ID: 1084657424

View in Genome Browser
Species Human (GRCh38)
Location 11:70527612-70527634
Sequence CCACCACGGGGGCTCCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 220}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084657424_1084657441 22 Left 1084657424 11:70527612-70527634 CCTCCCTGGAGCCCCCGTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 220
Right 1084657441 11:70527657-70527679 GCCGGGCCCCCAAATCTCTCTGG 0: 1
1: 0
2: 0
3: 4
4: 88
1084657424_1084657434 -9 Left 1084657424 11:70527612-70527634 CCTCCCTGGAGCCCCCGTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 220
Right 1084657434 11:70527626-70527648 CCGTGGTGGTGAAAGGAGCAGGG 0: 1
1: 0
2: 2
3: 16
4: 229
1084657424_1084657436 0 Left 1084657424 11:70527612-70527634 CCTCCCTGGAGCCCCCGTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 220
Right 1084657436 11:70527635-70527657 TGAAAGGAGCAGGGGCCCTGAGG 0: 1
1: 0
2: 5
3: 44
4: 422
1084657424_1084657432 -10 Left 1084657424 11:70527612-70527634 CCTCCCTGGAGCCCCCGTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 220
Right 1084657432 11:70527625-70527647 CCCGTGGTGGTGAAAGGAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 171
1084657424_1084657438 5 Left 1084657424 11:70527612-70527634 CCTCCCTGGAGCCCCCGTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 220
Right 1084657438 11:70527640-70527662 GGAGCAGGGGCCCTGAGGCCGGG 0: 1
1: 0
2: 9
3: 97
4: 802
1084657424_1084657437 4 Left 1084657424 11:70527612-70527634 CCTCCCTGGAGCCCCCGTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 220
Right 1084657437 11:70527639-70527661 AGGAGCAGGGGCCCTGAGGCCGG 0: 1
1: 2
2: 9
3: 172
4: 1109
1084657424_1084657435 -8 Left 1084657424 11:70527612-70527634 CCTCCCTGGAGCCCCCGTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 220
Right 1084657435 11:70527627-70527649 CGTGGTGGTGAAAGGAGCAGGGG 0: 1
1: 0
2: 0
3: 19
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084657424 Original CRISPR CCACCACGGGGGCTCCAGGG AGG (reversed) Intronic
900094689 1:935528-935550 ACCCCACGGCTGCTCCAGGGAGG - Intronic
900130412 1:1084929-1084951 CCATCGCGGGGGCACCATGGAGG - Intronic
900365712 1:2311195-2311217 CCCCCACGGAGGGTACAGGGCGG + Intergenic
900459636 1:2796666-2796688 ACAGCAAGGGGGCTCCAGGAGGG - Intronic
901829538 1:11883654-11883676 CCACCAAGCGGGCTCCAGGATGG + Intergenic
902033479 1:13439530-13439552 CCACCCCGTGGGCTCCTGTGCGG + Intergenic
902928786 1:19715926-19715948 CCATCTCAGGGACTCCAGGGAGG - Intronic
903000027 1:20258629-20258651 CCACCAGGAGGGCCGCAGGGCGG + Intergenic
903277012 1:22228775-22228797 GCAGCACCGGGACTCCAGGGAGG - Intergenic
903623512 1:24715078-24715100 TCACCCCGTGGGCTCCAGGCAGG - Intergenic
904276002 1:29384672-29384694 CCACCACAGGGGCTCCTCAGAGG + Intergenic
904396283 1:30224608-30224630 CCACCACGGGGGCTGAGGGCAGG - Intergenic
907513687 1:54980447-54980469 CCCCCGCGAGCGCTCCAGGGCGG - Intergenic
911741846 1:101394898-101394920 CCACCACCGGACCTCCAGGGAGG + Intergenic
919990715 1:202707438-202707460 CCACCACTGAAGGTCCAGGGTGG - Intronic
922542063 1:226427192-226427214 CCACTAGGTGGCCTCCAGGGAGG + Intergenic
922757700 1:228105648-228105670 CAGAGACGGGGGCTCCAGGGAGG + Intergenic
923307834 1:232704322-232704344 CCACCATAGGGGCACCAGGTTGG + Intergenic
923631196 1:235650190-235650212 CGGCCACGCGGGCTCCGGGGGGG - Intronic
1063769737 10:9183632-9183654 CCACCCCGTGGGCTCCTGTGCGG + Intergenic
1065888251 10:30097942-30097964 CAACCACAGAGGCTCCAGGAAGG + Intronic
1067574479 10:47400548-47400570 CCACCATGGAGGATCCAGGCAGG - Intergenic
1069581877 10:69572231-69572253 CCTCCACGGGGGCGGCAGGCTGG - Exonic
1074782471 10:116811871-116811893 CCACCGCAGGGATTCCAGGGCGG + Intergenic
1076132114 10:128020681-128020703 CCACCACTGGGACACCAGGAGGG - Intronic
1076474965 10:130745458-130745480 GTAGAACGGGGGCTCCAGGGAGG - Intergenic
1076935564 10:133566151-133566173 CCTCCACGGTGGCCCCAGCGCGG - Intronic
1077362450 11:2146732-2146754 CCACGACAGGGCCTGCAGGGAGG - Exonic
1077413381 11:2413714-2413736 CCAGGACGGGGGCTCCGGGAGGG - Intronic
1080262595 11:30365677-30365699 CAAAAACAGGGGCTCCAGGGAGG - Intergenic
1082011605 11:47453403-47453425 CCACCACGGGCACTCCAGCCTGG - Intergenic
1083664817 11:64268668-64268690 CCACAGTGCGGGCTCCAGGGCGG + Exonic
1084183599 11:67458650-67458672 CCGCCACTGAGGCTCCAGGAGGG + Exonic
1084330114 11:68425201-68425223 CCACCACCAGGGCCACAGGGCGG - Exonic
1084381642 11:68816605-68816627 CCACCCCGGGGGGTCCAGGAGGG - Intronic
1084383936 11:68830331-68830353 CCAGCAGGTGGGCTCCAGGTGGG - Intronic
1084657424 11:70527612-70527634 CCACCACGGGGGCTCCAGGGAGG - Intronic
1088847971 11:113683513-113683535 ACAGCACGTGGGCTCCAGGAAGG - Intergenic
1089292422 11:117445351-117445373 CAACCACCAGGGCTCAAGGGTGG - Intronic
1091671915 12:2457984-2458006 CCATCCCAGGGCCTCCAGGGTGG - Intronic
1094017940 12:25884421-25884443 CCATCACAGTGGCTTCAGGGAGG - Intergenic
1095982101 12:47979683-47979705 GCAGCAAGGGGGATCCAGGGAGG + Intronic
1096111893 12:49033756-49033778 CCACCACAGGGGCCTCCGGGTGG - Exonic
1097233905 12:57527193-57527215 CCCCGAGGGGGGATCCAGGGTGG - Exonic
1102157437 12:110742578-110742600 CGGCCCCGGGGGCTCGAGGGAGG - Intronic
1102951243 12:117033029-117033051 CCACCACAGGGGCTCCAACAGGG + Intergenic
1103266625 12:119636085-119636107 CCACCCCCTGGACTCCAGGGAGG - Intronic
1103595911 12:122024066-122024088 CCACCCCGCGGGCCCCGGGGCGG + Intronic
1103925377 12:124420925-124420947 CCGCCAGGGGGGCTCCCAGGCGG + Intronic
1105606706 13:21932099-21932121 CCACCACTGGGTCCCCGGGGGGG - Intergenic
1106587157 13:31067584-31067606 ACACCACGTGGCCGCCAGGGAGG + Intergenic
1107361239 13:39619512-39619534 CCACCCAGTGGGCTCCAGGCTGG - Intergenic
1108179604 13:47827772-47827794 CCACCATGGGTGGTCCATGGTGG - Intergenic
1112374356 13:98825048-98825070 CCACCCCGGGGCCTCTGGGGTGG - Intronic
1115429557 14:33300756-33300778 CCTCCATGGGGGATCCTGGGAGG - Intronic
1119442435 14:74637338-74637360 CCAGCAGGGGGTCTCCAGAGAGG - Intergenic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1121235957 14:92391363-92391385 CAACCCCAGGGTCTCCAGGGTGG + Intronic
1122276252 14:100592251-100592273 CCACCATGGGCCCTCCAGGCGGG + Intergenic
1122277959 14:100604939-100604961 CAAGCACGAGGGCTGCAGGGAGG - Intergenic
1122662816 14:103309408-103309430 CCCCCAGGGAGGCTCCAAGGCGG + Intergenic
1122738978 14:103859887-103859909 CCACCCAGGGGACTGCAGGGAGG - Intergenic
1122860260 14:104579362-104579384 CCACCACGGAGGCCCCATGCTGG + Intronic
1124203998 15:27701939-27701961 CCACTACTGGGGCGGCAGGGTGG + Intergenic
1125752186 15:42036619-42036641 CAACCAGGGGCGGTCCAGGGTGG - Intronic
1126099723 15:45111860-45111882 CGAACACGGGGTCTCCAGGTGGG + Exonic
1128265313 15:66261024-66261046 CCAACCCGGGGGCTTCAGGGAGG - Intergenic
1128638084 15:69315938-69315960 CCACCTCTGAGGCTCCAGGCTGG - Intronic
1129676195 15:77633421-77633443 CCAGGACGGGGGCTCCCGGTCGG - Intronic
1129680901 15:77657791-77657813 CCGCCGCGGGGGCTTGAGGGAGG + Intronic
1129739966 15:77985386-77985408 CACCCACGAGGGCTCCAGGAAGG - Intronic
1131846073 15:96491910-96491932 CCGCCCCGGGGGCTCCTGTGCGG - Intergenic
1132543518 16:522500-522522 CCTCCAGGGGGGCCACAGGGTGG + Exonic
1132623410 16:878980-879002 CCCCCACGCTGCCTCCAGGGGGG - Intronic
1132663933 16:1073184-1073206 CCACGACGGGGGCCACAGCGGGG + Intergenic
1132665612 16:1080161-1080183 ACACAGCGGGGGCTCCCGGGAGG + Intergenic
1132698757 16:1213368-1213390 CCAACTTGGGAGCTCCAGGGGGG + Intronic
1132804580 16:1769606-1769628 CCACCCTGGGGGCTTCTGGGAGG - Exonic
1133287394 16:4696983-4697005 CCACCACGCGGGATCCAGGCTGG + Intronic
1133464847 16:6019492-6019514 CCACCGCGGGTGCTGCTGGGGGG - Intronic
1134267159 16:12702208-12702230 CCACCAAGGGCCCTACAGGGTGG - Intronic
1134911827 16:18034311-18034333 CCACCATGGGGCATCCCGGGGGG + Intergenic
1136685796 16:31994323-31994345 CCAGTTCGGGGGCTCCAGCGTGG - Intergenic
1138529436 16:57627102-57627124 CCACCCCGTGGGGTGCAGGGAGG - Intronic
1140548693 16:75838802-75838824 AAATCACGGGGCCTCCAGGGTGG + Intergenic
1141527410 16:84620529-84620551 CCTCTACGGCGGCTCCATGGGGG - Intergenic
1141830980 16:86509967-86509989 CCAACGCGGGGGCCCGAGGGGGG + Intergenic
1141984635 16:87571861-87571883 CCACCACGAGGCCCCCAGGGTGG - Intergenic
1141993695 16:87623907-87623929 CCATTATGGGGGCTCCATGGTGG - Intronic
1142425665 16:90001007-90001029 CCTCCACGGAGGCCCCAGGAAGG - Intergenic
1142434445 16:90047675-90047697 CCACCAGGAGGGCCCCAGCGGGG + Intergenic
1142850191 17:2701023-2701045 CCAACACTGGGGGCCCAGGGCGG + Intronic
1146312385 17:31779211-31779233 CCAGCATGGAGGCTCCAGGCTGG + Intergenic
1146445242 17:32927970-32927992 CCACCGCGGGGGCGCGAGGAAGG + Exonic
1147146748 17:38489981-38490003 CCAGTTCGGGGGCTCCAGCGTGG - Intronic
1148321525 17:46758309-46758331 CCACAACGGGAGTTCCTGGGAGG + Intergenic
1148356601 17:46979376-46979398 CCAGCACCGGGACTCCGGGGAGG - Intronic
1148744203 17:49909471-49909493 CCAGCAAGGGGGCTCCAGGGTGG - Intergenic
1151757505 17:76083112-76083134 CCACCTAGGGGACTCCTGGGAGG + Exonic
1151893270 17:76963702-76963724 CCACCTTGGGGGCTCCTGAGAGG - Intergenic
1152142105 17:78542660-78542682 CAACCATGGGGGCTCCCAGGAGG + Intronic
1152290452 17:79437183-79437205 ACCCCAGGGGGGCTCCTGGGGGG - Intronic
1152408810 17:80111888-80111910 CCTGCACAGGGGCTCCTGGGAGG + Intergenic
1152418262 17:80177072-80177094 CCCCCATGAAGGCTCCAGGGAGG + Intronic
1153025678 18:670274-670296 CCAACACTGGGACGCCAGGGTGG - Intronic
1156340361 18:36205153-36205175 GCACCACAGGGGCTCCATTGGGG - Exonic
1156683611 18:39618748-39618770 CCACCCCGTGGGCTCCTGCGTGG + Intergenic
1160580129 18:79879033-79879055 CCACATCCGGGTCTCCAGGGAGG - Intronic
1160724330 19:610915-610937 CCTCCCCAGGGGCTCCGGGGGGG - Intronic
1160731715 19:644257-644279 CCCTCCCGGGGGCTCCAGTGCGG - Intergenic
1161086190 19:2335789-2335811 ACACCTCGAGGGCTCCAGGAGGG - Intronic
1161103371 19:2432218-2432240 ACACCACTCAGGCTCCAGGGAGG + Intronic
1161236517 19:3201086-3201108 CCACAGCCGGGGCTCGAGGGTGG + Intronic
1161321867 19:3645173-3645195 CACCCACGGGGGTTGCAGGGAGG - Intronic
1161357196 19:3825698-3825720 CCACCACGTGGGCTGCCAGGTGG + Intronic
1162817759 19:13207052-13207074 CCACGACAGGGGCTCTCGGGTGG - Exonic
1163267470 19:16229534-16229556 CCACCAGGGGGGCTCAGGGCAGG + Intronic
1163289482 19:16370148-16370170 CCACCATGGGAGCTCCTGGTGGG - Intronic
1163427010 19:17245510-17245532 CCCCCGCCGGGGCCCCAGGGCGG - Exonic
1165058798 19:33194959-33194981 CCACCGCGGTGGCTCCCGCGCGG + Intronic
1165080641 19:33303969-33303991 CCCCCTCCGGGGCTCCTGGGCGG - Intergenic
1165224096 19:34342029-34342051 CCACCACGGGCACCCCAGGCTGG + Exonic
1165913736 19:39245345-39245367 CCACCAGGGGAGCCCCAGGCTGG + Intergenic
1165917225 19:39268279-39268301 CCACCAGGGGAGCCCCAGGCTGG - Intergenic
1166066917 19:40365644-40365666 CCTACACGGGGACTCTAGGGTGG + Intronic
1167096680 19:47378261-47378283 CCACCAGACGGGCTCGAGGGAGG - Intronic
1167384089 19:49153962-49153984 CCACCACAGAGTCCCCAGGGAGG - Exonic
1167641967 19:50687121-50687143 CCACCCCGGGGCCCCGAGGGAGG - Intronic
1167674733 19:50877313-50877335 CCAGCATGGGGGCTGCAGGAGGG - Intronic
1167705004 19:51076775-51076797 GGACCACAGGGGCTCCAGGGAGG + Intergenic
1167938054 19:52923446-52923468 CCACCTCGTTGGCTCCACGGAGG - Intergenic
1168069831 19:53943209-53943231 CCTCGACGGGGCCTCGAGGGGGG - Exonic
1168153346 19:54460597-54460619 CCACCTCAGGGGCTCGGGGGGGG - Intronic
925294187 2:2767001-2767023 CCACCATGGTGGCTGCAGGCGGG - Intergenic
926736138 2:16074499-16074521 CCGCCACGGGGGCTCTTGTGAGG + Intergenic
927497982 2:23563431-23563453 GCCCCAAGGGGGCTCCTGGGAGG - Intronic
928199449 2:29238085-29238107 CCAGCACAGGAGCTCCAGTGTGG + Intronic
928880649 2:36092653-36092675 CCCGCACCGGGGCTGCAGGGTGG - Intergenic
929107280 2:38377320-38377342 CCACCCCGCCGGCTCCCGGGAGG - Intergenic
930728727 2:54708581-54708603 CCACCACGCTGGCTGCAGTGGGG + Intergenic
936093487 2:109515365-109515387 CCCCCACGGACCCTCCAGGGAGG - Intergenic
937152147 2:119693236-119693258 GCACCCCAGGGTCTCCAGGGGGG - Intergenic
937299351 2:120829730-120829752 CCACCAGGGTGGCTGCAGGAGGG + Intronic
937321026 2:120960844-120960866 CCACCACTGGGAGACCAGGGAGG - Intronic
942605970 2:177691368-177691390 CCACCACTGGGAGTGCAGGGTGG - Intronic
944206686 2:197164511-197164533 CCACCGCAGCGGCTCCTGGGTGG + Intronic
945189078 2:207167136-207167158 TCACCATGGGGTCTCCAGCGAGG + Intronic
948421479 2:237863122-237863144 CCTCCACTGGGGACCCAGGGAGG + Intronic
1169353129 20:4886120-4886142 CCACCCAGGCAGCTCCAGGGTGG + Intronic
1170701605 20:18708822-18708844 CCACCACGGGGGCAGGTGGGAGG - Intronic
1170825649 20:19792602-19792624 CCACCAGAGGGGCTAAAGGGGGG + Intergenic
1175387618 20:58607502-58607524 GCACCTGGAGGGCTCCAGGGAGG + Intergenic
1175632908 20:60557133-60557155 ACACAAGGGAGGCTCCAGGGTGG - Intergenic
1175939514 20:62531573-62531595 CCACCATGGGGGCTTCTGGGAGG + Intergenic
1178547118 21:33501575-33501597 CCAGCACGGGGGGCCCAGGTAGG - Intergenic
1179276810 21:39899465-39899487 CCACCACAGAGGCTCCAAAGGGG - Intronic
1179354155 21:40642912-40642934 CCATCACTGGGTCTCCTGGGAGG - Intronic
1179924689 21:44528038-44528060 CTACCAAGGAGGCTGCAGGGAGG + Intronic
1181069272 22:20322448-20322470 CCACCTCTGGGTCTTCAGGGAGG + Intergenic
1182243380 22:28935355-28935377 TCACCACACGGGCGCCAGGGTGG - Intronic
1182282411 22:29225148-29225170 CGACCACATGGGCTCCAAGGAGG - Exonic
1183002664 22:34874612-34874634 CCACCTCTGGGGGTGCAGGGGGG + Intergenic
1184406058 22:44301470-44301492 AGAACACAGGGGCTCCAGGGAGG - Intronic
953384565 3:42499267-42499289 CCAGCTCAGGGGCTCCATGGTGG - Intronic
953979750 3:47407689-47407711 TCACCAAGGGGGCTCCTGGGGGG - Exonic
954325221 3:49859765-49859787 CCACCCCCGGGGCTGCAGGTGGG - Exonic
954361575 3:50125291-50125313 CCACCAAGGGGGTCTCAGGGAGG + Intergenic
954539142 3:51382301-51382323 TCACCACTGGGGCTCCTGTGGGG - Exonic
955234945 3:57131024-57131046 GCACAACGGGGCCTCCCGGGGGG + Intronic
955405564 3:58623595-58623617 CCCCGACAGGGGCTCCAGGTGGG + Intronic
961458293 3:127034896-127034918 CGCCCTCAGGGGCTCCAGGGTGG - Exonic
961466822 3:127087131-127087153 CCAGCACAGTGGCTCCAGGCTGG + Intergenic
961714571 3:128849719-128849741 GCAAAACGGGGGCTCCAGGGTGG - Intergenic
967939613 3:194756043-194756065 CTACCACAGGAGGTCCAGGGAGG - Intergenic
968131850 3:196196727-196196749 CCACCCCAGAGGCTCCAGAGAGG + Intergenic
968472071 4:786853-786875 CCACCCCGGGGGGTCCCTGGAGG + Intronic
968910711 4:3475829-3475851 CCACCACGGAGGTGCTAGGGAGG - Intronic
969480742 4:7445619-7445641 CCAGGATGGGGGCTGCAGGGAGG + Intronic
969693299 4:8719731-8719753 GCTCCACGTGGGCTCCAGGAGGG + Intergenic
970007290 4:11424092-11424114 CCAGCACAGGGGCTGCAGGCGGG - Intronic
972960460 4:44447475-44447497 CCCCCGCGGGGCCTCCAGCGGGG + Intronic
973737363 4:53885741-53885763 CCAGCTCCAGGGCTCCAGGGAGG - Intronic
978420180 4:108523992-108524014 CCACCACGTGGGCTCCACCCTGG + Intergenic
978914274 4:114104725-114104747 CCACCACTGGGGATGCAGGGTGG + Intergenic
985663601 5:1169772-1169794 CGAGCACGGGGGCTCCTGGGGGG + Intergenic
994251472 5:97541952-97541974 CCACCCCGTGGGCTCCTGTGCGG - Intergenic
995379146 5:111512595-111512617 CGATCCCGGGGGCTCCGGGGAGG + Intergenic
995831430 5:116359873-116359895 CCACCCTGGGGTCTCCAGGAAGG - Intronic
997365273 5:133321508-133321530 CACCCACAGGGGCACCAGGGAGG - Intronic
1001988938 5:176100056-176100078 CCATCACGGGGGCAGCAGGTGGG - Intronic
1002204658 5:177554281-177554303 CGACCACGACGGCCCCAGGGAGG - Exonic
1002227931 5:177738080-177738102 CCATCACGGGGGCAGCAGGTGGG + Intronic
1002641664 5:180633417-180633439 CCACCTCGGGGCCCCAAGGGAGG - Intronic
1010196146 6:73241797-73241819 CCATCAGGGAGGCTGCAGGGAGG + Intronic
1018302519 6:162418791-162418813 GCACCAGGGGAGCTGCAGGGAGG + Intronic
1018854773 6:167667512-167667534 CCAACCCTGGCGCTCCAGGGGGG - Intergenic
1018966107 6:168490424-168490446 ACACCAGGTGGGCTCCAGAGGGG + Intronic
1019298429 7:290902-290924 GCACCGCGGCGGCTTCAGGGAGG + Intergenic
1020111853 7:5452019-5452041 CCACTTGGGGGTCTCCAGGGAGG - Intronic
1020118116 7:5487705-5487727 GCACCATGGGGGCCCCAGGCAGG + Intronic
1020139661 7:5605544-5605566 CCGCCAGGTGGGCTCCAGGGCGG + Exonic
1021940908 7:25678250-25678272 CCACCACTGTGGCTCCACTGGGG + Intergenic
1028446227 7:90927185-90927207 CCACCAATGTGCCTCCAGGGAGG - Intronic
1029222935 7:99004470-99004492 GCCCCATGGGAGCTCCAGGGTGG + Intronic
1029423723 7:100484327-100484349 CCACCCGGGGGGCTCCAGTCTGG - Intronic
1029440914 7:100586162-100586184 CAACTACGGCGGCTCCAAGGAGG - Intronic
1029514450 7:101017006-101017028 CTTCTACGGGGGCTCCTGGGGGG - Intronic
1029610808 7:101625583-101625605 CGACGACGCGGGCTCCTGGGCGG - Intronic
1030301494 7:107978975-107978997 CCACCAAGGTGGGTCCAGGAGGG - Intronic
1034195004 7:149239727-149239749 GCAGCACGGGGGCTCCGAGGCGG + Exonic
1035050969 7:155998913-155998935 CCTCCTCGGAGGCTGCAGGGTGG + Intergenic
1035450633 7:158974659-158974681 CCGCCAAGGGGGTTCCAGGCAGG + Intergenic
1035568615 8:658316-658338 CCTCCACTGGGCCTCCCGGGAGG + Intronic
1036645521 8:10609592-10609614 CCACCCAGGGGGCTGCAGAGAGG - Exonic
1036760702 8:11506815-11506837 CCACCTGGGGGGCCCCAGAGTGG - Intronic
1040341255 8:46442319-46442341 CAACAACGGGGGCAGCAGGGTGG - Intergenic
1044068136 8:87723312-87723334 CCACCACTGGGACTCCCAGGTGG + Intergenic
1048235097 8:132682276-132682298 CCAGCACGGCGGCCTCAGGGTGG - Intergenic
1049154753 8:141059730-141059752 CTCCCACGGGGGCTCCTGGCTGG - Intergenic
1052048974 9:23824347-23824369 CCACCACTGGAGCTCCGCGGCGG - Intronic
1053027245 9:34740312-34740334 CCACTCCGTGGGCTCCTGGGCGG - Intergenic
1056998185 9:91483519-91483541 CCAGCACCAGGGCTCCAAGGAGG - Intergenic
1057192036 9:93093787-93093809 CCACCACGGGGGCTGCAAGCAGG - Intergenic
1057208183 9:93185343-93185365 CCCCGACGGCGGCCCCAGGGAGG + Exonic
1059515258 9:114888801-114888823 ACACCACGGCTGCTGCAGGGTGG - Intergenic
1060749498 9:126159711-126159733 CCAGCAGGAGGGCTCCAGAGGGG + Intergenic
1060940531 9:127540755-127540777 CCACCATGGGGGCTGCACGCCGG + Intronic
1060943648 9:127557527-127557549 CCACCCGGGGGCCTCCAGGCAGG + Intronic
1061041739 9:128144664-128144686 GCACCAGAGGGGCTCCAGGCAGG + Intergenic
1061059535 9:128243571-128243593 CCACCATGGGGGCCCCTGGAAGG + Intronic
1061402238 9:130374716-130374738 CCACCGCGGGTGCTGGAGGGAGG + Intronic
1061767153 9:132888579-132888601 CCACCAGGAGGCCTCCAGGGTGG - Intronic
1062358229 9:136175180-136175202 AGCCCACGGGGGCTCCAGGTTGG - Intergenic
1062427937 9:136514634-136514656 CCACAACGGGGGCACCTGCGAGG - Exonic
1189179110 X:38986771-38986793 CCACCAGAGGGGCTGCAGGGAGG - Intergenic
1189317119 X:40064133-40064155 TCCCCCCGGGGGCTCCAGGGTGG + Intronic
1194384414 X:93236010-93236032 CCACCGCGGGGGGCACAGGGTGG - Intergenic
1195320857 X:103720992-103721014 ACCCCAAGGGGGCTCCTGGGTGG - Intronic
1200248690 X:154540780-154540802 CCACCACAGGGCTTCCAGGAGGG + Intronic