ID: 1084647644

View in Genome Browser
Species Human (GRCh38)
Location 11:70468409-70468431
Sequence CAGGACTGCCCGTGCTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084647644_1084647647 -3 Left 1084647644 11:70468409-70468431 CCCACAAAGCACGGGCAGTCCTG 0: 1
1: 0
2: 1
3: 7
4: 99
Right 1084647647 11:70468429-70468451 CTGTCTGCATGCAGCTGCTGTGG 0: 1
1: 0
2: 5
3: 44
4: 305
1084647644_1084647648 14 Left 1084647644 11:70468409-70468431 CCCACAAAGCACGGGCAGTCCTG 0: 1
1: 0
2: 1
3: 7
4: 99
Right 1084647648 11:70468446-70468468 CTGTGGTCACCCAGCCACTGTGG 0: 1
1: 2
2: 2
3: 38
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084647644 Original CRISPR CAGGACTGCCCGTGCTTTGT GGG (reversed) Intronic
901154595 1:7127069-7127091 CAGGACTGCCACTTCTTTGTAGG + Intronic
901680827 1:10911797-10911819 CAGCACTGCCAGTGATTTGATGG - Intergenic
901776699 1:11565186-11565208 CAGGCCTGCCCTTGCCCTGTGGG - Intergenic
902623727 1:17664913-17664935 CAGCATTGCCCGGGCTCTGTGGG - Intronic
919594065 1:199539553-199539575 CAGGAATGCCAGTTATTTGTGGG - Intergenic
922207628 1:223462103-223462125 CATGTCTGCCCCTCCTTTGTGGG + Intergenic
1075723718 10:124601285-124601307 CAGTGCTGCCCATGGTTTGTCGG + Intronic
1075819395 10:125293068-125293090 CAGCACTCCCCGTGATTTGAAGG + Intergenic
1078546658 11:12252105-12252127 AAGGACTTCCTGGGCTTTGTGGG - Intronic
1081607848 11:44538369-44538391 CAGGATTGCCCCCGCTTTGGAGG + Intergenic
1084647644 11:70468409-70468431 CAGGACTGCCCGTGCTTTGTGGG - Intronic
1085987513 11:81805013-81805035 CATGCCTGCCTGTGCTCTGTGGG + Intergenic
1089900128 11:121973330-121973352 CAGGACTGCACGTGCTCTAGAGG - Intergenic
1090136701 11:124206866-124206888 AAGGACTTCCCATGCCTTGTTGG - Intergenic
1092801473 12:12172408-12172430 CAGGACTGCCCATGCAATCTTGG + Intronic
1094717559 12:33028261-33028283 CAGGGCTGCCCGGGCTTTGCTGG + Intergenic
1095525808 12:43123692-43123714 CAGCACCCCCTGTGCTTTGTGGG - Intergenic
1096996386 12:55840800-55840822 CAGGGCTGCCCGGGCTGTGTGGG + Exonic
1097964874 12:65568158-65568180 CAGGACTGCCACAGCTTTGCTGG - Intergenic
1104255201 12:127130122-127130144 CAGGACTGGCCATCCTTGGTTGG - Intergenic
1105493914 13:20913527-20913549 TAGGACTTCCGGTACTTTGTTGG - Intergenic
1119785433 14:77310052-77310074 GGGGACTGCCCGTTCTTTTTTGG - Intronic
1122695031 14:103548302-103548324 CAGGACTGCCAGGGCTTCCTGGG - Intergenic
1127130443 15:55856626-55856648 CAGGACTGGCTGTGCATTGCAGG - Intronic
1129908302 15:79205343-79205365 CAGGACTGCACCAGCTTTGGGGG + Intergenic
1139054015 16:63158937-63158959 CAGGACTGGCCATACTATGTAGG + Intergenic
1141944129 16:87298016-87298038 CAGGTCAGCCCATGGTTTGTGGG - Intronic
1142872272 17:2828625-2828647 CAGGACTGCCCGGGCATGGCTGG + Intronic
1145252466 17:21304139-21304161 CAGGACTCCAGGTGCTTTGCTGG - Intronic
1150005830 17:61468429-61468451 CGAGACTGCCCGTGGTTTCTGGG + Intronic
1152993321 18:383079-383101 CAGGACTGCCTGTACTGTGTGGG + Intronic
1154356066 18:13624079-13624101 CGGGACTGCCTGTGCACTGTAGG - Intronic
1159905699 18:74089448-74089470 CAGGACTTCCAGTACTATGTTGG + Intronic
1160988410 19:1850818-1850840 CAGGACTGCGCCTGGTGTGTTGG + Intergenic
1160991294 19:1861383-1861405 CAGGAGTGCCCTGGCTTTTTGGG - Intronic
1161062278 19:2221292-2221314 CAGAACTGCCCGGGCTTCGGTGG - Intronic
1165115285 19:33524669-33524691 CAGGACTGGCCATGCTGTGAGGG + Intergenic
1166224666 19:41387586-41387608 CAGGACTGCCCGGGCCTCCTAGG + Exonic
1166689519 19:44814154-44814176 CAGAACTGCACGTGCTCCGTGGG - Exonic
1167448745 19:49555030-49555052 CAGAACTGCACTTCCTTTGTGGG + Intergenic
927949635 2:27158928-27158950 CAGGACTGCACTGGCTTGGTGGG - Intergenic
927954786 2:27200814-27200836 CAGGACTGCACTGGCTTGGTGGG - Intronic
928283172 2:29966405-29966427 CAGGGCTGCTAGTGCTGTGTAGG - Intergenic
930987163 2:57604169-57604191 CAGGATTGCCCTTGTTCTGTTGG + Intergenic
935091297 2:99897468-99897490 CAGGTCTGCCCATCCTTTGGTGG + Intronic
938310649 2:130286366-130286388 CAGGCCTGCCCCTCCTGTGTAGG + Intergenic
943453444 2:188074006-188074028 CAGGAATGCCAGTGAGTTGTAGG + Intergenic
944337467 2:198553397-198553419 CAGGACTTCTCATACTTTGTAGG + Intronic
945577834 2:211554466-211554488 CAGCACTGCGTGTGCTGTGTGGG - Intronic
946025670 2:216670466-216670488 CTGTACTGCCCGTGCTCAGTGGG - Intergenic
949026477 2:241768641-241768663 CAGCACCGCACGTTCTTTGTAGG - Exonic
1170259665 20:14389875-14389897 CAGGACTTCCAGTACTATGTTGG - Intronic
1171095758 20:22331174-22331196 CCTGACTGCCTGTGCTTTGCTGG - Intergenic
1172975394 20:38902471-38902493 CAGGAATGCCCTTGCTCTGTGGG + Intronic
1173088967 20:39952093-39952115 CTGGACGCCCCTTGCTTTGTAGG - Intergenic
1175022641 20:55866885-55866907 CAGGAGTGCCAGTAATTTGTAGG - Intergenic
1177385517 21:20405044-20405066 CAGGGCCGCCCGTGCACTGTGGG + Intergenic
1178737873 21:35168923-35168945 CTGGAGTGCCCATGCCTTGTAGG - Intronic
1178759067 21:35383194-35383216 CAGGACTGCCCGTGGTAATTTGG - Intronic
1178927501 21:36787922-36787944 CAGGGCTGCCAGGGCTTTCTGGG + Intronic
1180072625 21:45443925-45443947 CAGGACTGCCTGTCCTCTTTTGG + Intronic
1180987069 22:19911352-19911374 AAGGCCTGCGCGTGCTTGGTGGG - Intronic
1181467874 22:23119972-23119994 CAGGACTCCCCTTGCTTTGCAGG - Intronic
1183253439 22:36745801-36745823 CAAGGCTGCCCATGCTGTGTGGG + Intergenic
1183621277 22:38974294-38974316 CCGGCCTGCCCTTGCTTTTTGGG + Intronic
1184404342 22:44291709-44291731 AAGGAATGCCCATGCATTGTGGG + Intronic
1184622497 22:45692296-45692318 CAGCACAGCCCTTGCTTTGCTGG - Intronic
1184813874 22:46855701-46855723 CAGGCCTGACCGTGCCGTGTGGG + Intronic
951341744 3:21497022-21497044 CAGGATTTCCAGTGCTGTGTTGG - Intronic
952480846 3:33760266-33760288 CAGGGCTGCCAGAGCTGTGTGGG + Intergenic
954635756 3:52069948-52069970 CAGGACTGCCTCTGCTTCTTGGG - Intergenic
961770440 3:129245780-129245802 CAGGACTACCCTTGCTTTAGAGG - Intergenic
962078968 3:132116855-132116877 CAGGAATGCCAGTGAGTTGTAGG + Intronic
963773484 3:149414697-149414719 CAGGTCTGCCCTTCCTGTGTGGG + Intergenic
968574393 4:1358240-1358262 CAGGACTGACAGTGCTTGGAGGG + Intronic
969567273 4:7985920-7985942 CAGGACTGCCCGACCCCTGTGGG - Intronic
975501961 4:75096465-75096487 CAGGACTGTCTTTGCTATGTGGG + Intergenic
975900010 4:79140497-79140519 CAGGAATGCCCATGAGTTGTAGG + Intergenic
976671015 4:87653968-87653990 CATGGCTGCCCATGTTTTGTTGG - Intronic
980010295 4:127587841-127587863 CAGGAATGCCAATACTTTGTAGG - Intergenic
985495348 5:201140-201162 GAGGACAGCCCGTGCGATGTTGG - Exonic
994087113 5:95771434-95771456 CAGGGCTGGCCGTGGCTTGTCGG - Intronic
1003333439 6:5148411-5148433 CAGGACTTCCCGTGCTGTGTGGG + Intronic
1005395542 6:25378351-25378373 CAGGGGTGCCCCTGCTGTGTAGG - Intronic
1006115952 6:31776350-31776372 CGGGACTGTCCCTCCTTTGTGGG - Intronic
1007255493 6:40525262-40525284 CAGGGCCGCCCTTGCTTTCTGGG - Intronic
1008139523 6:47816046-47816068 CAGGTATACACGTGCTTTGTTGG + Intronic
1012414538 6:98998845-98998867 CAGAATTCCCTGTGCTTTGTGGG - Intergenic
1019443013 7:1056840-1056862 GAGGAATGCCTGTGCTTTGGCGG + Intronic
1019473857 7:1234935-1234957 CAGGACTGCCCGAGCTTCCGCGG + Intronic
1023457861 7:40361248-40361270 CTGAGCTGCCTGTGCTTTGTTGG - Intronic
1024929242 7:54652623-54652645 CAGGACTGGCTTTCCTTTGTTGG - Intergenic
1030825521 7:114152698-114152720 GAAGACTGCCCGTGATTTGGAGG + Intronic
1031987503 7:128172575-128172597 CAAGACAGCCCTTGCATTGTGGG + Intergenic
1035949152 8:3999873-3999895 AAGGGCTGCCCATGTTTTGTAGG + Intronic
1046355073 8:113072311-113072333 AAGGACTTCCAGTACTTTGTGGG + Intronic
1049093813 8:140536026-140536048 CAGGAGTGCCTGTGCTTTGCCGG + Intronic
1049216624 8:141411303-141411325 TAGCACTGCACGTGCTTTTTGGG + Intronic
1049783559 8:144439881-144439903 CAGGACGGCCAGTGCTTTCCCGG - Intronic
1051123438 9:13777129-13777151 CAGGAGTCCCCATGCTGTGTGGG + Intergenic
1060522498 9:124301580-124301602 CAGCACTGCCCCTGCTTCTTGGG - Intronic
1185514581 X:689667-689689 CAGGAGTTCACGTGCTTAGTAGG + Intergenic
1191152844 X:57239663-57239685 CAGGAATGCCAATTCTTTGTAGG + Intergenic
1194245583 X:91507882-91507904 CAGGACTTTCCCTGGTTTGTAGG - Intergenic
1195698596 X:107685035-107685057 CAGGACTCCCAGTGCTCTCTTGG + Intergenic
1198520361 X:137446249-137446271 CTGGCCTGACCCTGCTTTGTGGG + Intergenic
1200564551 Y:4749132-4749154 CAGGACTTTCCCTGGTTTGTAGG - Intergenic
1201563744 Y:15345122-15345144 CATGAGGGCCCTTGCTTTGTGGG + Intergenic