ID: 1084643019

View in Genome Browser
Species Human (GRCh38)
Location 11:70437165-70437187
Sequence CTCTCACGTTAGGCTCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084643019_1084643024 3 Left 1084643019 11:70437165-70437187 CCCACAGGAGCCTAACGTGAGAG No data
Right 1084643024 11:70437191-70437213 CCCCGCCCTCCTGCCACAACCGG No data
1084643019_1084643032 14 Left 1084643019 11:70437165-70437187 CCCACAGGAGCCTAACGTGAGAG No data
Right 1084643032 11:70437202-70437224 TGCCACAACCGGGCTGCTGTGGG No data
1084643019_1084643036 29 Left 1084643019 11:70437165-70437187 CCCACAGGAGCCTAACGTGAGAG No data
Right 1084643036 11:70437217-70437239 GCTGTGGGTTCTGCATCACAGGG No data
1084643019_1084643035 28 Left 1084643019 11:70437165-70437187 CCCACAGGAGCCTAACGTGAGAG No data
Right 1084643035 11:70437216-70437238 TGCTGTGGGTTCTGCATCACAGG No data
1084643019_1084643026 4 Left 1084643019 11:70437165-70437187 CCCACAGGAGCCTAACGTGAGAG No data
Right 1084643026 11:70437192-70437214 CCCGCCCTCCTGCCACAACCGGG No data
1084643019_1084643031 13 Left 1084643019 11:70437165-70437187 CCCACAGGAGCCTAACGTGAGAG No data
Right 1084643031 11:70437201-70437223 CTGCCACAACCGGGCTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084643019 Original CRISPR CTCTCACGTTAGGCTCCTGT GGG (reversed) Intergenic
No off target data available for this crispr