ID: 1084660862

View in Genome Browser
Species Human (GRCh38)
Location 11:70545478-70545500
Sequence GAGGACCCTCAGCTCTGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 240}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084660862_1084660866 -8 Left 1084660862 11:70545478-70545500 CCACTGCAGAGCTGAGGGTCCTC 0: 1
1: 0
2: 2
3: 36
4: 240
Right 1084660866 11:70545493-70545515 GGGTCCTCACCTCGGGGTCTTGG 0: 1
1: 1
2: 1
3: 12
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084660862 Original CRISPR GAGGACCCTCAGCTCTGCAG TGG (reversed) Intronic