ID: 1084647367

View in Genome Browser
Species Human (GRCh38)
Location 11:70466269-70466291
Sequence AGGGCTAAGAATTCAGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084647367_1084647375 3 Left 1084647367 11:70466269-70466291 CCGCCTCCTGAATTCTTAGCCCT No data
Right 1084647375 11:70466295-70466317 CATATGACGTCAGATGGGGCAGG No data
1084647367_1084647377 9 Left 1084647367 11:70466269-70466291 CCGCCTCCTGAATTCTTAGCCCT No data
Right 1084647377 11:70466301-70466323 ACGTCAGATGGGGCAGGGAGAGG No data
1084647367_1084647373 -2 Left 1084647367 11:70466269-70466291 CCGCCTCCTGAATTCTTAGCCCT No data
Right 1084647373 11:70466290-70466312 CTGCACATATGACGTCAGATGGG No data
1084647367_1084647376 4 Left 1084647367 11:70466269-70466291 CCGCCTCCTGAATTCTTAGCCCT No data
Right 1084647376 11:70466296-70466318 ATATGACGTCAGATGGGGCAGGG No data
1084647367_1084647379 23 Left 1084647367 11:70466269-70466291 CCGCCTCCTGAATTCTTAGCCCT No data
Right 1084647379 11:70466315-70466337 AGGGAGAGGAAGCACCCTGTGGG No data
1084647367_1084647372 -3 Left 1084647367 11:70466269-70466291 CCGCCTCCTGAATTCTTAGCCCT No data
Right 1084647372 11:70466289-70466311 CCTGCACATATGACGTCAGATGG No data
1084647367_1084647374 -1 Left 1084647367 11:70466269-70466291 CCGCCTCCTGAATTCTTAGCCCT No data
Right 1084647374 11:70466291-70466313 TGCACATATGACGTCAGATGGGG No data
1084647367_1084647378 22 Left 1084647367 11:70466269-70466291 CCGCCTCCTGAATTCTTAGCCCT No data
Right 1084647378 11:70466314-70466336 CAGGGAGAGGAAGCACCCTGTGG No data
1084647367_1084647380 26 Left 1084647367 11:70466269-70466291 CCGCCTCCTGAATTCTTAGCCCT No data
Right 1084647380 11:70466318-70466340 GAGAGGAAGCACCCTGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084647367 Original CRISPR AGGGCTAAGAATTCAGGAGG CGG (reversed) Intergenic
No off target data available for this crispr