intergenic
1120902352 14:89586832-89586854 CTTTTCCTATCAATGCAAAAAGG + Intronic
1120959380 14:90110580-90110602 CTTTGAGTAGCAAGGACATAAGG + Intronic
1121473096 14:94171964-94171986 CTTTGAAATTCAAAGCAAAATGG - Intronic
1122612945 14:102998542-102998564 CTTTGAGTCTCAGGACAAGAGGG + Intronic
1123962180 15:25415199-25415221 AGTTGAGGATAAAGGCAAAAGGG - Intronic
1124880274 15:33635798-33635820 CTTTGTGTTTGAAGGCAACAGGG + Exonic
1125065059 15:35472586-35472608 CAATGAGTATGAAGGCAAAAAGG + Intronic
1126096718 15:45095484-45095506 CTTTGAGGATGGAGGCAAAGGGG + Exonic
1126108494 15:45162308-45162330 CTTTGAGGATGGAGGCAAAAGGG - Exonic
1126734651 15:51718616-51718638 CTTAAAGGATCAAGGGAAAATGG + Intronic
1126836120 15:52667204-52667226 TTTTAAGTATTTAGGCAAAATGG - Intronic
1127802395 15:62488520-62488542 CTGTGAGAATCACTGCAAAATGG + Intronic
1132142577 15:99407685-99407707 CTTTGATTATCAAGAAAAATGGG - Intergenic
1137067439 16:35863173-35863195 CTTTGGGAAGCTAGGCAAAATGG + Intergenic
1138009719 16:53366725-53366747 ATTTGAGTTTAAAGTCAAAAGGG - Intergenic
1146891945 17:36511961-36511983 CATTGAGTACAAAGGCAAAGGGG - Intronic
1147347914 17:39815444-39815466 CTCTGAGTATCAAGGCTAGAGGG - Intronic
1149027032 17:52038819-52038841 TTTTGATGATTAAGGCAAAAAGG - Intronic
1149413490 17:56433662-56433684 CTTTGAGACTCAAGGGGAAAGGG + Intronic
1149484706 17:57033370-57033392 CTTCAAGTGTAAAGGCAAAAAGG + Intergenic
1149714080 17:58770299-58770321 CCTTGACTATCAAGGAAAAGAGG + Intronic
1150913882 17:69416313-69416335 CTTTGAGTATTAGGGGAGAATGG + Intronic
1151082341 17:71343329-71343351 GTTTGAGAATCAAGGGAAGAAGG + Intergenic
1152051623 17:77983384-77983406 TTCTGATTACCAAGGCAAAATGG + Intergenic
1153502958 18:5767630-5767652 CTTTGAGTGGCAAGGCCATAAGG - Intergenic
1154507450 18:15056599-15056621 CTTTGAAGATAAAGGCAAGAAGG + Intergenic
1158484574 18:57854327-57854349 CTGTGAGTTTGAAGGCTAAATGG - Intergenic
1158494838 18:57945614-57945636 CTTTGAGTTCCAAGACAAAGTGG + Intergenic
1158717735 18:59895546-59895568 CTTTGAGTAGCAAGGCCAGAGGG - Intergenic
1159249284 18:65852832-65852854 GTTTGAGAATTAAGGAAAAAAGG + Intronic
1163168359 19:15512966-15512988 CTTTGAGGACCCAGGAAAAATGG - Intronic
1166412804 19:42567791-42567813 CTTTGAGTAGCAAGGCTTGAGGG + Intergenic
1168583076 19:57571391-57571413 CCTTGAGCAGCAAGGCAAAGTGG + Intergenic
927340628 2:21979800-21979822 CTTTGACTACCCAGGCAAAGGGG - Intergenic
929656759 2:43740668-43740690 CTTTGAGTGTAACGTCAAAAAGG + Intronic
929716995 2:44322264-44322286 CATGTAGTTTCAAGGCAAAAGGG + Intronic
930882531 2:56288313-56288335 CTTTTAGCATCAAGATAAAAAGG + Intronic
932335053 2:70925971-70925993 CTCTGAGTATCCAGGGAAGAAGG - Intronic
933332355 2:80909938-80909960 CTTTGAATGTCAAGATAAAATGG - Intergenic
935859064 2:107308037-107308059 CTTTGAGGATCCAGAGAAAAGGG - Intergenic
935952103 2:108339356-108339378 TTATGAAAATCAAGGCAAAAAGG + Intergenic
936004252 2:108868286-108868308 CTTTCAGTAATAAGGAAAAAGGG - Intronic
937599781 2:123717373-123717395 CTTTTGGTAAGAAGGCAAAATGG - Intergenic
938179832 2:129170394-129170416 TTTTGAGTTTTGAGGCAAAATGG + Intergenic
940006370 2:149012535-149012557 CTTTCTGCATCAAGGCAAGAAGG + Intronic
941292285 2:163692085-163692107 CTTTCAGTAATAAAGCAAAATGG - Intronic
941362504 2:164569533-164569555 GTTGTAGTAACAAGGCAAAATGG + Intronic
941719078 2:168794327-168794349 ATTTGAGTAAGAAGACAAAAGGG + Intronic
944509943 2:200454622-200454644 CTTTTATTATCAAAGCAATAAGG - Intronic
945956395 2:216090208-216090230 CTCTGAGTTTGAAGGCAAAGGGG + Intronic
945981607 2:216316838-216316860 CTTTGAGAATCCTGGCATAAGGG + Intronic
1169834888 20:9867015-9867037 CTTTGATCTTCAAGTCAAAATGG + Intergenic
1171751907 20:29059828-29059850 TTTTCAGTATGAATGCAAAATGG + Intergenic
1176790627 21:13315168-13315190 CTTTGAAGATAAAGGCAAGAAGG - Intergenic
1178226983 21:30731022-30731044 TTTTGATTATATAGGCAAAAAGG - Intergenic
1182864588 22:33592451-33592473 CTTTGATTATCCTGGAAAAAAGG - Intronic
1183502119 22:38186863-38186885 CTTTCAATATCAGGGCAATAGGG + Intronic
1183769802 22:39914164-39914186 CTTTGTGTTCCATGGCAAAAGGG - Intronic
949159694 3:865865-865887 ATTTGAGTAGCAAGGAAAGATGG - Intergenic
951282957 3:20775335-20775357 ACCTGAGTATCATGGCAAAATGG - Intergenic
952672232 3:35983767-35983789 CTTTGAGAATCTAGGGAAGAAGG - Intergenic
955188932 3:56742071-56742093 CAGTGAGTATCATGGCACAAGGG - Intronic
955980101 3:64516220-64516242 TTTAGAGTATCTTGGCAAAATGG + Exonic
956271750 3:67455244-67455266 CTTTGTGGATTAAGGCAAAAAGG + Intronic
956283122 3:67579860-67579882 CATTGAGTTACAAGGTAAAATGG + Intronic
956651955 3:71512457-71512479 CTTTTGGTAACAAGGCAATAAGG - Intronic
957194931 3:77055504-77055526 GTTAGAAAATCAAGGCAAAAAGG - Intronic
957359772 3:79139777-79139799 CTTTGAATACCAGGGCAAAGTGG - Intronic
958738090 3:98033234-98033256 CTTTGAGTCACAAGCCAGAATGG - Intronic
958901645 3:99894072-99894094 CTTTGAGTATCATAGCAGAGAGG - Intronic
960568461 3:119161200-119161222 CTTTAAGAAACATGGCAAAACGG - Intronic
960951521 3:123001476-123001498 TATTGAGTATGAAGGGAAAAAGG - Intronic
962083867 3:132170046-132170068 CTTTGAGTAGCAAGGACATAGGG + Intronic
963251385 3:143106453-143106475 CATTGAGTGGCAAGACAAAATGG - Intergenic
963267686 3:143255223-143255245 TTTTGAGAATGAAGCCAAAATGG + Intergenic
964199895 3:154107415-154107437 CCTTGAGTATCTAGGAAAATAGG - Intergenic
965036435 3:163444916-163444938 CTTTGTGTTTCAAGGGAAACAGG - Intergenic
965396921 3:168171241-168171263 GTTTGAGTATTAAGGTAATATGG + Intergenic
969139592 4:5056860-5056882 ATTGGAGTATCAACGGAAAAAGG + Intronic
972391478 4:38617725-38617747 TATTGAGTAGCAATGCAAAATGG + Intergenic
973936618 4:55853204-55853226 CTTTGAGTATCAAGGTCATGAGG + Intergenic
975132303 4:70841793-70841815 CCTGGAGTATCAAAGAAAAAGGG + Intergenic
975491901 4:74998482-74998504 CTTTAAGTAACAAGGGAAACTGG - Intronic
976420314 4:84835089-84835111 CATTGAATATTAAGGCCAAAAGG - Intronic
977727408 4:100312238-100312260 CTTTGACTACCAAAACAAAATGG - Intergenic
978181498 4:105802377-105802399 CTTTAAGTATTAAGGCATGAAGG - Intronic
979544545 4:121925017-121925039 CATTAAGTATGAAGTCAAAAAGG - Exonic
979782699 4:124673748-124673770 CTTTAAGTATGTAGACAAAATGG + Intronic
979857941 4:125657823-125657845 ATTTGACTATCCATGCAAAATGG - Intergenic
980122737 4:128744447-128744469 CTTTGTGCATCAAAGTAAAAAGG - Intergenic
980341794 4:131559643-131559665 CTTTGAGAATAAAGGCAATATGG - Intergenic
980831736 4:138137557-138137579 CTTCGAGAAACAAGGTAAAAAGG + Intergenic
981641493 4:146948726-146948748 TTTAGAATATAAAGGCAAAAAGG - Intergenic
981770282 4:148300569-148300591 AAATGAGTAGCAAGGCAAAATGG - Intronic
981772898 4:148330651-148330673 CTTTGAATATAAAGTCAAATGGG - Intronic
983579194 4:169290847-169290869 CTTTGAGTTTCAAGGAACAGGGG - Intergenic
984160151 4:176242503-176242525 TTTTGAATATTAAGACAAAATGG - Intronic
984613018 4:181862560-181862582 CTATGAGAAGCAAGACAAAAAGG + Intergenic
984687064 4:182680987-182681009 CTGTTAGTTTCAAGGCATAAAGG - Intronic
984865386 4:184276176-184276198 CTGTGAGTGTCAAGACTAAAGGG + Intergenic
984876044 4:184368577-184368599 CTCTCAGTATCAGGGCAAGAAGG - Intergenic
986509614 5:8490412-8490434 CTTGGAGGTTAAAGGCAAAATGG + Intergenic
988282579 5:29169172-29169194 TTTTGAATATCAAAGAAAAATGG - Intergenic
991679817 5:69127680-69127702 CTCTGAGTAGGAAGGCAAATGGG - Intronic
992566682 5:78002697-78002719 CTTTGGTTAGCAAAGCAAAAAGG + Exonic
993035647 5:82754304-82754326 GTTAGATTATCAAGGAAAAAAGG - Intergenic
993816956 5:92560288-92560310 CTTTGAGTATATAGACAAGACGG + Intergenic
993890829 5:93469815-93469837 CTGTTAATATCAATGCAAAAGGG + Intergenic
995857066 5:116604683-116604705 ATTTTAGTATCTAGGAAAAAAGG - Intergenic
997809990 5:136957643-136957665 CTATGAGTAGCAAGGCAAGAGGG + Intergenic
999944837 5:156583653-156583675 AATGGAGTATGAAGGCAAAATGG + Intronic
1005842805 6:29755267-29755289 CTTTGAGTATAAATGGAACAGGG - Intergenic
1007323866 6:41045691-41045713 CTCAGAGTGTCAAGGCTAAACGG - Intronic
1008429145 6:51394342-51394364 CCTTGAGAATCCAGGCAAATGGG + Intergenic
1008599003 6:53070912-53070934 CTTTGAGTAGCAAGGCTGTAGGG - Exonic
1009423063 6:63484992-63485014 CTTTAAGTAACAAGACAAAGTGG - Intergenic
1011433426 6:87312673-87312695 CTGGGTGAATCAAGGCAAAAGGG - Intronic
1012091963 6:94909608-94909630 ATTTAAGTTTCATGGCAAAAGGG - Intergenic
1012743587 6:103054062-103054084 CCTTGAGTATCAAGGGGTAATGG - Intergenic
1014057887 6:117037612-117037634 CTTTGTGTATCCACTCAAAAGGG - Intergenic
1014601919 6:123423873-123423895 CTTTAAGTAAAAAGGAAAAAAGG - Intronic
1015177702 6:130328899-130328921 TTATGAGTATAAAGGAAAAATGG + Intronic
1015503789 6:133960675-133960697 CTTTGGGTATAGAGGAAAAATGG + Intronic
1015948743 6:138530023-138530045 AATTGATTATTAAGGCAAAATGG - Intronic
1016188791 6:141234137-141234159 CTTATAATATTAAGGCAAAATGG - Intergenic
1017527359 6:155253310-155253332 TTTAGGGTATCAAGGCAGAAAGG - Intronic
1018397612 6:163390871-163390893 CTTTGATTTTCATGACAAAATGG + Intergenic
1018916071 6:168133150-168133172 CTGTCCGTATCAAGGCAGAAAGG - Intergenic
1020645923 7:10814163-10814185 CTTTGAAAATTAAAGCAAAAAGG - Intergenic
1021889561 7:25173946-25173968 CTGTGAGTATTAAGGCTAAGGGG - Intronic
1022379905 7:29850344-29850366 TTTGGAGTATGAAGGAAAAACGG + Intronic
1024111196 7:46147852-46147874 CTTTGGGTATATACGCAAAATGG + Intergenic
1024172603 7:46805548-46805570 CATTGCCTATCAAGGAAAAATGG + Intergenic
1026859730 7:73778009-73778031 CTTGGAGTCTCCAGGCATAATGG + Intergenic
1029294757 7:99531238-99531260 CTGTGAGTTTCAAGGCAAGCTGG + Exonic
1030315834 7:108113505-108113527 TTTTGAAAATTAAGGCAAAATGG + Intronic
1036624848 8:10461413-10461435 CTTTGAACATCCAGGCTAAAAGG + Intergenic
1038668617 8:29563248-29563270 GTTTGAGACTCAAGGGAAAAAGG + Intergenic
1038929852 8:32181240-32181262 ATTTGAGTTTCAAAGCACAAAGG - Intronic
1041605080 8:59772553-59772575 CATTGAGTGGCAAGACAAAATGG + Intergenic
1041769004 8:61452962-61452984 TTTTTAGTAACAAGGAAAAAAGG - Intronic
1044520235 8:93190615-93190637 CTATTATTATCAAGGCAGAAGGG - Intergenic
1045131524 8:99159586-99159608 CCATGAACATCAAGGCAAAAAGG + Intronic
1045367777 8:101492998-101493020 CTTTTACTATCAAGGCCCAAAGG - Intronic
1045829985 8:106447290-106447312 CTTTTAATATAAAGGGAAAATGG + Intronic
1046677638 8:117128772-117128794 CCTTTAGTATGAAGGAAAAAGGG + Intronic
1047566220 8:126046969-126046991 CCCTGAGTATGAAGGAAAAAGGG + Intergenic
1048398805 8:134043352-134043374 CCTTGAGTTTCAAGGCAATCTGG - Intergenic
1048898543 8:139016367-139016389 GTTTGAGTCTCAAGGCAAGTGGG + Intergenic
1049448710 8:142646249-142646271 CTTGGAGGTTCAAGGCAAGATGG - Intergenic
1050163329 9:2740228-2740250 CTTAGAGTTTAAAGGCAAGATGG + Intronic
1050282176 9:4061935-4061957 CTTTAAGTCACATGGCAAAAGGG + Intronic
1050601387 9:7255613-7255635 CTTTCAGTACAAAGTCAAAAAGG + Intergenic
1051031214 9:12681691-12681713 GATTGAGTATAAAGGGAAAATGG - Intergenic
1052086402 9:24271645-24271667 CTTTGATTATCAAGTCAAGATGG - Intergenic
1052230658 9:26147298-26147320 GTTTGAGTTTCAATGTAAAATGG - Intergenic
1052475843 9:28957959-28957981 CTTTGAGTTTCAATATAAAATGG - Intergenic
1056720359 9:89065901-89065923 CTTTGAGCAGCAAGGAGAAAAGG + Intronic
1056941873 9:90962855-90962877 CTTTGAGTAAGAGGGCAAGATGG - Intergenic
1059508282 9:114819815-114819837 TTTTGAAGACCAAGGCAAAATGG + Intergenic
1186522177 X:10215363-10215385 GTTTGAGTGTCAAGCTAAAATGG - Intronic
1187041695 X:15603182-15603204 CTTTGAGAAGCAAGGGAAAAGGG + Intergenic
1187204620 X:17170281-17170303 CTTTGGCTATGAAAGCAAAAAGG + Intergenic
1187336105 X:18383317-18383339 CTTGGACTATCAAGGCGTAAAGG + Intergenic
1187798042 X:23025988-23026010 CTTTTAGTGTCAAGGAAGAAGGG - Intergenic
1192202208 X:69073562-69073584 CTGTGAGGATCAAGGCCACATGG - Intergenic
1192268728 X:69558337-69558359 CTTTGGGTCTGAAGGCAAGATGG + Intergenic
1195753911 X:108182173-108182195 CTCTGAGCCTCATGGCAAAATGG + Intronic
1196800492 X:119538814-119538836 CTTTGAGTATAAAGTCGATACGG + Exonic
1197158523 X:123297062-123297084 CTTTAAGTAGCAAGGCTATAGGG - Intronic