ID: 1084645605

View in Genome Browser
Species Human (GRCh38)
Location 11:70455703-70455725
Sequence GCCCTCAAAACCACCTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084645605_1084645607 -8 Left 1084645605 11:70455703-70455725 CCTCCAAAGGTGGTTTTGAGGGC No data
Right 1084645607 11:70455718-70455740 TTGAGGGCTTCAGTATTTAAAGG 0: 43
1: 107
2: 144
3: 196
4: 294
1084645605_1084645615 19 Left 1084645605 11:70455703-70455725 CCTCCAAAGGTGGTTTTGAGGGC No data
Right 1084645615 11:70455745-70455767 AGCAGGCAGGAGGGGAAGGAAGG No data
1084645605_1084645609 2 Left 1084645605 11:70455703-70455725 CCTCCAAAGGTGGTTTTGAGGGC No data
Right 1084645609 11:70455728-70455750 CAGTATTTAAAGGGAAAAGCAGG No data
1084645605_1084645608 -7 Left 1084645605 11:70455703-70455725 CCTCCAAAGGTGGTTTTGAGGGC No data
Right 1084645608 11:70455719-70455741 TGAGGGCTTCAGTATTTAAAGGG 0: 46
1: 110
2: 152
3: 191
4: 308
1084645605_1084645614 15 Left 1084645605 11:70455703-70455725 CCTCCAAAGGTGGTTTTGAGGGC No data
Right 1084645614 11:70455741-70455763 GAAAAGCAGGCAGGAGGGGAAGG No data
1084645605_1084645612 10 Left 1084645605 11:70455703-70455725 CCTCCAAAGGTGGTTTTGAGGGC No data
Right 1084645612 11:70455736-70455758 AAAGGGAAAAGCAGGCAGGAGGG No data
1084645605_1084645618 24 Left 1084645605 11:70455703-70455725 CCTCCAAAGGTGGTTTTGAGGGC No data
Right 1084645618 11:70455750-70455772 GCAGGAGGGGAAGGAAGGGAGGG No data
1084645605_1084645610 6 Left 1084645605 11:70455703-70455725 CCTCCAAAGGTGGTTTTGAGGGC No data
Right 1084645610 11:70455732-70455754 ATTTAAAGGGAAAAGCAGGCAGG No data
1084645605_1084645613 11 Left 1084645605 11:70455703-70455725 CCTCCAAAGGTGGTTTTGAGGGC No data
Right 1084645613 11:70455737-70455759 AAGGGAAAAGCAGGCAGGAGGGG No data
1084645605_1084645619 29 Left 1084645605 11:70455703-70455725 CCTCCAAAGGTGGTTTTGAGGGC No data
Right 1084645619 11:70455755-70455777 AGGGGAAGGAAGGGAGGGCGTGG No data
1084645605_1084645617 23 Left 1084645605 11:70455703-70455725 CCTCCAAAGGTGGTTTTGAGGGC No data
Right 1084645617 11:70455749-70455771 GGCAGGAGGGGAAGGAAGGGAGG No data
1084645605_1084645616 20 Left 1084645605 11:70455703-70455725 CCTCCAAAGGTGGTTTTGAGGGC No data
Right 1084645616 11:70455746-70455768 GCAGGCAGGAGGGGAAGGAAGGG No data
1084645605_1084645611 9 Left 1084645605 11:70455703-70455725 CCTCCAAAGGTGGTTTTGAGGGC No data
Right 1084645611 11:70455735-70455757 TAAAGGGAAAAGCAGGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084645605 Original CRISPR GCCCTCAAAACCACCTTTGG AGG (reversed) Intergenic
No off target data available for this crispr