ID: 1084643950

View in Genome Browser
Species Human (GRCh38)
Location 11:70443460-70443482
Sequence CTGGAGCTGGACGGCGGCGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084643943_1084643950 9 Left 1084643943 11:70443428-70443450 CCTCGCGAACTCTAGCGGAAGCT No data
Right 1084643950 11:70443460-70443482 CTGGAGCTGGACGGCGGCGACGG No data
1084643942_1084643950 10 Left 1084643942 11:70443427-70443449 CCCTCGCGAACTCTAGCGGAAGC No data
Right 1084643950 11:70443460-70443482 CTGGAGCTGGACGGCGGCGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084643950 Original CRISPR CTGGAGCTGGACGGCGGCGA CGG Intergenic
No off target data available for this crispr