ID: 1084652980

View in Genome Browser
Species Human (GRCh38)
Location 11:70499892-70499914
Sequence TTTAATTAATCCCTTGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 202}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084652980_1084652985 6 Left 1084652980 11:70499892-70499914 CCAACTCCAAGGGATTAATTAAA 0: 1
1: 0
2: 2
3: 17
4: 202
Right 1084652985 11:70499921-70499943 GAGTGCTGCTTTTAATTGTTGGG 0: 1
1: 0
2: 1
3: 14
4: 171
1084652980_1084652984 5 Left 1084652980 11:70499892-70499914 CCAACTCCAAGGGATTAATTAAA 0: 1
1: 0
2: 2
3: 17
4: 202
Right 1084652984 11:70499920-70499942 GGAGTGCTGCTTTTAATTGTTGG 0: 1
1: 0
2: 1
3: 12
4: 123
1084652980_1084652986 7 Left 1084652980 11:70499892-70499914 CCAACTCCAAGGGATTAATTAAA 0: 1
1: 0
2: 2
3: 17
4: 202
Right 1084652986 11:70499922-70499944 AGTGCTGCTTTTAATTGTTGGGG 0: 1
1: 1
2: 2
3: 26
4: 356
1084652980_1084652988 27 Left 1084652980 11:70499892-70499914 CCAACTCCAAGGGATTAATTAAA 0: 1
1: 0
2: 2
3: 17
4: 202
Right 1084652988 11:70499942-70499964 GGGGAGCTGTGTCCAGCAGCAGG 0: 1
1: 0
2: 3
3: 31
4: 284
1084652980_1084652987 8 Left 1084652980 11:70499892-70499914 CCAACTCCAAGGGATTAATTAAA 0: 1
1: 0
2: 2
3: 17
4: 202
Right 1084652987 11:70499923-70499945 GTGCTGCTTTTAATTGTTGGGGG 0: 1
1: 0
2: 2
3: 26
4: 426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084652980 Original CRISPR TTTAATTAATCCCTTGGAGT TGG (reversed) Intronic
905805366 1:40873159-40873181 TTTAATTAAACCATTTTAGTTGG + Intergenic
906215917 1:44038862-44038884 TTGAATTAATACTTTGGAGTGGG + Intergenic
909695486 1:78464300-78464322 TTTACTGAATTCCTTGGAATGGG + Intronic
910161681 1:84278770-84278792 TTTTATTAATTCCTGGAAGTTGG - Intergenic
910323514 1:85976770-85976792 TTTGAGTACTTCCTTGGAGTAGG - Intronic
912781368 1:112551699-112551721 TTTAATAAATCCACAGGAGTTGG - Intronic
914046034 1:144093126-144093148 TTTTAGTAATTCCTTGGGGTGGG - Intergenic
914132076 1:144867561-144867583 TTTTAGTAATTCCTTGGGGTGGG + Intergenic
915048429 1:153040456-153040478 TTTAAATAATTTCTTGGAGATGG - Intronic
915596739 1:156900561-156900583 TTACATTAACCCCTTGTAGTAGG - Intronic
916305232 1:163322593-163322615 TTTACTTAATTCATTGAAGTTGG + Intronic
917685764 1:177414259-177414281 TTTAATTCATTCCCTGCAGTTGG + Intergenic
917766967 1:178230849-178230871 TTTGATTCTTCCCTTGGGGTAGG + Intronic
918108945 1:181438916-181438938 TTTATCTATTCCCTTGGAATGGG - Intronic
918946613 1:191074612-191074634 TTTACTTAATCCATAGAAGTGGG - Intergenic
919395236 1:197037908-197037930 TTTAATTAATCTCCTGTAGTAGG - Intergenic
1063523553 10:6762224-6762246 TTTAATCAATTCCTTTCAGTGGG - Intergenic
1064068462 10:12204145-12204167 TTTAATTAATCACTGTGAGCTGG + Intronic
1064152541 10:12876817-12876839 TTTCACTACTCCCTTAGAGTCGG + Intergenic
1065209687 10:23390670-23390692 CTTGATTCTTCCCTTGGAGTGGG + Intergenic
1065260234 10:23916137-23916159 TTTAATTTTTTCCTTGGAATAGG - Intronic
1069024665 10:63525933-63525955 TGTATTTAATCCCATGGGGTAGG - Intronic
1069278561 10:66624615-66624637 TTTAATGAATGCCTTTCAGTAGG - Intronic
1071215531 10:83396289-83396311 TTAAAATAATGCCTTGGGGTAGG + Intergenic
1072951486 10:99850385-99850407 TTTAATTAAGTACTTGGGGTGGG + Intronic
1073244127 10:102077513-102077535 TATAATCAGTCCCATGGAGTTGG - Intergenic
1074406774 10:113186654-113186676 TTAGATGAATACCTTGGAGTGGG + Intergenic
1078849918 11:15154431-15154453 TTTAAATACGCCCTTTGAGTGGG + Intronic
1079525820 11:21386296-21386318 TATAATTAACACCTTGGAATGGG - Intronic
1081045389 11:38267944-38267966 TTTAATTTATCTCTTTGAGATGG + Intergenic
1082861858 11:57864340-57864362 TTTGATTCTTCCCTTGGGGTGGG - Intergenic
1084652980 11:70499892-70499914 TTTAATTAATCCCTTGGAGTTGG - Intronic
1085378988 11:76095569-76095591 ATTTTTTAATCCCTTGGAGCTGG + Intronic
1085683041 11:78595985-78596007 CTTAATTTTTCCCTTGGGGTGGG - Intergenic
1085970011 11:81577383-81577405 TTTTATTAATACTTTGGAGAAGG - Intergenic
1086460174 11:86998200-86998222 TTTAGTTAATCTCTAGGATTGGG + Intergenic
1087263063 11:96032262-96032284 TTAAATAAATACCTAGGAGTGGG - Intronic
1089340512 11:117754282-117754304 TTGAATTAATTCCCTGGTGTCGG - Intronic
1091713151 12:2756517-2756539 TTTATTTAATGCATTTGAGTGGG + Intergenic
1094184640 12:27627902-27627924 TTTTATTAAGCCATTGGAATAGG + Intronic
1096187689 12:49593056-49593078 TTTAATTGATACCTTATAGTTGG - Intronic
1097249971 12:57627174-57627196 TTTATTTAACCTCTGGGAGTAGG - Intronic
1097817695 12:64093147-64093169 TCAAACTAATCCCTTGGTGTCGG - Intronic
1098743399 12:74203730-74203752 TTTTATTAATTCCTTAGAGATGG + Intergenic
1099558035 12:84135181-84135203 TTTAATTAACCCTTTGGAATTGG + Intergenic
1100513408 12:95300467-95300489 TGTAATGAGTCCCTGGGAGTTGG - Exonic
1104263825 12:127212032-127212054 CTTAATTACCCCCTTGGAGTGGG + Intergenic
1105343218 13:19547416-19547438 TTTACATAATCGGTTGGAGTGGG + Intergenic
1105829789 13:24153832-24153854 TGGAATTCATCCCTTGGGGTTGG + Intronic
1107356809 13:39576046-39576068 TTTAAGAAATCCCCTGGGGTAGG - Intronic
1109450765 13:62511891-62511913 TTTATTGAATTCCTTGGATTGGG + Intergenic
1110242098 13:73280531-73280553 TTTAATTAATCCCATAGTTTTGG - Intergenic
1110386175 13:74913361-74913383 TTTAATTCCTCTCTTGAAGTGGG - Intergenic
1110863786 13:80372514-80372536 TTAAATTAAACCATTGAAGTCGG + Intergenic
1111740971 13:92205496-92205518 TCTAATGAAACCCTTGGAGTTGG - Intronic
1113104061 13:106753529-106753551 TTCAGTTAATAGCTTGGAGTAGG - Intergenic
1114881800 14:26795592-26795614 TTTAATTAAGTCCTAAGAGTAGG + Intergenic
1115375187 14:32667286-32667308 TTTGATTACTCCCTTGGAAAAGG - Intronic
1119262308 14:73245113-73245135 TTTAATAAATCGCTTGAAGTGGG - Intronic
1119702441 14:76764360-76764382 TTTAGCTAATCCCCTAGAGTTGG + Intronic
1120475957 14:84987380-84987402 ATTAATAAATTCCTTGTAGTTGG - Intergenic
1120484483 14:85094357-85094379 GTGAATTCATCACTTGGAGTAGG + Intergenic
1121319615 14:92983756-92983778 CATAATTAATCCCTAGAAGTGGG - Intronic
1121707834 14:96012514-96012536 TTGGATTAATACCTTGGAGTGGG - Intergenic
1123126208 14:105947869-105947891 CTTGATTCTTCCCTTGGAGTGGG + Intergenic
1126504797 15:49392271-49392293 TTGAATTAGTACCTTGGAGAAGG + Intronic
1126504913 15:49393832-49393854 TTGAATTAGTACCTTGGAGAAGG + Intronic
1127993718 15:64139310-64139332 TTTGATTCATCCCTTGTTGTTGG + Exonic
1128635447 15:69299423-69299445 TTTAATAAAACCCTTGGATTGGG + Intronic
1129088133 15:73118772-73118794 TTTATTTAATCCCTTAGCTTGGG - Intronic
1130874399 15:87999893-87999915 TTCAATTAATATTTTGGAGTAGG - Intronic
1131738424 15:95359781-95359803 TTTAATTATTTACTTGGTGTGGG - Intergenic
1133623283 16:7546776-7546798 TTTAGCCAATCCCTTGTAGTTGG + Intronic
1137386900 16:48050179-48050201 TCTGATTCTTCCCTTGGAGTGGG - Intergenic
1137599822 16:49749037-49749059 TTTATTTAATGCCGTGGAGATGG - Intronic
1138062649 16:53908177-53908199 CTAAATTAATCCCATGGAATTGG - Intronic
1140019959 16:71229401-71229423 TTTGATAAATACCTGGGAGTAGG - Intronic
1140915780 16:79491992-79492014 ATTAATTAATAGCTTGGACTGGG - Intergenic
1143576241 17:7795055-7795077 TTTTATTGATCCTATGGAGTGGG + Intronic
1143961768 17:10727173-10727195 TTTAATTAATTTTTTGGAGATGG + Intronic
1145095389 17:20021092-20021114 TTTCATTAGTTCCTTGGAATTGG + Intronic
1149293527 17:55239573-55239595 TTTTAATAACCCCTAGGAGTGGG + Intergenic
1151203292 17:72485034-72485056 TTTAAATAATCCCCTGTGGTTGG - Intergenic
1152143711 17:78554505-78554527 TTAAATTAATTTCTTAGAGTAGG - Intronic
1153068250 18:1073320-1073342 TTTAAAAAATTCCTTTGAGTTGG + Intergenic
1153085371 18:1279438-1279460 TTTACTGAATTCCTTGGATTGGG - Intergenic
1153398827 18:4658693-4658715 TTTGATTAATGCCTTGGGCTAGG - Intergenic
1157843382 18:50980039-50980061 TTTAAATAAACAGTTGGAGTTGG + Intronic
1157939600 18:51912969-51912991 TATAGATATTCCCTTGGAGTAGG + Intergenic
1157940614 18:51924837-51924859 TTTAACAAATCCCTTAGTGTTGG - Intergenic
1157949423 18:52018071-52018093 TTAAATTAGGCCCTGGGAGTGGG - Intergenic
1158830660 18:61274314-61274336 TTTTAATATTCCCTTGGAGATGG + Intergenic
1202685590 1_KI270712v1_random:46539-46561 TTTTAGTAATTCCTTGGGGTGGG - Intergenic
928961040 2:36926125-36926147 TTTTAGTAATTCCTTGGGGTGGG - Intronic
933140661 2:78788908-78788930 TTTTATTAATCTGTTAGAGTGGG + Intergenic
933548523 2:83744019-83744041 TTTTATTATTCCCTTGGACGAGG + Intergenic
934246133 2:90308294-90308316 TTTTAGTAATTCCTTGGGGTGGG + Intergenic
934262614 2:91488736-91488758 TTTTAGTAATTCCTTGGGGTGGG - Intergenic
935450932 2:103208334-103208356 TTTAAATAATCACTTTAAGTAGG - Intergenic
935528640 2:104204854-104204876 TTTAACTATTCCCTAGGAGTGGG - Intergenic
940578595 2:155548182-155548204 TTTAATTATTACCTTCAAGTAGG + Intergenic
940703400 2:157074434-157074456 TTTAATTACTTCCTTTGAATGGG - Intergenic
940782954 2:157952708-157952730 CTTGATTTTTCCCTTGGAGTGGG - Intronic
941567124 2:167123262-167123284 TTTAATTCATCCATTGGGGGTGG + Intronic
941809520 2:169741369-169741391 TTTAATTAATACGTAGGTGTGGG + Exonic
942161685 2:173195697-173195719 TTTTATTAATTCCCTGGATTTGG - Intronic
943856423 2:192799580-192799602 TATAACTGATCCCTTGGAGAAGG + Intergenic
943965752 2:194329407-194329429 TTTGATAAATCCTTTGGAGTGGG + Intergenic
945557049 2:211290285-211290307 GGTAATTAATCCCTTAGAATAGG - Intergenic
945605822 2:211928961-211928983 TTTAATTACTCCCATTTAGTAGG + Intronic
947857218 2:233332293-233332315 TTTAATACATGGCTTGGAGTGGG + Intronic
1169163009 20:3398383-3398405 TTTACTTAAATCCTTTGAGTTGG + Intronic
1169262290 20:4148117-4148139 TTTAATAAACTCTTTGGAGTAGG + Intronic
1169447927 20:5688018-5688040 TGTAATTCATCACATGGAGTGGG - Intergenic
1169621393 20:7510622-7510644 TTTACCAAATGCCTTGGAGTTGG - Intergenic
1170678501 20:18504205-18504227 TTTAATTAATCCCTACGACCAGG - Intergenic
1172189016 20:33050383-33050405 TTTAATGAATCCCTTCCCGTGGG + Intergenic
1172659895 20:36560533-36560555 TTTTATTAAGCCAATGGAGTGGG - Intergenic
1174668106 20:52279467-52279489 TTTAATTTATCTCTTGGGCTGGG + Intergenic
1176333977 21:5578374-5578396 TGTAATTAAACCCTTAGGGTGGG + Intergenic
1176393780 21:6242578-6242600 TGTAATTAAACCCTTAGGGTGGG - Intergenic
1176467639 21:7073596-7073618 TGTAATTAAACCCTTAGGGTGGG + Intronic
1176491200 21:7455374-7455396 TGTAATTAAACCCTTAGGGTGGG + Intergenic
1176509442 21:7683009-7683031 TGTAATTAAACCCTTAGGGTGGG - Intergenic
1180968308 22:19801875-19801897 GCTAATTAATCACTTGGAGGCGG - Intronic
1183193794 22:36339101-36339123 TTGAATGAATCTCTTGGAGAAGG + Intronic
1184745505 22:46453432-46453454 CTTAATTCATCACTTGGAGTTGG + Intronic
950653186 3:14420427-14420449 TTTAATTAATCCCATAGTGATGG + Intronic
951862176 3:27265285-27265307 TTTGAAAAATGCCTTGGAGTGGG + Intronic
953094690 3:39763827-39763849 TTGGATTAATACCTAGGAGTGGG - Intergenic
953121017 3:40042072-40042094 TTTGATTCATCCCTTGTTGTTGG - Intronic
955218967 3:57008206-57008228 TATGATTAATCCCTAGGAGGTGG + Intronic
956762194 3:72453718-72453740 TTTGGTAAATCCCTAGGAGTGGG - Intergenic
957030335 3:75233502-75233524 TTTATTTAATACATAGGAGTGGG - Intergenic
957590665 3:82193208-82193230 GTTAATTAAGCCCTTGTAATCGG + Intergenic
957969432 3:87364132-87364154 TTTTATTAATCCCTAGAAGTAGG - Intergenic
961028126 3:123578964-123578986 TGGAAGTAATCCCTTGGACTGGG - Intronic
962094723 3:132281475-132281497 TTTAGTTAATCTCTAGGATTGGG - Intronic
962302387 3:134253796-134253818 TTTAATTAAACCCTTGGAGAAGG + Intergenic
964046302 3:152331594-152331616 TTTATTTAATTCCTTGGACATGG - Intronic
965190832 3:165527133-165527155 TTCAATTAATACCTTTGAGTTGG + Intergenic
965424033 3:168499183-168499205 TTGAATTTAACCCTTGGTGTTGG - Intergenic
966696019 3:182791812-182791834 TCCAATCAATCCCTTGAAGTAGG - Intergenic
967743159 3:193025159-193025181 TTTATTTGGTCACTTGGAGTTGG + Intergenic
970681838 4:18517714-18517736 TTTAAATAATCTGTTTGAGTGGG + Intergenic
970753393 4:19394296-19394318 CTTAGTTAAACCCTTGTAGTAGG + Intergenic
971129906 4:23796288-23796310 TTAAATTAATCCCATTGAATAGG - Intronic
971355743 4:25893957-25893979 TTTTATTAATCCCTTGGCAAAGG - Intronic
974092455 4:57326108-57326130 TTAAATTCATCCATTGGAGGAGG + Intergenic
975237601 4:72018137-72018159 ATTAATTAATAATTTGGAGTGGG + Intergenic
975653768 4:76620655-76620677 ATTTATTAATCCCCTGTAGTCGG - Intronic
975752628 4:77539494-77539516 TCTAATTCTTCCCTTGGGGTGGG + Intronic
976430781 4:84961941-84961963 TTGAGTTAATACCTAGGAGTGGG - Intronic
978104906 4:104890110-104890132 TTTATGTAATACCTTTGAGTAGG + Intergenic
978322247 4:107510529-107510551 TTCCATTAACCCATTGGAGTGGG + Intergenic
978533226 4:109734906-109734928 ATTAATAAATACCTTGGAATGGG + Intergenic
978789199 4:112643314-112643336 TTTAAATAAACACTTGAAGTAGG + Intronic
979985001 4:127302898-127302920 TTTAATTAAAACCTTGTAATAGG - Intergenic
982101709 4:151974878-151974900 TCAAAACAATCCCTTGGAGTAGG - Intergenic
988137695 5:27196060-27196082 TTTAATTAATCCCATAAAATTGG - Intergenic
992247144 5:74837524-74837546 TTTATTTCTTCCCTTTGAGTTGG - Intronic
994922559 5:106067875-106067897 TTTAGTTAATGCCTTGAACTTGG + Intergenic
995539257 5:113168718-113168740 TTTAATTAAGCCCTCCTAGTGGG + Intronic
996393517 5:122989180-122989202 TTTAGTTAAGTCCTTGGATTTGG - Intronic
997691537 5:135830781-135830803 TTTCATTAATCCTTTGAACTCGG + Intergenic
1000827542 5:166064450-166064472 CTTAATTACTCCCTTAGAGGCGG + Intergenic
1003793108 6:9568680-9568702 TCTCATTAATCCCTTGGTGAAGG + Intergenic
1003864944 6:10354280-10354302 TTTAAATAATCCTTGGAAGTAGG + Intergenic
1005765944 6:29012213-29012235 TTCTATTAATACCTTGCAGTGGG + Intergenic
1006215787 6:32441487-32441509 GTTCATTATTCCCTTGGTGTTGG + Intronic
1007797745 6:44364098-44364120 TTGAAATAATCCCTGGGAGGAGG - Intronic
1009578174 6:65494218-65494240 TTTAATAGATTCCTTGGATTTGG - Intronic
1013751529 6:113412579-113412601 TTGAATTTTTCCCTTGGAGGTGG + Intergenic
1014497794 6:122148307-122148329 ATTAAGTTATCCCTTGGAGAGGG - Intergenic
1015945850 6:138500117-138500139 TCTAATTTATCATTTGGAGTGGG - Intronic
1016422848 6:143902791-143902813 CATAATTAAGCCCTTGGGGTTGG - Intronic
1016690868 6:146936350-146936372 TTTGAATAATACCTTGGACTGGG - Intergenic
1017360195 6:153559734-153559756 TTTAATTAATCCATTGGTAATGG + Intergenic
1018483573 6:164216517-164216539 TTTAATTAATACTGTGGAGAGGG - Intergenic
1020526455 7:9265978-9266000 CTTTATTAATCCTCTGGAGTGGG + Intergenic
1026972607 7:74477449-74477471 TATAATGAATGCTTTGGAGTAGG + Intronic
1028996714 7:97108894-97108916 TTTAATTAATTCCTTGGTGTTGG + Intergenic
1029751759 7:102546702-102546724 TTTAATTAATTAATTTGAGTTGG + Intronic
1029769711 7:102645793-102645815 TTTAATTAATTAATTTGAGTTGG + Intronic
1031583525 7:123505819-123505841 TTTAATTCCTCCCTTGAAATAGG + Intronic
1036230926 8:6999476-6999498 TTTAAATATTCCCTTGGTGCAGG - Intronic
1036233372 8:7018575-7018597 TTTAAATATTCCCTTGGTGCAGG - Intergenic
1036415393 8:8542563-8542585 TTTAAGTAATCCCTTACTGTTGG + Intergenic
1036451634 8:8872758-8872780 TTTATTTTTTCCCTTGGAATAGG - Intronic
1038284067 8:26191082-26191104 TTTTATTACACCCTTGGCGTAGG - Intergenic
1038769095 8:30459578-30459600 TTTCATTATACCTTTGGAGTTGG + Intronic
1042684255 8:71420289-71420311 TTTAATGAATCCCTCTGAGATGG + Intronic
1042747739 8:72125774-72125796 TCTAATTCTTCCCTTGGGGTGGG - Intergenic
1044363078 8:91310778-91310800 TGTGATTCTTCCCTTGGAGTGGG - Intronic
1044646877 8:94453066-94453088 GTTCATAAATACCTTGGAGTAGG - Intronic
1046400630 8:113699206-113699228 CTTGATTCATCCCTTGGAGTGGG + Intergenic
1047180884 8:122586663-122586685 TTTAAATAATATATTGGAGTAGG - Intergenic
1049860454 8:144894660-144894682 TTTAATTAATTTCTTAGAGACGG + Intronic
1051072586 9:13189904-13189926 TTTATTTCATCTCTTGGAATTGG - Intronic
1051367470 9:16331390-16331412 TGTCATGAATCCCCTGGAGTGGG + Intergenic
1056160180 9:83882486-83882508 ATTATTTAATCCTTTGAAGTGGG - Intronic
1056360044 9:85847349-85847371 ATTATTTAATCCTTTGAAGTGGG + Intergenic
1059259354 9:112960831-112960853 TTTAGTAAATTCCTTGCAGTTGG + Intergenic
1059600590 9:115773479-115773501 TTTCATTAAACCCTTGAAGAAGG + Intergenic
1060453836 9:123770750-123770772 TTTAATTTATCACTTGGATTAGG - Intronic
1186263366 X:7805266-7805288 CTAAATTAATCCACTGGAGTAGG + Intergenic
1186570735 X:10712514-10712536 TCTGATTCTTCCCTTGGAGTGGG - Intronic
1186767124 X:12782226-12782248 TTTATTTATTCTCTTGGAGATGG - Intergenic
1188394783 X:29667849-29667871 TTAAAATATTCCCTTGGTGTGGG + Intronic
1188970961 X:36614339-36614361 TTTACTAAATTCCTTGGATTGGG - Intergenic
1189268630 X:39735315-39735337 TTTTTTTAATCCCTTGAAGAAGG - Intergenic
1189672534 X:43426203-43426225 TTTCATCAAGCCCTTGTAGTAGG - Intergenic
1190105574 X:47558832-47558854 TTAATTTTATCCATTGGAGTTGG + Intergenic
1191912729 X:66168218-66168240 TTCAAATTAACCCTTGGAGTAGG + Intronic
1192441425 X:71177390-71177412 TTTAATTAATGACTTGGATGAGG - Intergenic
1193878048 X:86886333-86886355 TTTGTTTAAACCCATGGAGTGGG + Intergenic
1194147749 X:90283288-90283310 CTTGATTATTCCTTTGGAGTAGG + Intergenic
1194775231 X:97954987-97955009 CTCATTTAATCCCTTGAAGTGGG + Intergenic
1197069505 X:122279133-122279155 GTGAATTAAACCCTGGGAGTTGG - Intergenic
1199942811 X:152641368-152641390 TTTCATTAACCCTTTGGAGTGGG - Intronic
1201454143 Y:14149900-14149922 TTAAATTAATCCACTGGAGTGGG - Intergenic
1202588052 Y:26453047-26453069 TTTTAGTAATTCCTTGGGGTGGG + Intergenic