ID: 1084662866

View in Genome Browser
Species Human (GRCh38)
Location 11:70557462-70557484
Sequence CAGTGGGGGAGGAGCCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1219
Summary {0: 1, 1: 2, 2: 23, 3: 205, 4: 988}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084662860_1084662866 2 Left 1084662860 11:70557437-70557459 CCAGACAGATGTTCTGGATGCTC 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1084662866 11:70557462-70557484 CAGTGGGGGAGGAGCCCAGATGG 0: 1
1: 2
2: 23
3: 205
4: 988
1084662858_1084662866 16 Left 1084662858 11:70557423-70557445 CCATATGGAAGCTTCCAGACAGA 0: 1
1: 1
2: 0
3: 15
4: 183
Right 1084662866 11:70557462-70557484 CAGTGGGGGAGGAGCCCAGATGG 0: 1
1: 2
2: 23
3: 205
4: 988

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084662866 Original CRISPR CAGTGGGGGAGGAGCCCAGA TGG Intronic
900680979 1:3915978-3916000 CTGTGGGGCAGGAGCCCACCTGG + Intergenic
900940217 1:5793614-5793636 CAGTGGTGGTGGTGGCCAGATGG + Intergenic
901167120 1:7229053-7229075 CAGGTGGAGGGGAGCCCAGAGGG + Intronic
901316898 1:8315697-8315719 CACTGAGGGAGGAGCCCAGGTGG - Intergenic
901637665 1:10677850-10677872 CAGTGGGCAAGGACCCCAAATGG + Intronic
901741190 1:11343041-11343063 CAGGAGGGGAGGAGCCAGGAGGG + Intergenic
902585713 1:17437889-17437911 CGGGGGGGGAGGGGCGCAGAGGG + Intronic
902631909 1:17709834-17709856 CAGGGATGGAGGAGCTCAGAGGG + Intergenic
902878461 1:19355040-19355062 CAGAGGGGCTGGAGGCCAGAAGG - Intronic
903069811 1:20721628-20721650 CCGTGGGAGGGGAGCCCTGAGGG - Exonic
903129838 1:21271665-21271687 CACTGGGGGAGGAGCCCAGTGGG + Intronic
903230407 1:21918934-21918956 GAGAGGGGGAGGAGCCCAGTGGG - Intronic
903319136 1:22531536-22531558 CAGTTCTGGAGGAGCACAGATGG + Intergenic
903800546 1:25964011-25964033 CAGCAGGGGAGGAGGCCAGGAGG + Intronic
904591669 1:31618406-31618428 CAGTGGGGGTGGTGCGCGGAGGG - Intronic
904750823 1:32740849-32740871 CAGCGGGAGAGGAGCCAAGATGG - Intergenic
904988396 1:34572087-34572109 CTCAGGGGGAGGAGCCAAGATGG - Intergenic
905394433 1:37657864-37657886 CTGGGAGGGAGGAGCACAGAAGG + Intergenic
905470617 1:38188942-38188964 CAATGTTGGAGGAGCCCACATGG - Intergenic
905740409 1:40365523-40365545 CATTCGGGGAGGAGCCAAGATGG + Intronic
905867671 1:41385057-41385079 TAGTGGGGTCAGAGCCCAGAAGG + Intergenic
905936450 1:41827894-41827916 CAATAGAGGAGGACCCCAGAGGG + Intronic
906033450 1:42737116-42737138 AAGTGAGGGAGGAGCCAAGGTGG + Intronic
906034385 1:42741337-42741359 CTGTGGGGGAGGAAGCCAGCAGG - Intergenic
906084618 1:43120499-43120521 AAGTCGGGGAGGAGCCAAGATGG - Intergenic
906851706 1:49257803-49257825 CCGTGCTGGAGGAGCCAAGATGG - Intronic
907415754 1:54312834-54312856 CACTGGAGGGGGAGCTCAGAGGG - Intronic
907470767 1:54672055-54672077 CAGTGTGACTGGAGCCCAGAGGG + Intronic
907838337 1:58132467-58132489 CCCGGGGGGAGGAGCCAAGATGG - Intronic
907853096 1:58275014-58275036 TATAGGGGGAGGAGCCAAGATGG - Intronic
907863801 1:58379188-58379210 CTGGGGGGGAGGAGCCAAGATGG - Intronic
908452868 1:64273423-64273445 TACGGGGGGAGGAGCCAAGATGG + Intergenic
908575630 1:65456291-65456313 TATGGGGGGAGGAGCCAAGATGG - Intronic
908665029 1:66480920-66480942 CCGGGAGGGAGGAGCCAAGATGG + Intergenic
908717393 1:67084899-67084921 CAAGGTGGGAGGAGCCAAGATGG - Intergenic
908881710 1:68740118-68740140 CTTTGGGGGAGGAGCCAAGATGG - Intergenic
908898035 1:68923483-68923505 CACCGGAGGAGGAGCCAAGATGG + Intergenic
909036694 1:70601260-70601282 CTCGGGGGGAGGAGCCAAGATGG - Intergenic
909114147 1:71513694-71513716 CAGCAGAGGAGGAGCCAAGATGG + Intronic
909778893 1:79517264-79517286 AAGAGTGGGAGGAGCCAAGATGG - Intergenic
909812246 1:79944401-79944423 ATGGGGGGGAGGAGCCAAGATGG - Intergenic
910082410 1:83356447-83356469 CTGAGAGGGAGGAGCCAAGATGG - Intergenic
910144074 1:84058389-84058411 TTGTAGGGGAGGAGCCAAGATGG - Intergenic
910911359 1:92237711-92237733 TTATGGGGGAGGAGCCAAGATGG - Intronic
911064977 1:93780018-93780040 CAGTGGGGGATGAGGTCAGTGGG - Intronic
911066788 1:93796664-93796686 GTGTTGGGGAGGAGCCAAGATGG - Intronic
911508438 1:98783538-98783560 AATTGGGGGTGGAGCCAAGATGG + Intergenic
911557260 1:99360147-99360169 CAGTGGGGAACAAGACCAGAAGG - Intergenic
911932394 1:103921997-103922019 ACTTGGGGGAGGAGCCAAGATGG + Intergenic
913284937 1:117217591-117217613 CATTTGGGGTGGAGCCAAGATGG + Intergenic
913299815 1:117358708-117358730 CAGAGCGGGAGGAGCCAAGATGG - Intergenic
914401800 1:147327796-147327818 AAGGGGGGGAGGAGCCAAGATGG - Intergenic
914408546 1:147402381-147402403 CTCGGGGGGAGGAGCCAAGATGG + Intergenic
914410540 1:147423215-147423237 CCTTGGGGGAGGAGCCAAGATGG + Intergenic
914492316 1:148160197-148160219 CAGTGGGGGAGATGCCCACGTGG + Intergenic
915238594 1:154502947-154502969 CAGAGGGGGCGGAGCGCGGAGGG + Intronic
915445281 1:155971000-155971022 CAGAGCGGGAGGAGCCTAGGAGG - Intronic
915462060 1:156076226-156076248 CAGCGGGGGAGGTGGGCAGAGGG + Exonic
915506054 1:156357149-156357171 CGGAGGGGGAGGAGCCCAGCAGG + Intronic
915761775 1:158320667-158320689 TGGAGGGGGAGGAGCCAAGATGG - Intergenic
915770255 1:158414798-158414820 CAGTGGGGAAACAGCTCAGAAGG - Intergenic
915808913 1:158886100-158886122 CCGAGGAGGAGGAGCCAAGATGG + Intergenic
915905411 1:159873284-159873306 AAATGGGGCTGGAGCCCAGAGGG - Intronic
916019976 1:160783077-160783099 ATGTGGGGGAGGAGCCAAGATGG + Intergenic
916140441 1:161692856-161692878 CAAGGGGGGAGGGGCCAAGATGG + Intergenic
916359055 1:163947213-163947235 CAGTAGTGAAAGAGCCCAGAAGG + Intergenic
916497276 1:165356854-165356876 CAGAGGCGGAGGGGCTCAGAGGG - Intergenic
916596884 1:166252210-166252232 AACAGGGGGAGGAGCCAAGATGG - Intergenic
916903684 1:169257573-169257595 CAGAGGGGGAGGAGCCAAGATGG - Intronic
916977390 1:170095183-170095205 CTAAGGGGGAGGAGCCAAGATGG - Intergenic
917182423 1:172314243-172314265 CACAGGGGGAGGAGCCAAGATGG + Intronic
918058541 1:181043333-181043355 CTGTGAGGGAGGAGCCCATGGGG + Intronic
918070530 1:181130769-181130791 CAGTGGAGGAGGGGCACAGCTGG + Intergenic
918215933 1:182391913-182391935 CATTGGGCGAGGAGCCCGGCGGG + Exonic
918483159 1:185001526-185001548 CAGTAGAGGAGGAGCCAAGATGG + Intergenic
918786196 1:188768178-188768200 ATGTGGGGGAGGGGCCAAGATGG + Intergenic
918855739 1:189754798-189754820 TACTGGGGGAGGAGCCAAGATGG + Intergenic
919580817 1:199369957-199369979 CACAGGGAGAGGAACCCAGATGG + Intergenic
919802974 1:201364635-201364657 AGGTGGGGGCAGAGCCCAGAAGG - Intronic
920244908 1:204580123-204580145 CAGTGAGAGGGGAGCACAGAGGG - Intergenic
920302420 1:204997161-204997183 CAATGTGGGAGGAGCTGAGAGGG - Exonic
920506311 1:206517872-206517894 GGGTGGGGGAGGGGCCCATAAGG - Intronic
920805024 1:209224872-209224894 CAGTGTGGTTGGAGCACAGAGGG - Intergenic
920995696 1:210988413-210988435 CATAGGGGGAGGAGCCAAGATGG - Intronic
921056847 1:211548955-211548977 CAGTGGGGGAGGAGCCACCTAGG + Intergenic
921652612 1:217696506-217696528 CTTTTGGGGAGGAGCCAAGATGG - Intronic
921796510 1:219350930-219350952 AAGAGGGTGAGGAGCCCAGTGGG + Intergenic
922086168 1:222349124-222349146 CAGTGAAGGAGGATCACAGAAGG - Intergenic
922142777 1:222906759-222906781 CATAGGCAGAGGAGCCCAGAGGG - Intronic
922172507 1:223167649-223167671 GTTTGGGGGAGGAGCCAAGATGG + Intergenic
922205979 1:223446986-223447008 CATTCTGGGAGGAGCCAAGATGG + Intergenic
922404867 1:225301653-225301675 CACTGGGGGAGGACCACAGGTGG + Intronic
923291608 1:232551587-232551609 CAGTGGGGGAGGTGAGAAGAAGG + Intronic
924427645 1:243967732-243967754 CAGTAGGAGAGGAGCTGAGAAGG + Intergenic
924583485 1:245341815-245341837 CAGTTGGGGCAGAGCTCAGAGGG + Intronic
924882189 1:248172571-248172593 AAAGGGGGGAGGAGCCAAGATGG - Intergenic
1063375800 10:5553593-5553615 GAGGTGGGGAGGAGCCCAGCGGG + Intergenic
1063528826 10:6810283-6810305 TTCTGGGGGAGGAGCCAAGATGG - Intergenic
1063554287 10:7063518-7063540 TCGAGGGGGAGGAGCCAAGATGG - Intergenic
1063665658 10:8058777-8058799 CGGTGGGGGAGCCGCCCAGCAGG - Exonic
1064802779 10:19094600-19094622 AGTTGGGGGAGGAGCCAAGATGG - Intronic
1065022971 10:21516346-21516368 CAGCGGCGGCGGAGGCCAGATGG + Exonic
1065319919 10:24499812-24499834 CAGCAGGGGAGCAGGCCAGAAGG - Intronic
1065985564 10:30948022-30948044 CAGCTGCGGAGGAGCCAAGATGG - Intronic
1066326155 10:34361101-34361123 CTGAGGAGGAGGAGCTCAGAAGG - Intronic
1066444941 10:35473779-35473801 CTTGGGGGGAGGAGCCAAGATGG + Intronic
1066487197 10:35858665-35858687 CTTAGGGGGAGGAGCCAAGATGG + Intergenic
1066676843 10:37896966-37896988 TAGACGGGGAGGAGCCAAGATGG + Intergenic
1066930197 10:41749401-41749423 TAGTGGAGGAGGAGCCAAGATGG + Intergenic
1067785815 10:49246132-49246154 AAGAGGGGGAGGAGCCAAGATGG + Intergenic
1067809657 10:49417362-49417384 CTGTGGGGGAGAAGCCACGAGGG - Intergenic
1068202324 10:53797827-53797849 AAGGGGTGGAGGAGCCAAGATGG - Intergenic
1068333406 10:55601872-55601894 CACGGGGGGAGGAGCCAAGATGG + Intronic
1068340065 10:55689075-55689097 AAGCAGGGGAGGAGCCAAGATGG - Intergenic
1068940749 10:62678512-62678534 AACTGAGGGAGGAGCCAAGATGG - Intergenic
1069110713 10:64442505-64442527 TCTTGGGGGAGGAGCCAAGATGG - Intergenic
1069240184 10:66129426-66129448 CAGCCAGGGTGGAGCCCAGAGGG + Intronic
1069594163 10:69659867-69659889 CACTGGGGGAGGGGCCCTGGGGG - Intergenic
1069745677 10:70713449-70713471 CAGTGGGGCAGGAGCCCCAGGGG + Intronic
1069982424 10:72261456-72261478 CCCAGGGGGAGGATCCCAGAGGG + Intergenic
1071072364 10:81709608-81709630 TAGGGGGGGAGGAGCCAAGATGG + Intergenic
1071077625 10:81773223-81773245 ACGAGGGGGAGGAGCCAAGATGG - Intergenic
1071105542 10:82089889-82089911 CACTGGGGCAGGAGCCTAGAAGG - Intronic
1071248133 10:83787069-83787091 AAGAGGGGGAGGAGCCAAGATGG - Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071602436 10:86964870-86964892 CTCTGCTGGAGGAGCCCAGAGGG + Intronic
1071904675 10:90159461-90159483 CAGGAGGGGAGGAGCCAAGATGG - Intergenic
1071912357 10:90250610-90250632 GCTTGGGGGAGGAGCCAAGATGG + Intergenic
1072029300 10:91503260-91503282 AAATGAGGGAGGAGCCAAGATGG + Intronic
1072399128 10:95079212-95079234 AATCGGGGGAGGAGCCAAGATGG + Intergenic
1072874010 10:99152734-99152756 ATGAGGGGGAGGAGCCAAGATGG + Intronic
1073048639 10:100654277-100654299 ACGTGGGGGAGGAACCCGGAGGG - Intergenic
1073105892 10:101031936-101031958 TACTGGGGTAGGAGCCCAGGGGG + Intronic
1073470691 10:103720441-103720463 CAGTGGGGGAGGTGGGCAGCAGG - Intronic
1073653197 10:105383359-105383381 TAGGGGGGGAGGAGCCAAGATGG - Intergenic
1073716500 10:106114385-106114407 ATGTGGGGGAGGGGCCAAGATGG + Intergenic
1073898540 10:108191607-108191629 CATTGTGGGAGGAACCCAGTGGG + Intergenic
1073987233 10:109223617-109223639 AAATAGGGGAGGAGCCAAGATGG + Intergenic
1074003228 10:109393181-109393203 CACTGGGGGTGGAGCCAAAATGG + Intergenic
1074023103 10:109605443-109605465 TAAAGGGGGAGGAGCCAAGATGG + Intergenic
1074044588 10:109825814-109825836 CAGAGGGGGAGGAGCCAAGATGG + Intergenic
1074165763 10:110872349-110872371 CAGAGGGGGAGGAGGGCTGAGGG - Intronic
1074179154 10:111043137-111043159 GATTGGGGGTGGAGCCAAGATGG + Intergenic
1074282104 10:112062387-112062409 CAGGAGGGGAGGAGCCAAGATGG + Intergenic
1074286626 10:112103922-112103944 TGGTGGGGGAGGAGCCAAGATGG + Intergenic
1074363526 10:112840611-112840633 CAGTGGGGCAGCTGCCCAGGGGG - Intergenic
1074490833 10:113938257-113938279 CAGAAGGGGAGGAGCGGAGATGG - Intergenic
1074778401 10:116783300-116783322 CAGTGGCAGAGGAGCCTGGATGG + Intergenic
1074809171 10:117085045-117085067 CCCTGGGGGAGGAGCCAAGATGG - Intronic
1074819603 10:117168354-117168376 GAGTGGGGATGGAGCCCCGAGGG - Intergenic
1075077649 10:119361643-119361665 CAGTGGGGGAGGCGCAGAGGGGG + Intronic
1075553527 10:123412018-123412040 CAGTGTTGGAGGAGCCCCGTGGG + Intergenic
1075973693 10:126676468-126676490 ACGAGGGGGAGGAGCCAAGATGG + Intergenic
1076193633 10:128499742-128499764 CAGGTGGGGAGGGGCCCAGCAGG + Intergenic
1076339992 10:129738563-129738585 CACATGGGGAGGAGCCAAGATGG - Intronic
1076849410 10:133085818-133085840 CAGCGGGGGAGGGGCCCTGGGGG + Intronic
1076882487 10:133246264-133246286 CAGTGTTGGGAGAGCCCAGAGGG - Intergenic
1076899968 10:133333563-133333585 AAGTGGGGTAGGATCCCAGGTGG + Intronic
1076932912 10:133545755-133545777 AAGTGGGGGAGGGGCCAAGATGG + Intronic
1077141987 11:1028808-1028830 GGGTGGGGAGGGAGCCCAGACGG - Intronic
1077269354 11:1667779-1667801 CTGTGGTGGTGCAGCCCAGAAGG + Intergenic
1077461563 11:2713306-2713328 CAGCAGAGGAAGAGCCCAGAAGG - Intronic
1077475453 11:2788192-2788214 CTGTGGAGAAGGAGCCCAGGAGG - Intronic
1077591918 11:3499033-3499055 TAGTGGGGGTGGAGCCAAGATGG - Intergenic
1077794481 11:5477495-5477517 TATTGGGGGAGGAGCCAAGATGG + Intronic
1078182537 11:9024590-9024612 CAGTGAGAGAGGAGACTAGAAGG - Intronic
1078806974 11:14715903-14715925 CATAGTGGGAGGAGCCAAGATGG + Intronic
1079577585 11:22022003-22022025 CAAGGGAGGAGGAGCCAAGATGG - Intergenic
1079808525 11:24963900-24963922 CTGGAGGGGAGGAGCCAAGATGG - Intronic
1079842737 11:25425129-25425151 AATGGGGGGAGGAGCCAAGATGG + Intergenic
1079848739 11:25502121-25502143 TCGAGGGGGAGGAGCCAAGATGG - Intergenic
1080234922 11:30057216-30057238 GTTTGGGGGAGGAGCCAAGATGG - Intergenic
1080378297 11:31740750-31740772 ATTTGGGGGAGGAGCCAAGATGG + Intronic
1080508963 11:32947238-32947260 AACAGGGGGAGGAGCCAAGATGG - Intronic
1080583567 11:33662892-33662914 CACTGGGAGATGAGCCCAGAAGG - Intronic
1080907171 11:36557619-36557641 AAGTTGAGGAGGAGCCAAGATGG - Intronic
1081039321 11:38191737-38191759 TATTGAGGGAGGAGCCAAGATGG + Intergenic
1081169196 11:39846652-39846674 TGGTAGGGGAGGAGCCAAGATGG + Intergenic
1081443065 11:43101133-43101155 AAATGGGGGTGGAGCCAAGATGG - Intergenic
1081468996 11:43352100-43352122 TGATGGGGGAGGAGCCAAGATGG - Intergenic
1081516141 11:43832138-43832160 CAGTGGGAGTGGACCCCTGATGG + Intronic
1081775604 11:45674251-45674273 CAGTCAGGGAGGAGCCCAGGAGG - Intergenic
1081882119 11:46462558-46462580 CAGTGGGAGACAAGCCCAGAGGG - Intronic
1082152011 11:48750697-48750719 AAGTGGGGGAGGAGCCAAGATGG - Intergenic
1082158383 11:48853706-48853728 ATGTGGGGGAGGAGCCAAGATGG - Intergenic
1082321688 11:50819349-50819371 TTCTGGGGGAGGAGCCAAGATGG - Intergenic
1082636335 11:55598586-55598608 CACGGGGGGTGGAGCCAAGATGG - Intergenic
1082684275 11:56219462-56219484 GTGTGGGGGTGGAGCCAAGATGG + Intergenic
1082877165 11:58000169-58000191 TTCTGGGGGAGGAGCCAAGATGG - Intergenic
1082956691 11:58877404-58877426 CAGAGGGAGTGGAGCCAAGATGG - Intronic
1083460297 11:62806656-62806678 CAGGGGAGCAGGATCCCAGAGGG - Intergenic
1083594219 11:63911414-63911436 CAGGGGGGGAGGTGGGCAGAGGG - Exonic
1084247757 11:67871769-67871791 TAGTGGGGGTGGAGCCAAGATGG - Intergenic
1084662866 11:70557462-70557484 CAGTGGGGGAGGAGCCCAGATGG + Intronic
1084825064 11:71723724-71723746 TAGCGGGGGTGGAGCCAAGATGG + Intergenic
1084864012 11:72041216-72041238 CAGTGGGGGTGGGGCCCAGAGGG + Intronic
1085156020 11:74295050-74295072 CACGGGGGGAGGAGCCAAGATGG - Intronic
1085280207 11:75325123-75325145 CAGTGGGGGAGGTGCCAACATGG + Intronic
1085797135 11:79552649-79552671 TAGCTGGGGAGGAGCCAAGATGG + Intergenic
1086184955 11:84002417-84002439 CTGTGGGAGAGGAGCCCTCATGG - Intronic
1086442033 11:86837936-86837958 CAGTGGGTGAAGTGCACAGAGGG + Intronic
1086742125 11:90380645-90380667 TACTGGGGGAGGGGCCAAGATGG - Intergenic
1086786189 11:90972284-90972306 AACTGGAGGAGGAGCCAAGATGG - Intergenic
1086976252 11:93136635-93136657 ACATGGGGGAGGAGCCAAGATGG + Intergenic
1087209855 11:95436212-95436234 TTGTAGGGGAGGAGCCAAGATGG + Intergenic
1087330831 11:96777802-96777824 GAGCGGGGGAGGAGCCAAGATGG - Intergenic
1087370750 11:97280283-97280305 CAGTGGTGGTGGTGGCCAGAGGG + Intergenic
1087608747 11:100409038-100409060 CGCTGGGGGAGGAGCCAAGATGG + Intergenic
1087615458 11:100481726-100481748 TTGGGGGGGAGGAGCCAAGATGG - Intergenic
1087787873 11:102375175-102375197 AAGGAGGGGAGGAGCCAAGATGG - Intronic
1088203108 11:107361807-107361829 TGTTGGGGGAGGAGCCAAGATGG + Intronic
1088414246 11:109571378-109571400 CAAGGGGGGAGAAGCCAAGATGG + Intergenic
1088806622 11:113358679-113358701 CAGTTGATGTGGAGCCCAGAGGG - Intronic
1089071158 11:115700684-115700706 CAGAGGGTGGGGAGACCAGAGGG + Intergenic
1089560241 11:119340036-119340058 GAGCGGGGGAGGGGCCCAGGCGG - Intronic
1089567611 11:119380350-119380372 AAAGGGGGAAGGAGCCCAGATGG - Intronic
1089609348 11:119660840-119660862 CAGAGGAGCAGGAGCCCTGAGGG - Intronic
1090337560 11:125983090-125983112 AAGTGAGGGAGGACCCCAGCAGG - Intronic
1090684434 11:129100122-129100144 CAGTTGATGTGGAGCCCAGAAGG + Intronic
1090896752 11:130984260-130984282 TCCTGGGGGAGGAGCCAAGATGG + Intergenic
1091183102 11:133625265-133625287 CAGTGAGGAAGGAGCACTGATGG + Intergenic
1091407744 12:219919-219941 CATGGGGGGGGGTGCCCAGAGGG - Intergenic
1091706794 12:2699493-2699515 AACTAGGGGAGGAGCCAAGATGG + Intergenic
1091943119 12:4508892-4508914 CCTGGGGGGAGGAGCCAAGATGG + Intronic
1092012090 12:5122413-5122435 CTGAGGCGGAGGAGCCAAGATGG - Intergenic
1092418040 12:8307164-8307186 TAGCGGGGGTGGAGCCAAGATGG - Intergenic
1092709005 12:11314740-11314762 GATTGGAGGAGGAGCCAAGATGG + Intergenic
1093191334 12:16078430-16078452 CAGTGGGAGAGGAGACCATCTGG + Intergenic
1093332025 12:17855565-17855587 AATTGAGGGAGGAGCCAAGATGG + Intergenic
1093571166 12:20667832-20667854 TTGCGGGGGAGGAGCCAAGATGG + Intronic
1093620552 12:21284248-21284270 ATGAGGGGGAGGAGCCAAGATGG + Intronic
1093629773 12:21395006-21395028 CAAGGGGAGAGGAGCCAAGATGG + Exonic
1093693638 12:22136527-22136549 ATGGGGGGGAGGAGCCAAGATGG + Intronic
1093986163 12:25536710-25536732 AAGTAGGGGAGGAGCCAAGATGG + Intronic
1094222360 12:28008157-28008179 GGGAGGGGGAGGAGCCAAGATGG - Intergenic
1094561320 12:31556187-31556209 AAAGGGGGGAGGAGCCAAGATGG - Intronic
1094803382 12:34064971-34064993 CATTAGAGGAGGAGCCAAGATGG + Intergenic
1094861400 12:34470176-34470198 AAATGGAGGAGGAGCCAAGATGG - Intergenic
1095083240 12:38031430-38031452 CTGGGGGCGAGGAGCCAAGACGG + Intergenic
1095387936 12:41672312-41672334 AAGAGAGGGAGGAGCCAAGATGG - Intergenic
1095553284 12:43470969-43470991 CTATCGGGGAGGAGCCAAGATGG + Intronic
1095591233 12:43906478-43906500 AAGCGGGGGAGGAGCCAAGATGG + Intronic
1095657546 12:44687414-44687436 AAGAGGGGGAGGAGCCAAGATGG - Intronic
1095873587 12:47056715-47056737 AAGAGGGGGAGGAGCCAAGATGG + Intergenic
1095911056 12:47426900-47426922 AAGACGGGGAGGAGCCAAGATGG + Intergenic
1095966515 12:47870725-47870747 CAGTGGAGATGGAGCCCAGAGGG - Intronic
1096243549 12:49972292-49972314 CAGAGACGGAGGAGCCAAGAAGG + Intronic
1096493035 12:52023375-52023397 GAGTGGGGTGGGAGCGCAGAGGG + Intronic
1096496209 12:52040767-52040789 AAGAGGAGGAGGACCCCAGAGGG - Intronic
1096910812 12:54981973-54981995 CAGTGTGGGAGGAGAGAAGAAGG + Intronic
1096921191 12:55087389-55087411 CCTGGGGGGAGGAGCCAAGATGG - Intergenic
1096940848 12:55344246-55344268 TAGAGGGGGAGGAGCCAAGATGG + Intergenic
1097201242 12:57280640-57280662 CAGTGGGGGAGGGGACAAAAGGG - Intronic
1097222708 12:57460238-57460260 CAGTGGGGGAGGGGGCCTGAGGG + Intronic
1097621153 12:61941436-61941458 TTGTTGGGGAGGAGCCAAGATGG + Intronic
1097963537 12:65555724-65555746 TTGTGTGGGAGGAGCCAAGATGG - Intergenic
1098097837 12:66979034-66979056 TCCTGGGGGAGGAACCCAGATGG - Intergenic
1098665293 12:73153627-73153649 GTTTGGGGGAGGAGCCAAGATGG - Intergenic
1098794701 12:74874865-74874887 TGGTGGAGGAGGAGCCAAGATGG + Intergenic
1098855766 12:75651603-75651625 CAGTGGGGGAAGTGCCAAGTTGG - Intergenic
1098922953 12:76319621-76319643 GGGTGGGGGAGGAGCCAAGATGG + Intergenic
1099001145 12:77179406-77179428 AAGCGGGGGAGGAGCCAAGATGG - Intergenic
1099040908 12:77653961-77653983 AGTTGGGGGAGGAGCCAAGATGG + Intergenic
1099106703 12:78506426-78506448 TGGTAGGGGAGGAGCCAAGATGG + Intergenic
1099235771 12:80080810-80080832 GCGGGGGGGAGGAGCCAAGATGG - Intergenic
1099548276 12:84011912-84011934 CCGAGAGGGAGGAGCCAAGATGG - Intergenic
1101077471 12:101146040-101146062 TACCGGGGGAGGAGCCAAGATGG + Intergenic
1101240478 12:102833190-102833212 GTGGGGGGGAGGAGCCAAGATGG - Intergenic
1101537062 12:105628258-105628280 GAGGGGGGGAGGAGCCAAGATGG + Intergenic
1101928986 12:108996944-108996966 TAGAGGAGGAGGAGCCAAGATGG + Intronic
1102328069 12:112006089-112006111 CAGTATAGGAGGAGCCCAGCTGG - Intronic
1102750051 12:115285119-115285141 CTTGGGGGGAGGAGCCAAGATGG + Intergenic
1104843885 12:131837197-131837219 CTCTGAGGAAGGAGCCCAGAGGG + Intronic
1104846726 12:131850753-131850775 CAGTGGGGGGTCAGACCAGACGG - Intronic
1104862668 12:131932324-131932346 CAGCGGGGGAGGGGCAGAGAAGG - Intronic
1105277937 13:18947113-18947135 CAGTGGGTGTGGAGCAGAGAGGG + Intergenic
1105784967 13:23739514-23739536 CAGTCAGGCAGGAGCCCAGAGGG + Intronic
1106991749 13:35428264-35428286 GGGTGGGGGAGGAGCCAAGATGG - Intronic
1107208907 13:37828281-37828303 TGGAGGGGGAGGAGCCAAGATGG - Intronic
1107231132 13:38112133-38112155 TTGAGGGGGAGGAGCCAAGATGG + Intergenic
1107475850 13:40734916-40734938 AGGCGGGGGAGGAGCCAAGATGG + Intronic
1107486089 13:40828814-40828836 GAGGGTGGGAGGAGCCAAGATGG + Intergenic
1107534238 13:41311925-41311947 CACCGGGGGAGGATCCCTGAGGG - Intronic
1107639234 13:42424877-42424899 CTTGGGGGGAGGAGCCAAGATGG + Intergenic
1107726833 13:43307620-43307642 CAGAGGCAGAGAAGCCCAGAAGG - Intronic
1107971250 13:45645027-45645049 AAGAGGGGGAGGAGCCAAGATGG + Intergenic
1108296161 13:49019611-49019633 ATGTAGGGGAGGAGCCAAGATGG - Intronic
1108775552 13:53761285-53761307 CAGTGGGTGGGGAGCCTAGAGGG + Intergenic
1109270685 13:60252033-60252055 GAGTGAGGGAGGAGCCAAGATGG - Intergenic
1109323027 13:60833328-60833350 CCATGGGGGTGGAGCCAAGATGG - Intergenic
1110328242 13:74241952-74241974 CCTGGGGGGAGGAGCCAAGATGG - Intergenic
1110586421 13:77199024-77199046 TAGGGGGGGAGGAGGCAAGATGG + Intronic
1110841737 13:80151898-80151920 ATGGGGGGGAGGAGCCAAGATGG + Intergenic
1110949378 13:81465182-81465204 CTCTGGGCGAGGAGCCAAGATGG - Intergenic
1110991190 13:82045346-82045368 TAGGGGGGGAGGAGCCAAGATGG + Intergenic
1111616137 13:90663979-90664001 GACGGGGGGAGGAGCCAAGATGG + Intergenic
1111778359 13:92691574-92691596 AATTGAGGGAGGAGCCAAGATGG - Intronic
1111782917 13:92752472-92752494 GATGGGGGGAGGAGCCAAGATGG + Intronic
1111999452 13:95196490-95196512 CAATGAGGGAGGAGCCCTCATGG - Intronic
1112113909 13:96332190-96332212 AATGGGGGGAGGAGCCAAGATGG - Intronic
1112383937 13:98920162-98920184 AAGGAGGGGAGGAGTCCAGAAGG + Intronic
1113051099 13:106213537-106213559 AATGGGGGGAGGAGCCAAGATGG + Intergenic
1113557750 13:111252093-111252115 CACTGGGGCAGAAGCCTAGATGG + Intronic
1113780491 13:112974014-112974036 CAGTGGGGGATGGGGTCAGAGGG - Intronic
1114003869 14:18289846-18289868 CGGAGGAGGAGGAGCCAAGATGG - Intergenic
1114425834 14:22621746-22621768 CACTTGGGGTGGAGCCAAGATGG - Intergenic
1114869256 14:26635281-26635303 TTTTGGGGGAGGAGCCAAGATGG - Intergenic
1114872933 14:26679356-26679378 GGGTGGGGGAGGAGCCAAGATGG - Intergenic
1114982875 14:28188437-28188459 CAGGTTGGGAGGAGCCAAGATGG + Intergenic
1115158145 14:30363534-30363556 TTGAGGGGGAGGAGCCAAGATGG + Intergenic
1115186248 14:30690819-30690841 AAGTGGGCGAGGAGCCAAGATGG - Intronic
1115335460 14:32240737-32240759 CTGCAGGGGAGGAGCCAAGATGG - Intergenic
1115719907 14:36148672-36148694 AATGGGGGGAGGAGCCAAGATGG - Intergenic
1115832420 14:37356915-37356937 CCTGGGGGGAGGAGCCAAGATGG - Intronic
1115834026 14:37377274-37377296 CAGTAGGGGAGGAGGAAAGAGGG + Intronic
1115884536 14:37956441-37956463 CTATGGGGGAGGAGCCAAGACGG - Intronic
1116488863 14:45483151-45483173 CCGAGAGGGAGGAGCCAAGATGG - Intergenic
1116546138 14:46167264-46167286 GAGAGGGGGTGGAGCCAAGATGG - Intergenic
1116602276 14:46940896-46940918 GAGTTGGAGAGAAGCCCAGAAGG + Intronic
1116696670 14:48187079-48187101 CATTGGAGGAGGAGCCAAGATGG + Intergenic
1116711412 14:48372386-48372408 GAGAGGGGGAAGAGCCAAGATGG - Intergenic
1116836574 14:49774198-49774220 GAGTGGGCCAGGAGCCCAGAAGG - Intronic
1116933450 14:50713379-50713401 CAGTGAGGGAGGTGGCCAGGAGG + Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117349820 14:54870361-54870383 GGGTGGGGGTGGAGCCAAGATGG + Intronic
1117465860 14:55993322-55993344 CAAGAGGGGAGGAGCCAAGATGG - Intergenic
1117479697 14:56130139-56130161 CCTTGGGGGAGGTCCCCAGAGGG + Intronic
1117531877 14:56667524-56667546 GATGGGGGGAGGAGCCAAGATGG + Intronic
1117598096 14:57344100-57344122 CCGGCGGGGAGGAGCCAAGATGG - Intergenic
1117644870 14:57841233-57841255 TGATGGGGGAAGAGCCCAGAGGG + Intronic
1117948939 14:61061130-61061152 ACTTGGGGGAGGAGCCAAGATGG - Intronic
1118606690 14:67509190-67509212 CAGTAGGGAAGTAGACCAGATGG - Intronic
1118708480 14:68501240-68501262 AAGTCTGGGAGGAGGCCAGAGGG - Intronic
1118955190 14:70475200-70475222 TTCTGGGGGAGGAGCCAAGATGG + Intergenic
1119156423 14:72415669-72415691 CCGGGGGGGTGGAGCCAAGATGG - Intronic
1119189431 14:72670361-72670383 CGGAGGAGGAGGAGCCCAGGAGG + Exonic
1119204343 14:72782999-72783021 CAGTGAGGATGGAGCCCAGCGGG - Intronic
1120157871 14:81114162-81114184 CTGGGGGGGAGGAGCCAAGATGG + Intronic
1120273783 14:82347546-82347568 GGATGGGGGAGGAGCCAAGATGG + Intergenic
1120505821 14:85352850-85352872 CAGACGGGGCGGATCCCAGACGG + Intergenic
1121665875 14:95671744-95671766 CAGAGGAGGAGGAGGACAGAGGG + Intergenic
1122144263 14:99679934-99679956 CAGTGGGGGAGGAGGGGCGAGGG - Exonic
1122276838 14:100594984-100595006 TGGTGAGGAAGGAGCCCAGATGG - Intergenic
1122772601 14:104104016-104104038 AGGTGGGAGAGGAGCCAAGAAGG - Intronic
1124152508 15:27193854-27193876 AAGCGGGGGAGGAGCCAAGATGG - Intronic
1124584779 15:30994417-30994439 CAGTCAGGGAGGAGGGCAGAGGG + Intergenic
1124715023 15:32051784-32051806 TACTTGGGGAGGAGCCAAGATGG - Intronic
1125226867 15:37405458-37405480 CCCTGGGGGAGGAGCCAAGATGG - Intergenic
1125228678 15:37427153-37427175 TATGGGGGGAGGAGCCAAGATGG + Intergenic
1125848220 15:42878593-42878615 GAGTGGGGGAGGAGAGCAGCTGG - Exonic
1126298154 15:47165529-47165551 TTCTGGGGGAGGAGCCAAGATGG + Intergenic
1126505077 15:49395980-49396002 CTGGGGGCGAGGAGCCAAGATGG + Intronic
1126537738 15:49784500-49784522 TAAGGGGGGAGGAGCCAAGATGG - Intergenic
1126542571 15:49839349-49839371 CGGGGGGGGTGGAGCCAAGATGG - Intergenic
1126677543 15:51173497-51173519 ATTTGGGGGAGGAGCCAAGATGG + Intergenic
1126721938 15:51590943-51590965 CAAGGGGGGTGGAGCCAAGATGG + Intronic
1126885164 15:53141457-53141479 TGTTGGGGGAGGAGCCAAGATGG - Intergenic
1127157258 15:56140610-56140632 TAGCGGGGAAGGAGCCAAGATGG - Intronic
1127172505 15:56317159-56317181 CAAGGGGGGAGGAGCCAAGATGG - Intronic
1127348422 15:58125728-58125750 TACTGGGGGAGGAGCCAAGATGG + Intronic
1129060014 15:72853246-72853268 CAGTGGAGGAGGGGCCCGGCAGG + Intergenic
1129132668 15:73514452-73514474 TGGCGGGGGAGGAGCCAAGATGG - Intronic
1129150402 15:73684586-73684608 CAGGGGAGCAGGAGCCCGGAGGG - Intronic
1129183415 15:73891427-73891449 CAGTGGGGGAGGCGCAGTGAGGG + Intergenic
1129931076 15:79411776-79411798 CAGCCTGGGTGGAGCCCAGAGGG + Intronic
1129940447 15:79491800-79491822 AACAGGGGGAGGAGCCAAGATGG - Intergenic
1130218324 15:81995163-81995185 CGGGGGGGGAGGAGCCAAGATGG + Intergenic
1130274440 15:82469180-82469202 CAGTGGGGTTGGAGCCCTGGTGG + Intergenic
1130326928 15:82888902-82888924 CTGGTGGGGAGGAGCCAAGATGG - Intronic
1130466787 15:84196554-84196576 CAGTGGGGTTGGAGCCCTGGTGG + Intergenic
1130497477 15:84476982-84477004 CAGTGGGGTTGGAGCCCTGGTGG - Intergenic
1130589082 15:85201147-85201169 CAGTGGGGTTGGAGCCCTGGTGG + Intergenic
1130818202 15:87463735-87463757 AAGGGGGGGAGGAGCCAAGATGG + Intergenic
1130888141 15:88110906-88110928 CCATGTGGGAGGAGCCCAGATGG + Intronic
1130908177 15:88254324-88254346 CAGTGGGGGAGAGGCACAGTTGG + Intronic
1131584135 15:93675396-93675418 TATTGGAGGAGGAGCCAAGATGG + Intergenic
1131799300 15:96053109-96053131 CCGTGGGGGACGAGACCCGATGG - Intergenic
1132584669 16:700933-700955 GAGTGGGGGAGAAGCCGGGAAGG + Intronic
1132643885 16:990019-990041 CAGGGGGGCAGGAGCCCTCAGGG + Intergenic
1133507199 16:6423683-6423705 CAGTGGAGGAGCAGCACTGATGG + Intronic
1133860507 16:9590504-9590526 ATCTGGGGGAGGAGCCAAGATGG - Intergenic
1134250366 16:12569730-12569752 CACTGGAGGAGGAGCCCTGGGGG - Exonic
1134452145 16:14370180-14370202 CAGTGGGGGAGGACTCAGGAGGG + Intergenic
1134767700 16:16775181-16775203 CAGTGGGGGAGGTTCCAAGATGG - Intergenic
1135112917 16:19704678-19704700 CAAAGGAGGAGGTGCCCAGAAGG + Exonic
1135402822 16:22178078-22178100 CAGGGGAGGAGCAGCCCACAGGG - Intronic
1136281378 16:29213427-29213449 CAGTGGGAGAGGAAGCCAAAGGG - Intergenic
1136489625 16:30598348-30598370 CAATGTGGGATGTGCCCAGATGG + Intergenic
1136889517 16:33958594-33958616 TGGCGGGGGAGGAGCCAAGATGG - Intergenic
1137081868 16:36071919-36071941 CAGAGAGGGAGGAGTCAAGATGG + Intergenic
1137235083 16:46609919-46609941 TGGTGGGGGAGGAGAGCAGAGGG - Intronic
1137547680 16:49415719-49415741 CAGAGGGAGGGGAGGCCAGAGGG + Intergenic
1137800088 16:51255034-51255056 AAGTCGGGGTGGAGCCAAGATGG - Intergenic
1138258887 16:55598794-55598816 AAGAGGGGGAGGAGCCAAGATGG + Intergenic
1138722268 16:59096416-59096438 CACAGGGGGTGGAGCCAAGATGG + Intergenic
1138762906 16:59565301-59565323 GTGAGGGGGAGGAGCCAAGATGG - Intergenic
1138796530 16:59976598-59976620 AACAGGGGGAGGAGCCAAGATGG + Intergenic
1139649688 16:68356073-68356095 CACTGGTGGAGGAGCCAGGAAGG + Intronic
1139709308 16:68763627-68763649 AAGTGGGGGAGGAGGGCCGAGGG - Intronic
1140134928 16:72197601-72197623 CAGTGGAGGAGGAGGGCAGCCGG - Intergenic
1140173017 16:72627271-72627293 AACAGGGGGAGGAGCCAAGATGG + Intergenic
1140308918 16:73830413-73830435 TGGAGGGGGAGGAGCCAAGATGG - Intergenic
1141163556 16:81645263-81645285 GAGTGGAGGAGGACCCCACAGGG - Intronic
1141598746 16:85112743-85112765 AAGGGAGGGAGGAGCCCAGTGGG - Intergenic
1141760583 16:86026240-86026262 CAGTGGGGGAGGCAGGCAGAGGG + Intergenic
1141794563 16:86262162-86262184 GAATTGGGGAGGAGCCAAGATGG + Intergenic
1142085748 16:88179355-88179377 CAGTGGGAGAGGAAGCCAAAGGG - Intergenic
1142272702 16:89099009-89099031 CAGTGGCAGCAGAGCCCAGAGGG + Intronic
1142917448 17:3153392-3153414 CTCTTGGGGAGGAGCCAAGATGG - Intergenic
1143258934 17:5584146-5584168 AGGGGAGGGAGGAGCCCAGAGGG + Intronic
1143504156 17:7354787-7354809 CAGTGGGGGAGGAGATGGGAAGG + Exonic
1144312482 17:14025500-14025522 CAGTGGGTGAGGGGACCAGGAGG + Intergenic
1144332270 17:14235825-14235847 CAGTGGGTGAGGGGACCAGGAGG - Exonic
1144685417 17:17222943-17222965 CAGGTGGGGAGCAGCGCAGATGG - Intronic
1144801001 17:17927209-17927231 CAATGGGGGTGGAGTCCAAAGGG + Intronic
1145724497 17:27105158-27105180 CCACGGGGGAGGAGCCAAGATGG - Intergenic
1146420887 17:32684254-32684276 AGATGGGGGAGGAGCCAAGATGG - Intronic
1146426266 17:32742274-32742296 CAGTGGAGGAGGGTACCAGATGG + Intronic
1146440149 17:32886925-32886947 CAGTGAGGGTGTAGCACAGAGGG - Intergenic
1146797752 17:35795004-35795026 CAGACGGGCAAGAGCCCAGAGGG - Intronic
1147169443 17:38609417-38609439 GGGTGGGGGAGGAGCCAAGGAGG + Intergenic
1147214715 17:38892485-38892507 CAGAGGTGGAGGGGCTCAGAAGG + Intronic
1147443767 17:40462678-40462700 GGGTGGGGGACAAGCCCAGAGGG + Intergenic
1147537896 17:41332854-41332876 CAGTGGGGAGGGGGCCGAGAAGG - Intergenic
1147581864 17:41631572-41631594 CACGGAGGGAGGGGCCCAGAAGG + Intergenic
1148157267 17:45431440-45431462 AAGTGGCGGAGGAGCCCTGCTGG - Intronic
1148216717 17:45837392-45837414 CAGGGGTGGAGGAGCCGAGAGGG + Intergenic
1148740037 17:49887563-49887585 AAGTAGGGGAGGGGACCAGAAGG - Intergenic
1148795328 17:50194232-50194254 AGGTGGGGGAGGACTCCAGAGGG + Intronic
1148953273 17:51333079-51333101 CAGGGGCGGAGGAGCCAAGATGG - Intergenic
1149323014 17:55501712-55501734 CATTCGGGGAGGAGCCAAGATGG + Intergenic
1149341236 17:55688210-55688232 CATTGTGGGAGGAACCCAGTGGG + Intergenic
1149577155 17:57722341-57722363 AAGTGTGGGGGAAGCCCAGAAGG - Intergenic
1149961026 17:61110226-61110248 TATGGGGGGAGGAGCCAAGATGG + Intronic
1150627232 17:66849344-66849366 CAGAGGAGGAGGAGGCCAGCAGG + Intronic
1150901420 17:69282289-69282311 CAGTGGAGAAGGAGCCAAGAGGG - Intronic
1151318303 17:73337347-73337369 CAGAGGCACAGGAGCCCAGAGGG - Exonic
1151434049 17:74083172-74083194 AAGTGTGGCAGCAGCCCAGATGG + Intergenic
1151744527 17:76004843-76004865 CTGTGGTGGAGTAGCCCAGCTGG - Intronic
1152242595 17:79168099-79168121 CAGAGGCTAAGGAGCCCAGAGGG + Intronic
1152437372 17:80284701-80284723 CAGTGGGGGAGCCGTCCGGAAGG - Intronic
1152559516 17:81070919-81070941 CAGTGGGGGTGGATGACAGAAGG + Intronic
1152933082 17:83120141-83120163 GATTGGGGGAGGGGCTCAGAGGG + Intergenic
1153164535 18:2247164-2247186 CTGAGGGGGAGGAGCCAAGATGG + Intergenic
1153221522 18:2866325-2866347 TAGAGGGGAAGGAGCCAAGATGG - Intronic
1153429828 18:5004133-5004155 CCGGGGGGGAGGAGCCAAGATGG + Intergenic
1153494551 18:5684664-5684686 TTGTTGGGGAGGAGCCAAGATGG + Intergenic
1154185756 18:12181634-12181656 CTCTGGGGGAGAAGCCAAGATGG + Intergenic
1155986295 18:32233928-32233950 AGGAGGGGGAGGAGCCAAGATGG - Intronic
1156044547 18:32862666-32862688 GTATGGGGGAGGAGCCAAGATGG - Intergenic
1156235995 18:35205776-35205798 AATTGGGGGAGGAGCCAAGATGG + Intergenic
1156292464 18:35760305-35760327 AAGGGGGGGAGGAGCCAAGATGG + Intergenic
1156327200 18:36085328-36085350 CTGTGGGGGAGCAGCACAGTTGG + Intergenic
1156531325 18:37819734-37819756 AAGAGAGGGAGGAGCCAAGATGG + Intergenic
1156731062 18:40193641-40193663 AATTAGGGGAGGAGCCAAGATGG - Intergenic
1157039810 18:44024808-44024830 TATAGGGGGAGGAGCCAAGATGG - Intergenic
1157158236 18:45288394-45288416 CAGTGGGGCAGGAGCAACGATGG + Intronic
1157181863 18:45505428-45505450 GAGTGGGTGAGGAGCCCACAGGG + Intronic
1157217806 18:45800191-45800213 CTGTGGAGGTGGAGCCAAGATGG - Intergenic
1158965859 18:62621725-62621747 CAGCTGGGGACGAGGCCAGAAGG + Intergenic
1158994662 18:62906289-62906311 TATTGGGGGAGGAGCCAAGATGG + Intronic
1159631389 18:70752563-70752585 CACCGGGGGAGGAGCCAAGATGG - Intergenic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1160399081 18:78596068-78596090 CAGTGTGGGTGGAGCCCTGCTGG + Intergenic
1160567055 18:79792773-79792795 CAGTGCGGGAGGAGCTCCCACGG - Intergenic
1160865396 19:1253851-1253873 CAGAGGGGGCGGGGCCCAGCTGG - Intronic
1160880284 19:1316541-1316563 CAGTAGGGGGGGAACCCAGACGG - Intergenic
1161407662 19:4099427-4099449 CAGGGAGGAAAGAGCCCAGAGGG + Intronic
1161702699 19:5804172-5804194 CCGTCGGGGAGGAGCCCGGGTGG + Intergenic
1162962414 19:14136060-14136082 CAGTGGGGGAAGAGGCCACTGGG + Intronic
1162962441 19:14136132-14136154 CAGTGGGGGAGGAGGTCACGGGG + Intronic
1163212655 19:15852544-15852566 GAGAAGGGGAGAAGCCCAGAGGG - Intergenic
1163406478 19:17126188-17126210 CAGAGGGGGCGGAGGCCAGCAGG - Intronic
1163834054 19:19562703-19562725 GAGTGTGGGAGCAGCTCAGACGG + Intronic
1163851712 19:19668222-19668244 CTGTGGGGGAGCAGCCCAGCAGG - Intergenic
1163888175 19:19988027-19988049 TGGTGGGGGTGGGGCCCAGATGG + Intergenic
1164159502 19:22617386-22617408 CACTGAGGGAGGAGCCTGGAAGG + Intergenic
1164246700 19:23436269-23436291 TAGGGTGGGAGGAGCCAAGATGG - Intergenic
1164552803 19:29225776-29225798 TGGTGGGGGAGGAGCCAAGATGG + Intergenic
1164584601 19:29459286-29459308 AATTAGGGGAGGAGCCAAGATGG + Intergenic
1164632137 19:29768827-29768849 CAGTGGCTGAGGTGCCCTGAGGG + Intergenic
1164840023 19:31386299-31386321 CATTTGGGGAGGAGCCCAGCTGG - Intergenic
1165261044 19:34618141-34618163 ATGCGGGGGAGGAGCCAAGATGG - Intronic
1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG + Intergenic
1165714759 19:38037203-38037225 CTCTGGCAGAGGAGCCCAGAGGG + Intronic
1166219612 19:41355995-41356017 CAGTATGGCTGGAGCCCAGACGG + Intronic
1166489692 19:43248087-43248109 AACTGGGGAAGGAGCCAAGATGG - Intronic
1167043244 19:47035264-47035286 ATGAGGGGGCGGAGCCCAGAGGG + Intronic
1167251138 19:48398931-48398953 CAGCGGGGGCGGGGCCTAGAGGG + Intronic
1167348482 19:48961439-48961461 CAGGGACGGAGGAGGCCAGAAGG - Exonic
1167623168 19:50569702-50569724 CAGGGGCGGAGAAACCCAGAAGG + Intergenic
1168062875 19:53903225-53903247 CAGTTAGAAAGGAGCCCAGAAGG + Intronic
1168132731 19:54331673-54331695 CTGTGGGAGAGGAGACCACAGGG + Intergenic
1168438048 19:56337718-56337740 CAGGGCGGGTGGAGCCAAGATGG - Intronic
1168641577 19:58034621-58034643 CAGTGGGGGATGGGCCCAAGGGG - Intronic
1168651163 19:58093195-58093217 CAGTGGGGGAGGCGGTCAGTAGG - Intronic
925443689 2:3909625-3909647 AAGTGTGGGAGGGACCCAGAGGG - Intergenic
925470659 2:4157805-4157827 GGGGGGGGGAGGAGCCAAGATGG + Intergenic
925520008 2:4733726-4733748 CACCGAGGGAGGAGCCAAGATGG + Intergenic
926230751 2:11002118-11002140 CTGGGGAGGAGGAGCCAAGATGG - Intergenic
926601228 2:14848061-14848083 TTGAGGGGGAGGAGCCAAGATGG + Intergenic
926700273 2:15798871-15798893 TAGTGGGAGATGAGGCCAGAAGG - Intergenic
926755899 2:16235575-16235597 TACGGGGGGAGGAGCCAAGATGG - Intergenic
926929073 2:18018006-18018028 AGCTGGGGGAGGAGCCAAGATGG - Intronic
926962846 2:18377879-18377901 CAGTTGGGGAGGAGCACAAATGG + Intergenic
927175029 2:20399741-20399763 TAGTGGGGGGTGATCCCAGATGG + Intergenic
927190869 2:20516073-20516095 CAGTGTGGGAGCAGGGCAGAGGG + Intergenic
927334828 2:21909326-21909348 TTATGGGGGAGGAGCCAAGATGG - Intergenic
927354339 2:22156439-22156461 ATCTGGGGGAGGAGCCAAGATGG + Intergenic
927495511 2:23549158-23549180 CAGGAGGGGAGGACCCCAGCGGG + Intronic
927502868 2:23593899-23593921 CAGGGAGGGAGGGGCCCTGAAGG - Intronic
927880859 2:26689107-26689129 CAGAGGGAGAGGGGCACAGATGG - Intergenic
929248083 2:39724125-39724147 CTGTGGGGGAAGTGCCAAGAAGG - Intergenic
929649781 2:43666482-43666504 TGTTGGGGGAGGAGCCAAGATGG - Intronic
929951936 2:46418464-46418486 CAGGATGGGAGGAGCCAAGATGG + Intergenic
930911750 2:56637374-56637396 GGGTGGGGGAGGAGCCAAGATGG - Intergenic
931210407 2:60189020-60189042 AAAGGGGGGAGGAGCCAAGATGG + Intergenic
931249382 2:60516487-60516509 CACTGGGAGAGGAGCCAAGAGGG + Intronic
931498216 2:62835475-62835497 AAGCGGGGGAGGAGCCAAGATGG + Intronic
931694234 2:64859897-64859919 CAGCGGGGGCGGCGCCGAGAGGG + Intergenic
932320536 2:70819321-70819343 CAGTGGGGGTGGGGTGCAGAGGG - Intronic
932483372 2:72063972-72063994 TACTGGGGGAGGAGCCAAGATGG + Intergenic
932999539 2:76904878-76904900 TCTTGGGGGAGGAGCCAAGATGG + Intronic
933335573 2:80954477-80954499 CAGTGAAGGAGCAGACCAGAAGG + Intergenic
933519001 2:83347470-83347492 CAGGAGGGGAGGAGCCAAGATGG + Intergenic
933550315 2:83768299-83768321 TGGGGGGGGAGGAGCCAAGACGG + Intergenic
934781013 2:96969754-96969776 CCGGGTCGGAGGAGCCCAGAGGG + Intronic
935300569 2:101690355-101690377 CACTGGGGGAAGAGACCAGCAGG - Intergenic
935739100 2:106130889-106130911 CTGGGGGGGAGGAGCCAAGATGG + Intronic
935938198 2:108209249-108209271 AATTGGGGGTGGAGCCAAGATGG - Intergenic
936079330 2:109421644-109421666 CCCTGGGGGAGAAGCCCAGAGGG - Intronic
936573843 2:113637363-113637385 CAGTGGTGCAGGAGCACACACGG - Intronic
937809541 2:126184046-126184068 GAATGAGGGAGGAGCCAAGATGG - Intergenic
937866141 2:126753050-126753072 CAGGGGCCGAGGAGACCAGAGGG + Intergenic
937915403 2:127096507-127096529 CAGCGGGGGAGCAGCCCCAAGGG + Intronic
938149004 2:128864998-128865020 TAGCGGAGGAGGAGCCAAGATGG - Intergenic
938205470 2:129417383-129417405 AAATAGGGGAGGAGCCAAGATGG - Intergenic
938375227 2:130800519-130800541 CAGGGTGGGAGGAGCCAAGAGGG + Intergenic
938379258 2:130827412-130827434 CAGTGGAGGAGGAGCCACGAAGG - Intergenic
938534853 2:132231322-132231344 CGAAGGGGGAGGAGCCAAGATGG + Intronic
938595693 2:132785111-132785133 CAGAGGGAGAGGGGCCCACAGGG - Exonic
938659486 2:133471020-133471042 CAGGGGGGGAGGAGCCAAGATGG - Intronic
938972911 2:136448623-136448645 CAGTGGAGGCTGAGCCCAGCAGG + Intergenic
939051738 2:137315516-137315538 TAGTGGGGGAGGAGCCAAGATGG - Intronic
939096199 2:137836401-137836423 CAGTGCTGGAGGTGCCCACAAGG - Intergenic
939148779 2:138448374-138448396 CAGTTGGGCAGGAGATCAGAAGG + Intergenic
939239448 2:139538957-139538979 CCCGGGGGGAGGAGCCAAGATGG - Intergenic
939486063 2:142812275-142812297 ATGAGGGGGAGGAGCCAAGATGG - Intergenic
939487998 2:142841354-142841376 CAGTTGGAGAGGAAGCCAGAAGG - Intergenic
939572802 2:143860953-143860975 TCCTGGGGGAGGAGCCAAGATGG + Intergenic
939890126 2:147727000-147727022 CACTAGGGGAGGAGCCAAGATGG + Intergenic
939893598 2:147766519-147766541 CAAGGGGGGTGGAGCCAAGATGG + Intergenic
940085111 2:149850454-149850476 CAAGGAGGGAGGAGCCAAGATGG + Intergenic
940095092 2:149965730-149965752 AATTGGGGGTGGAGCCAAGATGG + Intergenic
940380876 2:153013780-153013802 TAGGGCGGGAGGAGCCAAGATGG - Intergenic
940441252 2:153719444-153719466 TATGGGGGGAGGAGCCAAGATGG + Intergenic
940465827 2:154025298-154025320 CATGGGGGGAGGAGCCAAGATGG - Intronic
940573729 2:155472626-155472648 CAGAGGGGGAGGAGCCAAGATGG - Intergenic
940741538 2:157515139-157515161 AATTAGGGGAGGAGCCAAGATGG + Intergenic
940835939 2:158522614-158522636 TGGAGGGGGAGGAGCCAAGATGG + Intronic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
941458471 2:165737676-165737698 ATGCGGGGGAGGAGCCAAGATGG - Intergenic
941781738 2:169452778-169452800 AAATGGGGGTGGAGCCAAGATGG + Intergenic
942214535 2:173705392-173705414 AGTTGGGGGAGGAGCCAAGATGG - Intergenic
942220103 2:173760460-173760482 CTGTGGGGCCGGAGCCCCGAGGG - Intergenic
942378456 2:175361498-175361520 AAGTAGGGGAGGAGCCCTGAAGG + Intergenic
942734419 2:179093542-179093564 TTGGGGGGGAGGAGCCAAGATGG - Intergenic
942742450 2:179195939-179195961 GAATGTGGGAGGAGCCAAGATGG + Intronic
942759898 2:179385753-179385775 CAGAGGGGGAGGAGCCAAGATGG + Intergenic
942977135 2:182031221-182031243 TATAGGGGGAGGAGCCAAGATGG - Intronic
943153125 2:184138781-184138803 CAGCTGGTGTGGAGCCCAGAGGG - Intergenic
943309929 2:186312989-186313011 CAGAGGGGGCGGAGCCAAGATGG + Intergenic
943566862 2:189526239-189526261 CCCTGGGGGAGGAGCCAAGATGG - Intergenic
943775502 2:191761846-191761868 TTGAGGGGGAGGAGCCAAGATGG + Intergenic
944030404 2:195228432-195228454 ACATGGGGGAGGAGCCAAGATGG + Intergenic
944257725 2:197640743-197640765 TCCTGGGGGAGGAGCCAAGATGG - Intronic
944262610 2:197693543-197693565 ATTTGGGGGAGGAGCCAAGATGG - Intronic
944971421 2:204997089-204997111 GAGGAGGGGAGGAGCCAAGATGG - Intronic
945379898 2:209128526-209128548 TCTAGGGGGAGGAGCCCAGATGG + Intergenic
945429927 2:209752190-209752212 TGGTGGGGGAGGAGCCAAGATGG - Intergenic
945430231 2:209755257-209755279 TAGTCTGCGAGGAGCCCAGAAGG + Intergenic
945550768 2:211219317-211219339 AAGAGGGGGAGGAGCCAAGATGG + Intergenic
945733878 2:213573245-213573267 GAGAAGGGGAGGAGCCAAGATGG - Intronic
945743424 2:213691027-213691049 CAGTGACGGAGGAGCCCTGAAGG + Intronic
946330723 2:219007606-219007628 AATTGGGGGAGGAACCAAGAAGG + Intronic
946468224 2:219931815-219931837 GTTTGGGGGAGGAGCCAAGATGG + Intergenic
946626004 2:221613028-221613050 CAGTGAGAGAGGAGGCCAGCAGG + Intergenic
947718789 2:232355235-232355257 ATGGGGGGGAGGAGCCAAGATGG + Intergenic
948189184 2:236045146-236045168 CAATGGGGGAGGATCGCCGAAGG - Intronic
948218357 2:236249264-236249286 CATTGTGGGAGGAGAGCAGAAGG - Intronic
948436266 2:237956232-237956254 GAGTGGGGGCGGAGCCAAGAAGG + Intergenic
948459967 2:238124299-238124321 CAGTGGGGGAGGTGCCCAGAGGG + Intronic
948525810 2:238570166-238570188 CAGTGGGGGAGGAGGTCCCAGGG + Intergenic
948630246 2:239297726-239297748 CAGGTGGGGCTGAGCCCAGAGGG - Intronic
948820798 2:240544491-240544513 TGGGGGGGGAGGAGCCAAGATGG + Intronic
1168735248 20:129961-129983 TCTTGGGGGAGGAGCCAAGATGG + Intergenic
1169027570 20:2383468-2383490 TAGTTGGGGAGGAGGTCAGAGGG + Intronic
1169714611 20:8601109-8601131 GACAGGGGGAGGAGCCAAGATGG - Intronic
1170327345 20:15171296-15171318 CAGTGGTGGAGGAGGAGAGATGG - Intronic
1170400556 20:15978532-15978554 CTGTGGTGGAGCAGCCCAGCAGG + Intronic
1171053931 20:21887652-21887674 CTTGGGGGGAGGAGCCAAGATGG + Intergenic
1171057014 20:21916864-21916886 CCCTTGGGGAGGAGCCAAGATGG - Intergenic
1171469747 20:25360840-25360862 CAGTGAGGTAGAAGCCCAGACGG - Intronic
1171569343 20:26233674-26233696 TTCTGGGGGAGGAGCCAAGATGG + Intergenic
1171748272 20:29021936-29021958 TGGGGGGGGAGGAGCCAAGAAGG + Intergenic
1171791042 20:29525903-29525925 AATGGGGGGAGGAGCCAAGATGG + Intergenic
1171936591 20:31280085-31280107 CAGCCGGTGTGGAGCCCAGAGGG + Intergenic
1172304684 20:33872415-33872437 CATTGGGGGAGATGCCCAGGAGG + Intergenic
1172386146 20:34535475-34535497 CATTCTGGGAGGAGCCCACAAGG + Intronic
1172443407 20:34980742-34980764 CGGTTGGGGAGGAGTCCAGGCGG - Intronic
1172834219 20:37862674-37862696 CAGTGGGGGAGAAAAACAGAGGG - Intronic
1173536085 20:43814457-43814479 CCCTCGGGGAGGAGCCAAGATGG + Intergenic
1173672777 20:44809986-44810008 CCCTGGGGGAGAAGGCCAGAAGG + Intronic
1173850258 20:46213248-46213270 CAGTGGGGGAGGGGACAAGGGGG + Intronic
1173965436 20:47109024-47109046 CAGGCGGGGAGGAGCACAGTAGG + Intronic
1174181977 20:48680663-48680685 CAGTGAGGGAGGGACCCAGGTGG - Intronic
1174789134 20:53461548-53461570 AGGAGGGGGAGGAGCCAAGATGG - Intronic
1175091269 20:56506529-56506551 CAGTAGGGGAAGTGCCAAGAGGG - Intronic
1175222511 20:57425535-57425557 CAGCTGGGGAGGGGCCCAGATGG + Intergenic
1175802183 20:61807141-61807163 CAGTGGGGCAGGTGCCGGGAGGG + Intronic
1175843042 20:62042552-62042574 CTGTGGGGCGGGAGCCCAAAAGG + Intronic
1175942788 20:62545655-62545677 CAGTGGGGGAGGTGCACGGCAGG - Intergenic
1176053870 20:63134629-63134651 CAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176053893 20:63134682-63134704 CAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176054030 20:63134983-63135005 CAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176054133 20:63135230-63135252 CAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176054156 20:63135283-63135305 CAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176054197 20:63135371-63135393 CAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176054253 20:63135495-63135517 CAGGGGAGGCGGGGCCCAGAGGG + Intergenic
1176349936 21:5785136-5785158 GAGAGGGGGTGGAGCCAAGATGG + Intergenic
1176356750 21:5905720-5905742 GAGAGGGGGTGGAGCCAAGATGG + Intergenic
1176544257 21:8183206-8183228 GAGAGGGGGTGGAGCCAAGATGG + Intergenic
1176563208 21:8366251-8366273 GAGAGGGGGTGGAGCCAAGATGG + Intergenic
1176757876 21:10739640-10739662 CACTGGAGGAGGAGCCAAGATGG + Intergenic
1176861570 21:14014036-14014058 CAGATGGGGAGGCCCCCAGAGGG + Intergenic
1176941070 21:14927079-14927101 GAGAGGGGGAGGAGCCAAGATGG + Intergenic
1177137983 21:17327479-17327501 CAATGGGGGAGGAGCCAAGATGG + Intergenic
1178770551 21:35499773-35499795 GAGGGGGGGAGGAGCCAAGATGG - Intronic
1178894920 21:36550342-36550364 CAGGGGGAGAGGAGCCAAGTTGG - Intronic
1178965061 21:37109072-37109094 CGGTAGGGGTGGAGCCAAGATGG + Intronic
1179232644 21:39519155-39519177 CAGTTGGGGAGGGGCTCAGGTGG + Intergenic
1179292778 21:40033158-40033180 CTGGGGGGGAGGAGCCAAGATGG + Intronic
1179725134 21:43337766-43337788 CAGAGGTGAAGGAGCCTAGAGGG - Intergenic
1180120598 21:45745067-45745089 CAGTGGAGAAGGTGCCCAGAGGG + Intronic
1180175152 21:46083702-46083724 CAGAGCGGGAGGGGCCCAGAGGG + Intergenic
1180395035 22:12323600-12323622 GTGGGGGGGAGGAGCCAAGAAGG - Intergenic
1180404705 22:12541148-12541170 GTGGGGGGGAGGAGCCAAGAAGG + Intergenic
1181172410 22:21017110-21017132 CAGTAAGGGAGGAGGCGAGAGGG - Intronic
1181630664 22:24149499-24149521 CAGTGGGGGAGAAGGTGAGATGG + Intronic
1182209521 22:28663280-28663302 AAGAGAGGGAGGAGCCAAGATGG + Intronic
1182244280 22:28943199-28943221 CACTGGGGGAGGACCCCCGGGGG - Intronic
1182333716 22:29569288-29569310 CTGTGGGGGAGGTGCAGAGAGGG + Intronic
1182585384 22:31341743-31341765 CAGAGTAGGAGGAGCCCAGAGGG - Intronic
1182696145 22:32200463-32200485 CAGTGGGATAGTAGCCCAGGGGG + Intronic
1182985046 22:34708283-34708305 CAGTGGGAGAGGAGCACAGAAGG - Intergenic
1183371083 22:37432910-37432932 CACAGGGGGTGGAGCCCAGGAGG + Intergenic
1183509542 22:38226895-38226917 GTGTGGAGGAGGAGCACAGAAGG + Intronic
1184206792 22:43009664-43009686 CAGAGGGGGAGGAGCGTGGATGG - Intronic
1184398503 22:44259984-44260006 TGGTGGGGGAGAATCCCAGAGGG - Intronic
1184523619 22:45009314-45009336 CAGGCGGAGGGGAGCCCAGAAGG + Intronic
1184668420 22:46000609-46000631 CAGGGAGGCAGGAGCCCAGCTGG - Intergenic
1184670588 22:46010545-46010567 AGGTGGGGTAGGAGCCGAGAGGG - Intergenic
1184727697 22:46356221-46356243 CACTGTGGGAGGAGCCCCCAGGG - Intronic
1184936241 22:47724392-47724414 CAGTTGGGGATGAGACCAGTTGG - Intergenic
1185131985 22:49044528-49044550 GAATGGGGGAGGAGAACAGATGG - Intergenic
1185416864 22:50715376-50715398 GGGTGGGGGAGGAGCCTAGAAGG - Intergenic
1203249126 22_KI270733v1_random:99444-99466 GAGAGGGGGTGGAGCCAAGATGG + Intergenic
949425297 3:3909459-3909481 CACTTGAGGAGGAGCCAAGATGG - Intronic
949429752 3:3963071-3963093 GAGTCTGGGAGGAGCCAAGATGG + Intronic
949457321 3:4253245-4253267 AATAGGGGGAGGAGCCAAGATGG + Intronic
949717613 3:6951172-6951194 GACTGGGGGTGGAGCCAAGATGG - Intronic
949873878 3:8611521-8611543 AAGTGGGGGAGCAGCCAAGATGG + Intergenic
949888724 3:8716073-8716095 AACGGGGGGAGGAGCCAAGATGG + Intronic
949960069 3:9304660-9304682 CGGAGGGGGAGAAGCCCAAATGG - Intronic
950330483 3:12152383-12152405 CAGAGGCTGAGGAGCCCTGAGGG + Intronic
950544323 3:13629706-13629728 AAGTGGGAGAGGGACCCAGAAGG - Intronic
950597286 3:13995843-13995865 CAGGAGGGGAGGAGCCAAGATGG - Intronic
950681533 3:14588534-14588556 CAGTGAGGCTGGACCCCAGAAGG - Intergenic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
951198804 3:19855045-19855067 CATCGGGGGAGGAGCCAAGATGG + Intergenic
951321984 3:21255737-21255759 TTGTGGGGGAGGAGCCAAGATGG - Intergenic
951330677 3:21364850-21364872 ATGTGGGGGAGGAGCCAAGACGG + Intergenic
951555507 3:23917103-23917125 AGGTGGGGGAGGAGCCCAAAAGG + Exonic
951572958 3:24084556-24084578 CATTGTCGGAGGAGCCAAGATGG - Intergenic
951592346 3:24280094-24280116 AACCGGGGGAGGAGCCAAGATGG + Intronic
951783506 3:26390749-26390771 CAGTGGGGGAGGAGCCAAGATGG - Intergenic
951818503 3:26783093-26783115 CACAGGGGGAGGAGCCAAGATGG + Intergenic
951938517 3:28051307-28051329 CAGTGAGGGGGAAGCCCAGGTGG + Intergenic
952331233 3:32366176-32366198 CAGTGTGGGGGGCGCACAGAGGG + Intronic
952547287 3:34433867-34433889 CCTTGGGGGAGGAGCCAAGATGG - Intergenic
952659272 3:35824674-35824696 TAATGGGGGAGGAGCCAAGATGG - Intergenic
953360053 3:42288059-42288081 AATTGGAGGAGGAGCCAAGATGG - Intergenic
953555729 3:43945624-43945646 TTGTAGGGGAGGAGCCAAGATGG - Intergenic
954185115 3:48911045-48911067 CACTGGGGAAGGAGCGTAGATGG + Intergenic
954373759 3:50183722-50183744 AAGCTGTGGAGGAGCCCAGATGG + Intronic
954497563 3:50979154-50979176 CACTGGGGGAGGAGCCAAGATGG - Intronic
954638654 3:52085230-52085252 TAGTGCAGGAGGAGCCCAGCTGG - Intronic
955255201 3:57324577-57324599 CCTGGGGGGAGGAGCCAAGATGG + Intronic
955816803 3:62852409-62852431 TGATGGGGGAGGAGCCAAGATGG - Intronic
955890478 3:63645167-63645189 TTTTGGGGGAGGAGCCAAGATGG + Intergenic
956465979 3:69521123-69521145 CAGTGAGGAGGGACCCCAGATGG + Intronic
956866549 3:73374597-73374619 AACTGGGGGAGGAGCCAAGATGG - Intergenic
957017317 3:75083172-75083194 GAGTGGGGGAGGAGCAGAGTGGG + Intergenic
957583970 3:82111024-82111046 AGGAGGGGGAGGAGCCAAGATGG - Intergenic
957601163 3:82337496-82337518 CTGCGGGGGAGGAGCCAAGATGG + Intergenic
957806252 3:85153068-85153090 CTGCGGGGGAGGAGCCAAGATGG + Intronic
957867030 3:86039078-86039100 CAGAGGGGGTGGAGCCAAGATGG + Intronic
957948893 3:87098373-87098395 CAGTGAGGGTGGAGCCAAGATGG - Intergenic
958488707 3:94745465-94745487 GAATTGGGGAGGAGCCAAGATGG + Intergenic
958704761 3:97641424-97641446 GGGTGGGGGAGGAGCCAAGATGG + Intronic
958835616 3:99141181-99141203 CCAGGGGGGAGGAGCCAAGATGG - Intergenic
959464140 3:106665290-106665312 CTCGGGGGGAGGAGCCAAGATGG + Intergenic
959617931 3:108369323-108369345 CACGGGGGGAGGAGCCAAGATGG + Intronic
959691169 3:109199869-109199891 CTCCGGGGGAGGAGCCAAGATGG + Intergenic
959891602 3:111562217-111562239 TATTCGGGGAGGAGCCAAGATGG - Intronic
960153729 3:114276888-114276910 CGGAGGGGGAGGAGCCAAGATGG + Intergenic
960545836 3:118914239-118914261 AAATCGGGGAGGAGCCAAGATGG + Intronic
960553989 3:119007472-119007494 ATCTGGGGGAGGAGCCAAGATGG - Intronic
961000463 3:123370815-123370837 AAGTGGGGGAGGAACGGAGAGGG - Intronic
961291437 3:125849807-125849829 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
961331936 3:126147617-126147639 CAGTGGGGCAGGAGTCAGGAGGG + Intronic
961349816 3:126292679-126292701 CAGTGGGGGAGGTGTCCATGGGG + Intergenic
961354921 3:126331601-126331623 GTGGGGGGGAGGAGCCAAGATGG + Intergenic
961694998 3:128698431-128698453 GAGCGGGTGAGGAGCCCAGCGGG - Intergenic
961804351 3:129478255-129478277 CACTGGGGGGGGAGCACAAATGG - Intronic
961895740 3:130166542-130166564 TAGCGGGGGTGGAGCCAAGATGG - Intergenic
962161551 3:133005644-133005666 CATGGGGGGAGGAGCCAAGATGG - Intergenic
962238476 3:133729793-133729815 ACGGGGGGGAGGAGCCAAGATGG - Intergenic
962258050 3:133885583-133885605 CAGAGAGGGAGGAGTCCGGAAGG + Intronic
962386465 3:134936413-134936435 CAGTGATGGAGGAGCCCAAGAGG + Intronic
962442997 3:135439842-135439864 ATGGGGGGGAGGAGCCAAGATGG - Intergenic
962443005 3:135439861-135439883 TATTTGGGGAGGAGCCAAGATGG - Intergenic
962635363 3:137325770-137325792 CAGAGGGGAAGGAGCCCCAAAGG + Intergenic
962648145 3:137460965-137460987 ATGGGGGGGAGGAGCCAAGACGG - Intergenic
963050806 3:141141461-141141483 CTGGGGGGGTGGAGCCAAGATGG - Intronic
963175142 3:142290200-142290222 CCCTGGTGGAGGAGCCAAGATGG + Intergenic
963954762 3:151241768-151241790 AATTAGGGGAGGAGCCAAGATGG + Intronic
964142556 3:153420243-153420265 CAGTCTGTGTGGAGCCCAGAAGG - Intergenic
964318463 3:155469059-155469081 AATAGGGGGAGGAGCCAAGATGG + Intronic
964399585 3:156284972-156284994 CCCCGGGGGAGGAGCCAAGATGG - Intronic
964563056 3:158019673-158019695 TGGGGGGGGAGGAGCCAAGATGG + Intergenic
964659221 3:159101376-159101398 TCTTGGGGGAGGAGCCAAGATGG - Intronic
964686164 3:159398334-159398356 GCGAGGGGGAGGAGCCAAGATGG - Intronic
965357505 3:167694584-167694606 CAGTGAGGGAAGATCCCAAAAGG - Intronic
965395416 3:168155417-168155439 AAGTGGAGGAGGAGCCCACATGG - Intergenic
965628795 3:170709333-170709355 TAGAGGGGAAGGAGCCCAGATGG - Intronic
966347748 3:178997819-178997841 CCGTGGGGTTGGAGCCCAAAAGG + Intergenic
967238410 3:187412119-187412141 AATTTGGGGAGGAGCCAAGATGG + Intergenic
967285193 3:187862477-187862499 CATGGGGGGAGGAGCCAAGATGG + Intergenic
967287794 3:187890217-187890239 CTCGGGGGGAGGAGCCAAGATGG + Intergenic
968545350 4:1195173-1195195 CGGTGGGGGCAGAGCCCAGGAGG - Intronic
968573249 4:1353460-1353482 CAGTGAGGGAGGAGCCTACCCGG - Intronic
968698605 4:2044262-2044284 CAGTGGTGCAGGAGCCTGGAGGG - Intergenic
968949670 4:3684028-3684050 CTGTGGGGGAGGTGCACAGCTGG - Intergenic
969005858 4:4019685-4019707 TAGTGGGGGTGGAGCCAAGATGG - Intergenic
969375470 4:6760726-6760748 CACTGAGAGAGGAGCCCAGGAGG - Intergenic
969669981 4:8584619-8584641 CAGTGGGGGAGGGGTCTTGAGGG + Intronic
969747034 4:9080575-9080597 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
969807091 4:9617605-9617627 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
969869984 4:10098587-10098609 CCTTGGGGGAGGTGCCCAGCTGG + Intronic
970168985 4:13269975-13269997 CAGTGGGGGAGGAGAAAAGGAGG - Intergenic
970169891 4:13278946-13278968 CAGTGGGGCAGGAGCACTGGAGG - Intergenic
970219816 4:13798974-13798996 AAGAGGGGGAGGAGCCAAGATGG + Intergenic
970348136 4:15174001-15174023 TACAGGGGGAGGAGCCAAGATGG + Intergenic
970411982 4:15817763-15817785 AATAGGGGGAGGAGCCAAGATGG + Intronic
970703483 4:18771115-18771137 CAGTCTGTGTGGAGCCCAGAAGG + Intergenic
970900927 4:21159387-21159409 TTGAGGGGGAGGAGCCAAGATGG + Intronic
971476395 4:27076246-27076268 TATGGGGGGAGGAGCCAAGATGG - Intergenic
971507458 4:27381701-27381723 CTTCGGGGGAGGAGCCAAGATGG - Intergenic
971880729 4:32366562-32366584 TTCTGGGGGAGGAGCCAAGATGG - Intergenic
972832305 4:42828405-42828427 CAGTGGTCAAAGAGCCCAGATGG - Intergenic
972995903 4:44879455-44879477 CAGTCAGGGAGGAGCCAAGATGG + Intergenic
973230527 4:47835629-47835651 CAGTGGGGGAGGTCAACAGAGGG + Intronic
973611171 4:52637172-52637194 AAGTGAGGGTAGAGCCCAGAAGG - Intronic
973667467 4:53177523-53177545 GACTGGGAGAGGAGCCAAGATGG + Intronic
973674201 4:53247906-53247928 GTTTGGGGGAGGAGCCAAGATGG + Intronic
973681850 4:53328728-53328750 TATTGGGGGAGGAGCCAAGATGG + Intronic
973704107 4:53564627-53564649 CTTTTGGGGAGGAGCCAAGATGG + Intronic
973736522 4:53877113-53877135 TACTGGGGGAGGAGCCAAGATGG + Intronic
973806908 4:54535075-54535097 ACGGGGGGGAGGAGCCAAGATGG - Intergenic
973986838 4:56362747-56362769 CCCTGGGGGTGGAGCCAAGATGG + Intronic
974253415 4:59419683-59419705 TTGTGGGGGTGGTGCCCAGATGG + Intergenic
974419041 4:61647286-61647308 AAATCGGGGAGGAGCCAAGATGG - Intronic
974659350 4:64865153-64865175 TTGGGGGGGAGGAGCCAAGATGG - Intergenic
974917236 4:68194055-68194077 AAGTGAGGGTGGAGCCAAGATGG + Intergenic
975154877 4:71059839-71059861 CCTCGGGGGAGGAGCCAAGATGG - Intergenic
975165608 4:71175203-71175225 AAGTGGGGGTGGAGCCAAGATGG + Intergenic
975277715 4:72520976-72520998 AAAGTGGGGAGGAGCCCAGATGG - Intronic
975467363 4:74723569-74723591 AAGCGGAGGAGGAGCCAAGATGG - Intergenic
975518896 4:75276589-75276611 TGGTGGAGGAGGAGCCAAGATGG - Intergenic
975531182 4:75401191-75401213 AGCTGGGGGAGGAGCCAAGATGG + Intergenic
975750625 4:77519401-77519423 TCATGGGGGAGGAGCCAAGATGG - Intronic
976905103 4:90227605-90227627 TATGGGGGGAGGAGCCAAGATGG + Intronic
977029573 4:91864441-91864463 CATAGGGGGTGGAGCCAAGATGG - Intergenic
977178108 4:93839708-93839730 GTGTTGGGGAGGAACCCAGAAGG - Intergenic
977264872 4:94841767-94841789 TACTGGGGGAGGAGCCAAGATGG - Intronic
977505855 4:97903595-97903617 AAGAGGGGAAGGAGCCAAGATGG + Intronic
977954585 4:103011922-103011944 CAGTGGAGGAGTGGCCCTGAAGG - Intronic
978189043 4:105892407-105892429 CAGTGGGGGAGCAATACAGAAGG - Intronic
978209576 4:106119949-106119971 CAATGTGAGAGGAGCCAAGATGG + Intronic
978231787 4:106408576-106408598 CATTTGGGGTGGAGCCAAGATGG - Intergenic
978479099 4:109168208-109168230 CAGTGGAGGAAGAGTTCAGAGGG - Intronic
978719752 4:111894796-111894818 CAATAAGGGAGGAGCCAAGATGG + Intergenic
979317370 4:119280109-119280131 AAACGGGGGAGGAGCCAAGATGG - Intronic
979455001 4:120917131-120917153 CAGTTGAGGAGGAGGTCAGAGGG - Intronic
979953768 4:126928252-126928274 GTGGGGGGGAGGAGCCAAGATGG + Intergenic
980010435 4:127588927-127588949 TTGTGGGGGAGGAGCCAAGATGG + Intergenic
980174429 4:129327303-129327325 CAAAGGGGGAAGAGCTCAGAAGG - Intergenic
980426912 4:132637286-132637308 ATCTGGGGGAGGAGCCAAGATGG - Intergenic
980448755 4:132944405-132944427 CAGAGGAGGAGGAGCCAAGATGG + Intergenic
980899076 4:138887421-138887443 TAGAGGGGGAGGAGCCAAGATGG - Intergenic
980930220 4:139177264-139177286 CCGAGGGGGAGGAGCCGAGGCGG - Intergenic
981059928 4:140413339-140413361 GATGGGGGGAGGAGCCAAGATGG + Intronic
981345067 4:143665223-143665245 TAATCGGGGAGGAGCCAAGATGG - Intronic
981443544 4:144809655-144809677 TTGGGGGGGAGGAGCCAAGATGG + Intergenic
981589982 4:146350015-146350037 TATAGGGGGAGGAGCCAAGATGG + Intronic
981618007 4:146663283-146663305 CATAGGAGGAGGAGCCAAGATGG + Intergenic
981631804 4:146827346-146827368 CTGTGGGGGCGGGGCCAAGATGG - Intronic
981729753 4:147885013-147885035 CAGTGGGGGTGGAGCCAAGTGGG + Intronic
981899686 4:149848201-149848223 TATAGGGGGAGGAGCCAAGATGG + Intergenic
982416244 4:155135737-155135759 AAGTGAGGGAGGTGACCAGAAGG - Intergenic
983058030 4:163122700-163122722 CAGTGAGGGGGGAGCCCTCATGG - Intronic
983137228 4:164100745-164100767 AGCTGGGGGAGGAGCCAAGATGG + Intronic
983147953 4:164241610-164241632 AAATGGGGGAGGAGCCAAGATGG + Intronic
983173302 4:164559505-164559527 AATAGGGGGAGGAGCCAAGATGG - Intergenic
983183481 4:164675912-164675934 TAGTGGGGGAGGTTCCAAGATGG + Intergenic
983341180 4:166463308-166463330 GAGTCGGAGAGGAGCCAAGATGG + Intergenic
983430845 4:167648811-167648833 CATTGTGGGAGGAACCCAGTGGG - Intergenic
983446317 4:167857878-167857900 CCGGGGGGGAGGAGCCAAGATGG + Intergenic
983495862 4:168441986-168442008 ATATGGGGGAGGAGCCAAGATGG + Intronic
983972386 4:173890558-173890580 AAGTGGGGGCGGGGCCAAGATGG - Intergenic
984198673 4:176691782-176691804 CTCTTGGGGAGGAGCCAAGATGG + Intronic
984696499 4:182785062-182785084 ATATGGGGGAGGAGCCAAGATGG - Intronic
985235005 4:187862902-187862924 AAGGGGGGGAGGAGCCAAGATGG - Intergenic
985524151 5:393427-393449 CACTCGTGGAGGTGCCCAGAAGG - Intronic
985552363 5:540236-540258 GAGCGGGTGAGGGGCCCAGAGGG - Intergenic
985978162 5:3439012-3439034 ATTTGGGGGAGGAGCCAAGATGG + Intergenic
986381748 5:7193766-7193788 AAGGGGGGGAGGAGCCAAGATGG + Intergenic
986478354 5:8159058-8159080 CTGGCGGGGAGGAGCCAAGATGG + Intergenic
986549901 5:8940926-8940948 CAATGTTGGAGGAGCCCAGTAGG - Intergenic
986637290 5:9835738-9835760 CTGTGGGAGAGGGGCCCAGCAGG - Intergenic
986978165 5:13416494-13416516 CCGAGGAGGAGGAGCCAAGATGG + Intergenic
987174324 5:15291927-15291949 TTCTGGGGGAGGAGCCAAGATGG + Intergenic
987307299 5:16649322-16649344 CTCAGGGGGAGGAGCCAAGATGG - Intergenic
987516507 5:18917518-18917540 CAGTGGTGGAGCAGCCCACTGGG + Intergenic
988648434 5:33122367-33122389 AACTGGAGGAGGAGCCAAGATGG + Intergenic
988746763 5:34147840-34147862 AAGGGCGGGAGGAGCCAAGATGG + Intergenic
989528831 5:42483012-42483034 ATCTGGGGGAGGAGCCAAGATGG - Intronic
989656378 5:43749328-43749350 CTATGGGGGAGGAGCCAAGATGG - Intergenic
989779199 5:45243985-45244007 CTTGGGGGGAGGAGCCAAGATGG - Intergenic
989793980 5:45444890-45444912 CATTAGGGGAGGAGCCAAGATGG + Intronic
989798064 5:45499597-45499619 CACAGGGGGAGGAGCCAAGATGG - Intronic
989809652 5:45658437-45658459 CAGAGGGGGAGGAGCCAAGATGG + Intronic
990093911 5:52088202-52088224 TCTTGGGGGAGGAGCCGAGATGG - Intergenic
990179117 5:53141063-53141085 CAGGGGCGGAGGAGCCAAGATGG + Intergenic
990367036 5:55081484-55081506 CAGCGGGGGTGGAGCCAAGATGG - Intergenic
990708646 5:58558265-58558287 AAAGGGGGGAGGAGCCAAGACGG - Intergenic
990744129 5:58941384-58941406 CAGTGGGGGAGGCTTCCAAATGG + Intergenic
990838671 5:60050373-60050395 TCCTGGGGGAGGAGCCAAGATGG - Intronic
991304633 5:65164014-65164036 CAGAGGGGGAGGAGCCAAGATGG + Intronic
991508361 5:67350064-67350086 CTGTGGGGAAGGAGTCCAGCTGG - Intergenic
991542299 5:67742913-67742935 AATTGAGGGAGGAGCCAAGATGG - Intergenic
991555360 5:67889601-67889623 CCTGGGGGGAGGAGCCAAGATGG + Intergenic
991633476 5:68680167-68680189 CACAGGAGGAGGAGCCCAGGAGG + Intergenic
992076739 5:73198789-73198811 GACTGGGTGGGGAGCCCAGAAGG + Intergenic
992328917 5:75695695-75695717 AAGTGGGGGAGGAGCCAAGATGG + Intronic
992675488 5:79101892-79101914 TTGAGGGGGAGGAGCCAAGATGG - Intronic
992872514 5:81021359-81021381 CAGTGGGGGAGGAGGTCTTAAGG - Intronic
993123125 5:83799624-83799646 TGGGGGGGGAGGAGCCAAGATGG - Intergenic
993744554 5:91580870-91580892 CAATGGGTGATGAACCCAGAGGG + Intergenic
993798809 5:92302967-92302989 AATGGGGGGAGGAGCCAAGATGG - Intergenic
994546994 5:101180127-101180149 ATGGGGGGGAGGAGCCCAGATGG + Intergenic
994618072 5:102131353-102131375 CAGAGAGGGAGGAGCCAAGATGG + Intergenic
994882822 5:105519256-105519278 CATGGGAGGAGGAGCCAAGATGG - Intergenic
995476366 5:112552393-112552415 CAGTGGAGGAAGAGTCCAAAGGG + Intergenic
996013136 5:118502894-118502916 AAATGGGGGTGGAGCCAAGATGG - Intergenic
996212657 5:120831422-120831444 AAGAGGGGGAAGAGCCAAGATGG + Intergenic
996348775 5:122515621-122515643 CACTGGGGGAGGAGCCAAGATGG - Intergenic
996663075 5:126027117-126027139 CAGCTGGTGTGGAGCCCAGAGGG + Intergenic
996813401 5:127545015-127545037 TACTGTGGGAGGAGCCAAGATGG - Intronic
996881342 5:128299831-128299853 TAAGGGGGGAGGAGCCAAGATGG - Intronic
996935515 5:128943737-128943759 AACTGGGGGTGGAGCCAAGATGG - Intronic
997266444 5:132497690-132497712 CTGTGGGGGAGCAGGTCAGAAGG - Intergenic
997354955 5:133256395-133256417 GAGTAGGGGAGGAGCCAAGGGGG + Intronic
997356631 5:133266863-133266885 CACTGAGTGAGGAGCCCACAAGG - Intronic
998542024 5:142991579-142991601 AAGTGGGGGAGGTTCCAAGATGG - Intronic
999058716 5:148610184-148610206 AGGTGGTGGAGGAGCCAAGATGG + Intronic
999191091 5:149747962-149747984 GAGTGGGTGAGGAGCCAAGCAGG + Intronic
999548723 5:152659880-152659902 TATTGGGGGAGGAGCCAAGATGG - Intergenic
999558239 5:152768680-152768702 GTGGGGGGGAGGAGCCAAGATGG - Intergenic
999606797 5:153325323-153325345 CCGGGGGGAAGGAGCCAAGATGG + Intergenic
999758471 5:154682703-154682725 CAGTGGGGGAACAGCGGAGAGGG - Intergenic
999899181 5:156067948-156067970 GTGGGGGGGAGGAGCCAAGATGG - Intronic
1000390231 5:160715623-160715645 GAGAGTGGGAGGAGCCAAGATGG - Intronic
1000999134 5:167988680-167988702 CAGTGGGAGAGGTAGCCAGAGGG + Intronic
1001662829 5:173408810-173408832 AAGGGGAGGAGGAGCCAAGATGG - Intergenic
1001975343 5:175994182-175994204 CAGTGGAGGGGCAGGCCAGAGGG - Intronic
1002242090 5:177849588-177849610 CAGTGGAGGGGCAGGCCAGAGGG + Intergenic
1002322620 5:178384688-178384710 CAGTGGGTGAGGCCCCCAGGAGG - Intronic
1002644207 5:180645274-180645296 CCGTGGGGGTGGAGACCAGGAGG + Intronic
1002644820 5:180647976-180647998 CCCTGGAGGAGGGGCCCAGAGGG - Intronic
1002675431 5:180908519-180908541 GTGAGGGGGAGGAGCCAAGATGG - Intronic
1002708581 5:181180126-181180148 CACTGGGACAGGATCCCAGAAGG - Intergenic
1202775333 5_GL000208v1_random:65273-65295 AAGGGGGAGAGGAGCCAAGATGG + Intergenic
1002789774 6:428499-428521 CAGTGGGGAAGATGCCCAGCGGG + Intergenic
1003010646 6:2423785-2423807 TTGTGGAGGAGGAGCCAAGATGG - Intergenic
1003457930 6:6300750-6300772 CTCGGGGGGAGGAGCCAAGATGG - Intronic
1003727024 6:8776494-8776516 ACGGGGGGGAGGAGCCAAGATGG - Intergenic
1003813380 6:9810747-9810769 TGGGGGGGGAGGAGCCAAGATGG + Intronic
1005101933 6:22180856-22180878 CAGAGGGGGAGGAGCCAAGATGG - Intergenic
1005239110 6:23804044-23804066 CCCTGGGGGAGGAGCCAAGATGG + Intergenic
1005355473 6:24979191-24979213 CAGTGGGAGTGGAGCAGAGAGGG - Intronic
1005884542 6:30086607-30086629 GATGGGGGGAGGAGCCAAGATGG - Intergenic
1005904318 6:30247879-30247901 CAGCGAGGAAGGAGCCAAGATGG + Intergenic
1006150113 6:31982584-31982606 CAGGAGGGGAGGAGGCCAGTGGG - Intronic
1006156414 6:32015322-32015344 CAGGAGGGGAGGAGGCCAGTGGG - Intronic
1006338277 6:33432111-33432133 AAGTTGGGGAGGGGGCCAGAAGG - Intronic
1006639177 6:35480258-35480280 CCGTGGGTGAGGGGCCCAGGAGG + Intronic
1007155215 6:39736402-39736424 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
1007261804 6:40569228-40569250 CACTGGGGGAGAAGCCCTGGAGG + Intronic
1007577171 6:42932670-42932692 AAGAGGGGAGGGAGCCCAGATGG + Intronic
1007621860 6:43220403-43220425 CAGTGTGGGAGCAGCACAGGGGG - Intronic
1007881761 6:45176058-45176080 CTTGGGGGGAGGAGCCAAGATGG + Intronic
1008183449 6:48363087-48363109 TCTTGGGGGAGGAGCCAAGATGG + Intergenic
1008874202 6:56307853-56307875 AAGAGGGGGTGGAGCCAAGATGG - Intronic
1008915858 6:56785850-56785872 AAGAGGGGGAGGAGCCAAGATGG - Intronic
1009165666 6:60338476-60338498 CAGTGGCAGAGGAACACAGATGG - Intergenic
1009282361 6:61769172-61769194 CTGGGAGGGAGGAGCCAAGATGG + Intronic
1009801342 6:68540527-68540549 TCGTGAGGGAGGAGCCCTGATGG + Intergenic
1010173024 6:72994668-72994690 CATGGGAGGAGGAGCCAAGATGG - Intronic
1010318939 6:74484527-74484549 AAATCGGGGAGGAGCCAAGATGG + Intergenic
1010523968 6:76877057-76877079 TCATGGGGGAGGAGCCAAGATGG - Intergenic
1010679540 6:78783124-78783146 AAGACGGGGAGGAGCCAAGATGG + Intergenic
1010834904 6:80573928-80573950 GAATTGGGGAGGAGCCAAGATGG - Intergenic
1010856522 6:80847736-80847758 CAAGGGGGGAGGAGCCAAGATGG + Intergenic
1010983471 6:82395407-82395429 TTGCGGGGGAGGAGCCAAGATGG - Intergenic
1011066595 6:83333949-83333971 CAGGGGGGGAGGAGCCAAGATGG + Intronic
1011419509 6:87156166-87156188 CAGTGGGGGCGGAGGCCCGTCGG - Intronic
1011435256 6:87329261-87329283 CAAGAGGGGAGGAGCCAAGATGG - Exonic
1011659395 6:89581417-89581439 CAGTGTGTGAGGAGCCCAATGGG + Intronic
1011710955 6:90053977-90053999 CCGGTGGGGAGGAGCCAAGATGG + Intronic
1011999696 6:93637591-93637613 CCTGGGGGGAGGAGCCAAGATGG - Intergenic
1012504791 6:99931972-99931994 CATGGAGGGAGGAGCCAAGATGG - Intronic
1012683085 6:102208471-102208493 TGGTGTGGGAGGAACCCAGAGGG + Intergenic
1012821915 6:104095441-104095463 AAGCGGGGGTGGAGCCAAGATGG + Intergenic
1012844638 6:104374604-104374626 AAGGGGGGGTGGAGCCAAGATGG + Intergenic
1012876723 6:104737312-104737334 ATTTGGGGGAGGAGCCAAGATGG + Intronic
1013397515 6:109757070-109757092 GAGAGGGGGAGGAGCCAAGATGG - Intronic
1013868490 6:114726735-114726757 AAGGAGGGGAGGAGCCAAGATGG - Intergenic
1014063756 6:117102128-117102150 CAAGGGAGGAGGAGCCAAGATGG + Intergenic
1014070995 6:117181812-117181834 CAGTCAGGGAGGAGCCAAGATGG + Intergenic
1014076750 6:117244749-117244771 CCTAGGGGGAGGAGCCAAGATGG + Intergenic
1014120611 6:117721291-117721313 TAGTGGGGGAGGAGCCAAGATGG + Intergenic
1014373671 6:120643631-120643653 CAGGTAGGGAGGAGCCAAGATGG - Intergenic
1014376961 6:120688736-120688758 AACAGGGGGAGGAGCCAAGATGG + Intergenic
1014433168 6:121392692-121392714 TACTTGGGGAGGAACCCAGAAGG + Intergenic
1014710806 6:124804499-124804521 ATCTGGGGGAGGAGCCAAGATGG + Intronic
1015056765 6:128911646-128911668 CTTTAGGGGAGGAGCCAAGATGG - Intronic
1015063645 6:128998382-128998404 GACAGGGGGAGGAGCCAAGATGG + Intronic
1016080658 6:139851233-139851255 CACTGGGGGAGGTCCCCAAATGG + Intergenic
1016213249 6:141566102-141566124 AACTGGAGGAGGAGCCAAGATGG + Intergenic
1016423944 6:143913980-143914002 CATTGGGAGAGGGGCCAAGATGG - Intronic
1018582859 6:165322663-165322685 CATTGTGGGAGGAACCCAGTGGG + Intergenic
1018929194 6:168229146-168229168 CAGTTGAAGAGGAGCCCTGAGGG - Intergenic
1018982039 6:168608404-168608426 CAGGGGGCCAGGAGCCCACACGG + Intronic
1019217616 6:170453862-170453884 CACTGGGGGCTGAGCCCAGGTGG - Intergenic
1019394238 7:808429-808451 CTCTGGGAGGGGAGCCCAGAAGG - Intergenic
1019400326 7:848276-848298 CACTTGGGGAAGAGCCCAGCTGG - Intronic
1019421929 7:954627-954649 CGGCGGCGGCGGAGCCCAGAGGG - Intronic
1019422102 7:955196-955218 GAGTGGGAGGGGTGCCCAGAGGG - Intronic
1019455977 7:1127930-1127952 CAGGGTGGGATGAGCCGAGATGG - Intronic
1019456170 7:1128810-1128832 CAGGGTGGGATGAGCCGAGATGG - Intronic
1019456192 7:1128904-1128926 CAGGGTGGGATGAGCCGAGATGG - Intronic
1019456204 7:1128952-1128974 CAGGGTGGGATGAGCCGAGATGG - Intronic
1019456316 7:1129460-1129482 CAGGGTGGGATGAGCCGAGATGG - Intronic
1019481583 7:1269536-1269558 CGGTCGGGCAGGAGCCCGGACGG - Intergenic
1019603059 7:1894911-1894933 CAGTGGGGGAGAAACACAGGAGG + Intronic
1019675550 7:2309891-2309913 CAGGGGTGAAGGAGCCCCGAGGG + Intronic
1020007411 7:4789971-4789993 GAGAGGGGGAGGAGTCCAGGAGG - Intronic
1020112593 7:5455961-5455983 CACTGGGGAAGGAGCACAGAGGG - Intronic
1020374031 7:7465089-7465111 AACCGGGGGAGGAGCCAAGATGG + Intronic
1020454039 7:8351720-8351742 GGGTGGGGGAGGAGCCAAGATGG + Intergenic
1020618944 7:10495842-10495864 TGGTGTGGGAGGAGCCAAGATGG + Intergenic
1020948601 7:14647627-14647649 TCATGGGGGAGGAGCCAAGATGG + Intronic
1020952998 7:14704476-14704498 AAAAGGGGGAGGAGCCAAGATGG + Intronic
1021047344 7:15940226-15940248 AATTGGGGGAGGAGCCAAGATGG + Intergenic
1021156299 7:17215214-17215236 AAGCGGGGGTGGAGCCAAGATGG + Intergenic
1021875797 7:25047873-25047895 AGTTGGGGGAGGAGCCAAGATGG - Intergenic
1022506036 7:30909091-30909113 CATTGGGGCAGGAGGCCAGGGGG - Intergenic
1022765690 7:33408572-33408594 AAATGTGGGAGGAGCCAAGATGG - Intronic
1022837997 7:34135287-34135309 CAGGGAGGGAGGAACACAGAAGG + Intronic
1022874361 7:34513454-34513476 GAGGCGGGGAGGAGCCAAGATGG + Intergenic
1023084754 7:36559110-36559132 AAATGTGGGAGGAGCCAAGATGG - Intronic
1023815201 7:43944034-43944056 GAGTTGGGAAGGAGGCCAGAGGG + Intronic
1023864303 7:44231677-44231699 CAGAGGGGCAGGTGCCCTGAGGG - Intronic
1024233393 7:47379769-47379791 CAGGAGGGGAGGTGCCCAGCAGG + Intronic
1024592273 7:50898839-50898861 AATGGGGGGAGGAGCCAAGATGG + Intergenic
1025122209 7:56314663-56314685 GAGCAGGGGAGGAGCCAAGAAGG - Intergenic
1025619414 7:63154841-63154863 GATGGGGGGAGGAGCCAAGATGG - Intergenic
1026289876 7:68996889-68996911 CAGTGTGGGATGAGCCCGGGTGG + Intergenic
1026658982 7:72282477-72282499 CAGTGAGGGAGGAGCCCTCATGG - Intronic
1027747440 7:82095042-82095064 CAGTAGGAGAGGACACCAGAAGG - Intronic
1027896873 7:84055713-84055735 AATTTGGGGAGGAGCCAAGATGG - Intronic
1028065150 7:86375394-86375416 CCTTGGGGGTGGAGCCAAGATGG + Intergenic
1028421736 7:90640254-90640276 AAGAGAGGGAGGAGCCAAGATGG - Intronic
1028467917 7:91173439-91173461 AAGGTGGGGAGGAGCCAAGATGG + Intronic
1028489541 7:91395491-91395513 ATGAGGGGGAGGAGCCAAGATGG - Intergenic
1028522896 7:91752236-91752258 CAGGAAGGGAGGATCCCAGATGG + Intronic
1028944192 7:96558196-96558218 TCCTGGGGGAGGAGCCAAGATGG - Intronic
1029516371 7:101025985-101026007 CAGTTATGGAGGAGCCCACACGG + Intronic
1029528260 7:101108665-101108687 AGGTGGGGGCTGAGCCCAGAAGG - Intergenic
1029620573 7:101687959-101687981 CTGTGGCAGAGGATCCCAGAAGG - Intergenic
1029850227 7:103453959-103453981 TGGTGGGGGTGGAGCCAAGACGG - Intergenic
1030423062 7:109333345-109333367 CAGTGTTGGAGAAGCCCAAATGG - Intergenic
1030466035 7:109905423-109905445 TATCGGGGGAGGAGCCAAGATGG + Intergenic
1030572943 7:111249528-111249550 AAGAGGGGGAGGAGCCAAGATGG - Intronic
1030795548 7:113782134-113782156 TATGGGGGGAGGAGCCAAGATGG - Intergenic
1030893753 7:115031097-115031119 CGGGGAGGGAGGAGCCAAGATGG - Intergenic
1032004736 7:128292008-128292030 GGGGGGGGGAGGAGCCAAGATGG + Intergenic
1032652657 7:133895437-133895459 AACAGGGGGAGGAGCCAAGATGG - Intronic
1032972465 7:137181605-137181627 TACCGGGGGAGGAGCCAAGATGG + Intergenic
1033142246 7:138838057-138838079 CGGTGGGGGAGGTTCCCGGAAGG + Exonic
1033305786 7:140224326-140224348 CGTTGGAGGAGGAGGCCAGAGGG + Intergenic
1033498792 7:141926694-141926716 AAGAGAGGGAGGAGCCAAGATGG - Intronic
1034289859 7:149921263-149921285 CTGTGGGAGAAGAGTCCAGAAGG - Intergenic
1034382069 7:150706234-150706256 AAGGTGGGGAGGAGCCAAGATGG + Intergenic
1034417272 7:150971743-150971765 GAGTGAGAGAGGAGCCGAGAAGG + Intronic
1034425236 7:151010519-151010541 CAGTGGGGGAGGGGTCAAGAAGG + Intronic
1034822851 7:154232857-154232879 CAATGCGGGAGGAACGCAGATGG + Intronic
1035156223 7:156915524-156915546 ATGGGGGGGAGGAGCCAAGATGG - Intergenic
1035481986 7:159194299-159194321 CAGAAGGCCAGGAGCCCAGAAGG + Intergenic
1036148820 8:6279527-6279549 CTTTGGAGGAGGAGCACAGACGG - Intergenic
1036461967 8:8961319-8961341 CATTGTGGGAGGAACCCAGTGGG - Intergenic
1036975302 8:13404429-13404451 CACTGGGGTAGGGGGCCAGAAGG + Intronic
1037546625 8:19930157-19930179 CAATAGGGGAGGAGCCAAGATGG + Intronic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1038032069 8:23651201-23651223 GATGGGGGGAGGAGCCAAGATGG - Intergenic
1038234280 8:25736336-25736358 AAAGGGGGGAGGAGCCAAGATGG - Intergenic
1038438513 8:27555417-27555439 CATCGGGGGAGGAGCCAAGATGG - Intergenic
1038483259 8:27915987-27916009 CAGAGGAGAAGGAGCCCAGGAGG - Intronic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039509271 8:38077841-38077863 CACTGGGGAAGCAGCCCAGATGG - Intergenic
1039877465 8:41599178-41599200 CAGTCAGGGAGATGCCCAGAAGG - Exonic
1040273685 8:45986128-45986150 CTAAGGGGGAGGAGCCAAGATGG - Intergenic
1040591817 8:48799912-48799934 CATGGGGGGAGGAGCCAAGATGG - Intergenic
1040679605 8:49792679-49792701 CTGTGGAGGAGGTGCTCAGAAGG - Intergenic
1041146402 8:54880875-54880897 CAGGGTGGGAGGGACCCAGACGG - Intergenic
1041211958 8:55560368-55560390 CAGAGGGGGCGGGGCCAAGATGG - Intergenic
1041301362 8:56415218-56415240 TTTTGGGGGAGGAGCCAAGATGG + Intergenic
1041477130 8:58278938-58278960 CAGTAGGGGAGGAGAGCAGAAGG - Intergenic
1041557558 8:59174662-59174684 CATGAGGGGAGGAGCCAAGATGG - Intergenic
1041613263 8:59875809-59875831 AAAGGGGGGAGGAGCCAAGATGG - Intergenic
1041914391 8:63125445-63125467 CAGTAGGGGTAGAGCACAGAGGG - Intergenic
1041950031 8:63490318-63490340 CAACGGGGGAGGAGCCAAGATGG - Intergenic
1042086155 8:65111661-65111683 CAGAGGGGGAGGTGCCCATCTGG - Intergenic
1042121697 8:65495445-65495467 TTGTTGGGAAGGAGCCCAGATGG + Intergenic
1042204758 8:66317802-66317824 AGGGGGGGGAGGAGCCAAGATGG + Intergenic
1042402178 8:68362408-68362430 CATGGAGGGAGGAGCCAAGATGG + Intronic
1042457145 8:69019001-69019023 AATCGGGGGAGGAGCCAAGATGG + Intergenic
1042579643 8:70262689-70262711 CAATGTGGGAGGAGGCAAGAAGG + Intronic
1042750558 8:72153448-72153470 CAGCTTGGGAGGAGCCAAGATGG - Intergenic
1042773514 8:72404799-72404821 GACTGGGGGAGGAGCCAAGATGG + Intergenic
1042970499 8:74402688-74402710 CTTTGGGGAAGGAGCCAAGATGG - Intronic
1042976820 8:74478717-74478739 CAGCTGGTGCGGAGCCCAGAGGG - Intronic
1043042289 8:75278364-75278386 AAGAGGGAGAGGAGCCAAGATGG + Intergenic
1043171586 8:76972827-76972849 CAGTGGGGTGGGGGCCAAGATGG - Intergenic
1043555582 8:81427208-81427230 CCAGGGGGGAGGAGCCAAGATGG + Intergenic
1043976689 8:86592349-86592371 CTATTGGGGAGGAGCCAAGATGG - Intronic
1044037834 8:87327811-87327833 AAAAGGGGGAGGAGCCAAGATGG - Intronic
1044764636 8:95558247-95558269 AACAGGGGGAGGAGCCAAGATGG - Intergenic
1045079867 8:98614442-98614464 GATCGGGGGAGGAGCCAAGATGG + Intronic
1045385958 8:101671030-101671052 CAAGGGGGGTGGAGCCAAGATGG + Intergenic
1045561833 8:103271534-103271556 CTGTGGGGGTGGAGCCCTCATGG + Intergenic
1045607110 8:103789279-103789301 CTGCTGGGGAGGAGCCAAGATGG - Intronic
1045775316 8:105795216-105795238 ATGAGGGGGAGGAGCCAAGATGG - Intronic
1045939199 8:107718074-107718096 CAGAGGGAGTGGAGCCAAGATGG - Intergenic
1046043017 8:108930475-108930497 GTTTGGGGGAGGAGCCAAGATGG + Intergenic
1046812531 8:118548533-118548555 CTGGAGGGGAGGAGCCAAGATGG + Intronic
1046867370 8:119165392-119165414 TCCTGGGGGAGGAGCCAAGATGG - Intronic
1047149452 8:122244415-122244437 CCGGGGGGGAGGAGCCAAGATGG + Intergenic
1047328831 8:123865989-123866011 GTGGGGGGGAGGAGCCAAGATGG - Intronic
1047627217 8:126668433-126668455 CAGTGGGAGAGGAGCCCAGTGGG + Intergenic
1047815556 8:128459002-128459024 CTGGGAGGGAGGAGCCAAGATGG - Intergenic
1047840268 8:128744600-128744622 CAGAGAGGGAGGAGCCAAGATGG + Intergenic
1047845500 8:128801229-128801251 GGGTGGGGGTGGAGCCAAGATGG + Intergenic
1048333438 8:133486395-133486417 CAGAGCGGGTGGAGCCCAGCTGG - Intronic
1048596872 8:135875859-135875881 TTGGGGGGGAGGAGCCAAGATGG + Intergenic
1048627010 8:136196204-136196226 CTTGGGGGGAGGAGCCAAGATGG - Intergenic
1048994843 8:139788002-139788024 CAGTGGTGGAGGACGCCACAGGG - Intronic
1048999790 8:139817537-139817559 CTGTGGGGCAGGAGACCAGGAGG - Intronic
1049128027 8:140810226-140810248 CAGCTGAGGTGGAGCCCAGAGGG + Intronic
1049476882 8:142801023-142801045 CAGGTGGGGAGGTGCCCAGTGGG + Intergenic
1049872478 8:144991245-144991267 CATTGAGGAAGGAGCCAAGATGG - Intergenic
1050509171 9:6376260-6376282 CATCAGGGGAGGAGCCAAGATGG + Intergenic
1050689049 9:8204580-8204602 CAGGGAAGGAGGAGCCAAGATGG - Intergenic
1050787635 9:9425918-9425940 CACTGGGGGAGGTTCCAAGATGG + Intronic
1051298961 9:15628034-15628056 CACTGGGGAGGGAGCCAAGATGG + Intronic
1051479020 9:17539556-17539578 CACTCAGGGAGGAGCCAAGATGG + Intergenic
1051603346 9:18896426-18896448 AAGAGGGGGAGGGGCCAAGATGG + Intronic
1052105558 9:24510397-24510419 CTGTGGGGGTGGAGCCCTCATGG + Intergenic
1052454516 9:28678228-28678250 GAGTGGGAGAGCAGGCCAGAAGG - Intergenic
1052480526 9:29019512-29019534 TAGTGGGAGTGGAGACCAGAAGG - Intergenic
1052612356 9:30791191-30791213 ATGAGGGGGAGGAGCCAAGATGG - Intergenic
1052650324 9:31294062-31294084 AGTTGGGGGAGGAGCCAAGATGG + Intergenic
1054425366 9:65061989-65062011 GACAGGGGGAGGAGCCAAGAGGG + Intergenic
1054811784 9:69440913-69440935 CTGGGGGGGTGGAGCCAAGATGG - Intronic
1055860890 9:80747671-80747693 CTCGGGGGGAGGAGCCAAGATGG - Intergenic
1056258417 9:84823997-84824019 CAGTGGGGGAGGAGCTAAGCAGG + Intronic
1056300632 9:85237082-85237104 CAATGGGGAACGGGCCCAGAGGG - Intergenic
1057051615 9:91928244-91928266 CAGTGGGGGACGGTTCCAGATGG - Intronic
1057086365 9:92214405-92214427 AATTGGGGGAGGAGCCAAGATGG + Intronic
1057108567 9:92445089-92445111 CAGCTGGTGTGGAGCCCAGAGGG - Intronic
1057407224 9:94783596-94783618 CAGTGGAGAAGGAGGCCAGGAGG + Intronic
1057844055 9:98508274-98508296 CTGGGGAGGAGGAGCCAAGATGG + Intronic
1058063811 9:100527224-100527246 CCGGAGGGGAGGAGCCAAGATGG + Intronic
1058176039 9:101737745-101737767 CAGCCGAGCAGGAGCCCAGAGGG - Exonic
1058456094 9:105139497-105139519 CAGTTAGTGAGGAGCCCTGAAGG - Intergenic
1058632958 9:107008150-107008172 CAGTTGGGGAGGAGTCAGGAAGG + Intronic
1058796210 9:108501088-108501110 AGGGGGGGGAGGAGCCAAGATGG + Intergenic
1059732626 9:117072018-117072040 GAGTGGGGGAGGAGCCAAGATGG - Intronic
1059921910 9:119169113-119169135 ATGTGGCGGAGGAGCCAAGATGG + Intronic
1060054927 9:120405049-120405071 CAGTGGTGCAGGAGCTCGGAAGG - Intronic
1060512356 9:124243174-124243196 CAGAGGGAGAAGGGCCCAGACGG + Intergenic
1060522413 9:124301206-124301228 TATTGGGGGAGATGCCCAGATGG + Intronic
1060555654 9:124506059-124506081 CAGGCGGGCGGGAGCCCAGATGG - Intronic
1060568610 9:124617067-124617089 CAGTAGAGGAAGAGCCAAGATGG + Intronic
1060722551 9:125988662-125988684 CAGTGGGGGAGGGAGCCACATGG - Intergenic
1060764403 9:126283050-126283072 CAATGGGGGAAGAGGTCAGAGGG + Intergenic
1060875555 9:127081294-127081316 CAGTTGGGTAGGAGGCCTGAAGG - Intronic
1060996412 9:127876873-127876895 CTGTGGGGCCGAAGCCCAGAGGG + Intronic
1061629544 9:131863437-131863459 CAGTGGGGGCAGATCCCAGAGGG + Intronic
1062431745 9:136529482-136529504 CAGTGGGAGAGGACCCGAGGTGG - Intronic
1062464590 9:136675473-136675495 CAGGGAGGGAGGAGGCCAGCAGG + Intronic
1062586216 9:137251133-137251155 TAGTGGGGGAGGGGCCCACCAGG + Intergenic
1203465525 Un_GL000220v1:82706-82728 GAGAGGGGGTGGAGCCAAGATGG + Intergenic
1203358929 Un_KI270442v1:193852-193874 TAGGGGAGGAGGAGCCAAGATGG - Intergenic
1203421359 Un_KI270521v1:839-861 CTTTCGGGGAGGAGCCAAGATGG - Intergenic
1203410362 Un_KI270581v1:3063-3085 GTGGGGGGGAGGAGCCAAGAAGG + Intergenic
1185492838 X:532023-532045 CAGTGGGGTGGGGGGCCAGAGGG - Intergenic
1186567272 X:10676811-10676833 CAGTCGATGAGGAGTCCAGAGGG - Intronic
1186664920 X:11707245-11707267 AAGGGGGGGAGGAGCCAAGATGG + Intergenic
1186687574 X:11941296-11941318 CAGGGAGGGAGGAGCCAAGATGG - Intergenic
1186905880 X:14109958-14109980 GAGTCGGGGAGGAGCCAAGATGG - Intergenic
1187393967 X:18904150-18904172 CAGAGAGGCAGGAGCCCATAAGG + Intronic
1188036142 X:25319060-25319082 AACTGGGGGTGGAGCCAAGATGG - Intergenic
1188420739 X:29987867-29987889 AATAGGGGGAGGAGCCAAGATGG - Intergenic
1188492997 X:30755821-30755843 CAGCTGGTGTGGAGCCCAGAGGG + Intergenic
1188857985 X:35221416-35221438 CCAGGGGGGAGGAGCCAAGATGG + Intergenic
1188959361 X:36471199-36471221 GCGGGGGGGAGGAGCCAAGATGG - Intergenic
1189583369 X:42430874-42430896 TATTGTGGGAGGAGCCAAGATGG - Intergenic
1189940733 X:46117899-46117921 CAGTGGCTGTGGAGCACAGAGGG - Intergenic
1189997774 X:46655354-46655376 GATTGGGGGAAGAGCCAAGATGG + Intronic
1190403173 X:50060140-50060162 CACGGGGGGAGGAGCCAAGATGG + Intronic
1190536515 X:51433582-51433604 CAGGAGGGGGGGAGCCAAGATGG - Intergenic
1190556878 X:51644755-51644777 GATGGGGGGAGGAGCCAAGATGG + Intergenic
1190921798 X:54860083-54860105 CACAGGGGGTGGAGCCAAGATGG - Intergenic
1191063129 X:56319670-56319692 GCGGGGGGGAGGAGCCAAGATGG + Intergenic
1191092237 X:56635703-56635725 CGGGTGGGGAGGAGCCAAGATGG - Intergenic
1191098091 X:56695881-56695903 CAGGGGAGGAGGAGCCAAGATGG + Intergenic
1191125926 X:56953805-56953827 CTGGGGGGGAGGAGCCAAGATGG - Intergenic
1191144620 X:57152900-57152922 CAGCGGGGGGGGAGCCAAGGTGG - Intergenic
1191157880 X:57295467-57295489 TAGAGGGGGTGGAGCCAAGATGG + Intronic
1191723837 X:64258357-64258379 AGGAGGGGGAGGAGCCAAGATGG - Intergenic
1191800494 X:65073646-65073668 CAGTTGGCGTAGAGCCCAGAGGG - Intergenic
1191827197 X:65378593-65378615 GAGTGGGGGAGGAGCCAAGATGG + Intronic
1192096408 X:68216911-68216933 AAATTGGGGAGGAGCCAAGATGG + Intronic
1192401260 X:70838495-70838517 TAGAGGGGGAGGAGCCAAGATGG + Intronic
1192640864 X:72860480-72860502 AAGTGGGGGAGGTTCCAAGATGG - Intergenic
1192884153 X:75319639-75319661 CATGGGGGGTGGAGCCAAGATGG - Intergenic
1192974339 X:76267402-76267424 TGGCGGGGGAGGAGCCAAGATGG + Intergenic
1193045168 X:77046223-77046245 AATAGGGGGAGGAGCCAAGATGG + Intergenic
1193064419 X:77244264-77244286 TCCTGGGGGAGGAGCCAAGATGG + Intergenic
1193580711 X:83259740-83259762 CAGTTGATGTGGAGCCCAGAGGG + Intergenic
1193749756 X:85327073-85327095 CAGTCAGTGCGGAGCCCAGAGGG - Intronic
1193790319 X:85808700-85808722 CAGTTGAGGTGGAGCCCAGAGGG - Intergenic
1193896050 X:87116303-87116325 CAGAGGAGGAGGAGCCAAGATGG + Intergenic
1193983001 X:88207882-88207904 GAAGGGGGGAGGAGCCAAGATGG + Intergenic
1194255270 X:91627093-91627115 CTGGGGGGGAGGAGCCAAGATGG + Intergenic
1194303482 X:92215058-92215080 CACTGGGGAAGCAGCCAAGATGG + Intronic
1195548307 X:106138392-106138414 CAGTTGATGTGGAGCCCAGAGGG + Intergenic
1195840617 X:109172307-109172329 CAGTGGGGAAGCAGCACAAAGGG - Intergenic
1196171149 X:112590120-112590142 TAGTGGGGGAGGAGCCAAGATGG + Intergenic
1196359623 X:114836714-114836736 CCGAGGGGGAGGAGCCAAGATGG - Intronic
1196380772 X:115086593-115086615 TATTGGGGGTGGAGCCAAGAAGG - Intergenic
1196478727 X:116121198-116121220 CAGCGGAGGTGGAGCCAAGATGG + Intergenic
1196511840 X:116520611-116520633 TTGAGGGGGAGGAGCCAAGATGG - Intergenic
1196788350 X:119441477-119441499 CAAAGCGGGAGGAGCCAAGATGG - Intronic
1196873687 X:120137131-120137153 CGGTGGGGGAGAATTCCAGAGGG + Intergenic
1197000817 X:121437640-121437662 GAGTAGGAGAGGAGCCAAGATGG + Intergenic
1197491551 X:127122711-127122733 AAGGGGGGGAGGAGCCAAGATGG - Intergenic
1197619525 X:128732733-128732755 ATGTTGGGGAGGAGCCAAGATGG + Intergenic
1197824441 X:130573680-130573702 CTGGGAGGGAGGAGCCAAGATGG - Intergenic
1197859855 X:130958928-130958950 AATGGGGGGAGGAGCCAAGATGG + Intergenic
1197877832 X:131129225-131129247 GCAGGGGGGAGGAGCCCAGATGG - Intergenic
1197902107 X:131384351-131384373 TACAGGGGGAGGAGCCAAGATGG - Intronic
1198976115 X:142338120-142338142 AACTGAGGGAGGAGCCAAGATGG + Intergenic
1199308336 X:146293243-146293265 GAATGGGGGAGGGGCCAAGATGG - Intergenic
1199400094 X:147389273-147389295 CAGCCGGTGTGGAGCCCAGAGGG + Intergenic
1199808991 X:151330317-151330339 TCGAGGGGGAGGAGCCAAGATGG + Intergenic
1200573998 Y:4866354-4866376 CTGGGGGGGAGGAGCCAAGATGG + Intergenic
1200581476 Y:4954923-4954945 TAGAGGGGGAGGAGCCAAGATGG - Intergenic
1200743205 Y:6877557-6877579 CAGTGGTGGAGGAACACATAGGG - Intergenic
1200774733 Y:7160115-7160137 TTGAGGGGGAGGAGCCAAGATGG - Intergenic
1200820329 Y:7576055-7576077 TAAAGGGGGAGGAGCCAAGATGG - Intergenic
1201014732 Y:9589711-9589733 CTGGGGGGGAGGAGCCAAGATGG + Intergenic
1201230670 Y:11861076-11861098 TAAAGGGGGAGGAGCCAAGATGG - Intergenic
1201245922 Y:12003574-12003596 AAATGGGGGTGGAGCCAAGATGG - Intergenic
1201415690 Y:13746725-13746747 CAAATGGGGAGGAGCCAAGATGG - Intergenic
1201437289 Y:13972665-13972687 AAATCGGGGAGGAGCCAAGATGG - Intergenic
1201494341 Y:14576706-14576728 CATGGGGGGTGGAGCCAAGATGG - Intronic
1201988361 Y:19993990-19994012 CTGAGGGGGAGAAGCCAAGATGG - Intergenic
1201991346 Y:20030939-20030961 AGCTGGGGGAGGAGCCAAGATGG + Intergenic
1202066948 Y:20950145-20950167 GAGGGGAGGAGGAGCCAAGATGG - Intergenic
1202277885 Y:23144664-23144686 GGGTGGGGGAGGAGCCAAGATGG + Intronic
1202287318 Y:23264103-23264125 GGGTGGGGGAGGAGCCAAGATGG - Intronic
1202383555 Y:24300422-24300444 GAGAGGAGGAGGAGCCAAGATGG - Intergenic
1202430711 Y:24776003-24776025 GGGTGGGGGAGGAGCCAAGATGG + Intronic
1202439258 Y:24882160-24882182 GGGTGGGGGAGGAGCCAAGATGG - Intronic
1202487228 Y:25369698-25369720 GAGAGGAGGAGGAGCCAAGATGG + Intergenic