ID: 1084664119

View in Genome Browser
Species Human (GRCh38)
Location 11:70567066-70567088
Sequence AATGCCACCACCATTGTTAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084664117_1084664119 -5 Left 1084664117 11:70567048-70567070 CCCTCTGAGCTGCTGCTGAATGC 0: 1
1: 0
2: 1
3: 28
4: 254
Right 1084664119 11:70567066-70567088 AATGCCACCACCATTGTTATCGG 0: 1
1: 0
2: 0
3: 24
4: 154
1084664114_1084664119 24 Left 1084664114 11:70567019-70567041 CCCTCGAGGCTGGAGGAATGCTT 0: 1
1: 0
2: 1
3: 8
4: 128
Right 1084664119 11:70567066-70567088 AATGCCACCACCATTGTTATCGG 0: 1
1: 0
2: 0
3: 24
4: 154
1084664115_1084664119 23 Left 1084664115 11:70567020-70567042 CCTCGAGGCTGGAGGAATGCTTC 0: 1
1: 0
2: 0
3: 11
4: 117
Right 1084664119 11:70567066-70567088 AATGCCACCACCATTGTTATCGG 0: 1
1: 0
2: 0
3: 24
4: 154
1084664118_1084664119 -6 Left 1084664118 11:70567049-70567071 CCTCTGAGCTGCTGCTGAATGCC 0: 1
1: 0
2: 2
3: 23
4: 228
Right 1084664119 11:70567066-70567088 AATGCCACCACCATTGTTATCGG 0: 1
1: 0
2: 0
3: 24
4: 154
1084664113_1084664119 25 Left 1084664113 11:70567018-70567040 CCCCTCGAGGCTGGAGGAATGCT 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1084664119 11:70567066-70567088 AATGCCACCACCATTGTTATCGG 0: 1
1: 0
2: 0
3: 24
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084664119 Original CRISPR AATGCCACCACCATTGTTAT CGG Intronic
901097930 1:6697511-6697533 AATGCCACCACCAATCTGACAGG + Intronic
909069771 1:70980452-70980474 AATTCCACCAACAATCTTATAGG - Intronic
909758843 1:79263899-79263921 AATACCAACTCCATTGTTACCGG - Intergenic
912010801 1:104959274-104959296 AATGCCACCACATTTTTGATAGG - Intergenic
915290884 1:154882441-154882463 AATGCCAGCACCAGTGTTGAGGG - Intergenic
917622450 1:176810533-176810555 AATGCCACCACAAATTTTACAGG + Intronic
919782018 1:201227187-201227209 ACTGCCACCCTCATTGTCATAGG + Exonic
921955376 1:220978072-220978094 ATTGCTACCACCACTGCTATAGG + Intergenic
1062984889 10:1759498-1759520 AAAGCCACCTACATTATTATTGG - Intergenic
1063521318 10:6743771-6743793 AATCCCAGCACCCTTGTTATGGG - Intergenic
1063698676 10:8363702-8363724 AATGCCTCCACCATCCTTTTGGG - Intergenic
1064679370 10:17794446-17794468 AATGCCATCAACATTGTTTTAGG + Intronic
1067428117 10:46224490-46224512 AATGGCACCAACTTTGTGATTGG + Intergenic
1068139751 10:52990939-52990961 AATGCCACCCCCAGTGTTGGAGG - Intergenic
1069422923 10:68262720-68262742 ATTGTAACCACCATTGTTGTGGG + Intergenic
1070643264 10:78184088-78184110 AAGGACACCACCAGTCTTATCGG - Intergenic
1071426508 10:85560153-85560175 AATGCAAACACTACTGTTATAGG - Intergenic
1078387898 11:10909087-10909109 CCTGCCAGCACCTTTGTTATCGG - Intergenic
1079735468 11:23992373-23992395 ATTGTCACCACCATTGCTATTGG - Intergenic
1084099475 11:66936448-66936470 GAGGCCACCAATATTGTTATTGG + Intronic
1084664119 11:70567066-70567088 AATGCCACCACCATTGTTATCGG + Intronic
1084837409 11:71813217-71813239 AATGCCACCAACACTGTTAATGG + Intergenic
1085851664 11:80127640-80127662 ATTGGCACCATCATTGGTATTGG - Intergenic
1087160409 11:94943033-94943055 AATGCCACCACCAATTTGACAGG + Intergenic
1087517413 11:99181419-99181441 TATCCCACCCCCATTGGTATTGG + Intronic
1088295047 11:108284001-108284023 CATACCACCACCATAATTATGGG - Intronic
1088941399 11:114461028-114461050 AACGCCACCACCATAGCTACTGG - Intergenic
1089819643 11:121213112-121213134 GATCCCACCACCATTACTATGGG + Intergenic
1090513769 11:127402700-127402722 AATGCCACCACCAACACTATAGG - Intergenic
1092401291 12:8180856-8180878 AATGCCACCAACACTGTTAATGG - Intronic
1096437493 12:51606616-51606638 AATGCCACCATCACTCTTCTCGG - Intronic
1099236297 12:80085800-80085822 TATGCCACATCCATAGTTATAGG + Intergenic
1100380658 12:94058725-94058747 AATGCCACCACCTATATTGTAGG + Intergenic
1101699905 12:107163068-107163090 ACTGCCACCACCATTTATAGGGG + Intergenic
1105204971 13:18214934-18214956 AATCCCATCACCATGGTGATAGG - Intergenic
1107631585 13:42348596-42348618 AATTCCACCATCTTTGATATAGG + Intergenic
1110301588 13:73935435-73935457 AATGCGACCTCCAATGTTAGAGG + Intronic
1111085318 13:83369074-83369096 GATGCCATTACCATTGTTTTTGG - Intergenic
1112492455 13:99879853-99879875 ACTGCTACCACCATTGCTACTGG - Intronic
1112737429 13:102436470-102436492 AATGCCAGCTCCATTGATGTTGG - Intergenic
1114899527 14:27039439-27039461 AATCCCAACACCTTTGGTATTGG + Intergenic
1115792989 14:36900534-36900556 AATCCCAGTACCATTGTCATTGG - Intronic
1116508099 14:45710091-45710113 AATTCCACCAGCAATGTTACAGG + Intergenic
1118331211 14:64817473-64817495 AATGACACCACCATCTTTGTTGG + Intronic
1118864602 14:69693167-69693189 AAAGCCACTACCACTGCTATAGG - Intronic
1120721607 14:87895074-87895096 AACGAAACCACCATTGTTACCGG - Intronic
1123770730 15:23525793-23525815 AATGTGACCACCAATGTTAGAGG + Intergenic
1126247266 15:46523318-46523340 ACTCCCACCATCAGTGTTATAGG - Intergenic
1126600009 15:50418763-50418785 AATGGCACCAACTTTGTGATTGG + Intergenic
1126702812 15:51383118-51383140 ATGGCCACCAGCATTGTTACTGG + Intronic
1127342428 15:58061824-58061846 AATGCCACTTACATTTTTATAGG - Intronic
1133386227 16:5372342-5372364 ACTCCCACCACCATCTTTATTGG - Intergenic
1134298886 16:12971704-12971726 AATGCCATCATCATTGTTGTAGG + Intronic
1136286702 16:29248392-29248414 AATGCCTTCACCAGTGTTCTGGG - Intergenic
1138393778 16:56689269-56689291 AATGCCCCCACCACTGCCATTGG + Intronic
1146989263 17:37253019-37253041 AAAGCCACCACCATGTTTCTGGG + Exonic
1147494276 17:40901155-40901177 AATGACATCACCATTGTCATTGG + Intergenic
1148630523 17:49104755-49104777 TATGCCACTGCCATTGTCATGGG - Intergenic
1153327210 18:3833074-3833096 AATTACACCACCAATGTAATAGG - Intronic
1159542598 18:69797285-69797307 AATGCCACCATCACTGTAGTCGG + Intronic
1163338266 19:16687772-16687794 AATACCATCACCTTTGTGATAGG + Intronic
1165731066 19:38145087-38145109 ACTGCCACCACCTTTGTTACTGG - Intronic
925048549 2:793274-793296 ACTGGCACCACCCTTGCTATGGG - Intergenic
927058898 2:19394945-19394967 AATGCCAGCACCTTTGTTAAGGG - Intergenic
927382866 2:22499232-22499254 CATGGCAACACCATTGCTATAGG - Intergenic
929624129 2:43388950-43388972 ACTGCCACCACCACTGCTACGGG - Intronic
929752420 2:44729623-44729645 TTTGCCACCAACATTCTTATGGG - Intronic
933193185 2:79359931-79359953 GATGCCATCATCATTCTTATGGG + Intronic
935813583 2:106825145-106825167 CAAGTCAGCACCATTGTTATGGG - Intronic
937190221 2:120088700-120088722 ACTCCCACCAGCAATGTTATTGG + Intronic
938164402 2:129014032-129014054 AATGCAATCAGCATTTTTATAGG + Intergenic
939215589 2:139234153-139234175 AGTGGGACCACCTTTGTTATTGG - Intergenic
942694058 2:178618778-178618800 TATGGCACCACCATTGTCAGAGG + Exonic
942882825 2:180883292-180883314 AATCCCACCAACATTGATGTAGG + Intergenic
948164021 2:235847174-235847196 AATGAAACCACCATTCTTACAGG - Intronic
948583999 2:239007243-239007265 AATGCCAGCAGCATTTTTATGGG - Intergenic
948693410 2:239720871-239720893 AATGCCAGCACCACTGTTGCGGG - Intergenic
1169086456 20:2827891-2827913 AATCCCAGCAGCATTTTTATAGG + Intergenic
1169315542 20:4587680-4587702 AATGCCACCTCCATTCAGATGGG + Intergenic
1172356071 20:34280942-34280964 AATGGCACCAACTTTGTGATTGG - Exonic
1175557209 20:59873855-59873877 AATTCCACGACCACTGTTTTTGG - Exonic
1176597964 21:8764736-8764758 CATGTCACCCCCATTGTTTTGGG + Intergenic
1180760785 22:18202472-18202494 AATCCCATCACCATGGTGATAGG + Intergenic
1180774884 22:18422188-18422210 AATCCCATCACCATGGTGATAGG - Intergenic
1181193786 22:21166070-21166092 AATCCCATCACCATGGTGATAGG - Intergenic
1181193870 22:21166955-21166977 AATCCCATCACCATGGTGATAGG - Intergenic
1181215570 22:21325821-21325843 AATCCCATCACCATGGTGATAGG + Intergenic
1182087612 22:27572231-27572253 AATCCAACCACCATAGTTACTGG + Intergenic
1183057592 22:35316446-35316468 AATGCCAGCACCTTTGTAAACGG - Intronic
949409892 3:3752311-3752333 CAAGACTCCACCATTGTTATAGG + Intronic
949479468 3:4479862-4479884 TATGCCACCACCATTGTGTGAGG - Intergenic
957591554 3:82205560-82205582 ACTGATACCACCATTGATATAGG - Intergenic
959175003 3:102897078-102897100 AATGCCACCTCCTTTGTTTTTGG - Intergenic
959482841 3:106894531-106894553 AATCTCACCATCATTCTTATGGG - Intergenic
959830468 3:110855734-110855756 AAAGCCATGACCATTGGTATGGG - Intergenic
960162903 3:114369706-114369728 AAGGCCACCTTCATTGTCATGGG - Intronic
965113193 3:164452796-164452818 AAAGCAACCACCATAGTTATTGG - Intergenic
966160524 3:176962799-176962821 AATCCCACCTCCATTCTTACAGG + Intergenic
966769230 3:183489198-183489220 TATGCCAGTACCATTGTCATTGG + Exonic
967111693 3:186299273-186299295 AATGCTACCAACATTTTGATGGG - Intronic
969778824 4:9380722-9380744 AATGCCACCAACACTGTTAATGG + Intergenic
970989685 4:22198339-22198361 ACTGCTACCAACAGTGTTATTGG + Intergenic
971002333 4:22337328-22337350 TATCCCACCCCCATTGGTATTGG + Intergenic
973361282 4:49167091-49167113 CATGTCACCCCCATTGTTTTGGG + Intergenic
975445754 4:74463431-74463453 CATGCCACCAGCATTGTTCCAGG - Intergenic
976880914 4:89923946-89923968 AATTACACCACCATTGTTAAGGG - Intronic
978212258 4:106151627-106151649 AATGCCATCAGCATTTTAATAGG + Intronic
982189385 4:152838302-152838324 AATGCCACCATCATTCTTCACGG - Intronic
984481184 4:180304040-180304062 AATACCATCAACATTGATATTGG - Intergenic
984583755 4:181539832-181539854 AATGTCATCAACATTTTTATAGG - Intergenic
985318055 4:188679342-188679364 TATGCTACCTCCATTGTTTTTGG + Intergenic
987185653 5:15415709-15415731 AATGCCACCATAATTGGCATGGG + Intergenic
988978147 5:36536048-36536070 AATGCCACCACGGTTGCCATTGG + Intergenic
989064170 5:37443138-37443160 AATCCCACCCCCTATGTTATAGG - Intronic
990317398 5:54596114-54596136 AATGCCAACAGCATTGCTACTGG + Intergenic
991499517 5:67263266-67263288 AATGCCACCAGAATTTTTAAAGG + Intergenic
991548053 5:67805559-67805581 AGTGCCACCACCTTTATTATAGG - Intergenic
992665637 5:79006163-79006185 AATGACAGCGACATTGTTATAGG + Intronic
994417983 5:99498970-99498992 AATCCCACCCCCTATGTTATAGG - Intergenic
994461982 5:100076183-100076205 AATCCCACCCCCTATGTTATAGG + Intergenic
996123349 5:119695918-119695940 AATGCCAACATCATTCTTAAAGG - Intergenic
997281141 5:132646738-132646760 AATGCCACCACCAATCTGATAGG + Intergenic
1000281994 5:159790131-159790153 AATGGCACCAACACTGTCATTGG - Intergenic
1000457220 5:161465338-161465360 AAGGCCACCATAATGGTTATAGG + Intronic
1001189214 5:169611547-169611569 AATACCACCATCATTCTTAATGG - Intergenic
1005716804 6:28557246-28557268 AATGCCACTCCCATTTGTATTGG - Intergenic
1006664222 6:35678174-35678196 AATGACTCCACTATTCTTATTGG - Intronic
1008068284 6:47073816-47073838 AATGACACCACCATTTAAATCGG - Intergenic
1008494008 6:52114599-52114621 GATGCCACCACCATGAATATGGG + Intergenic
1009989828 6:70828506-70828528 AATCTGACCACCATTGTTGTAGG - Intronic
1011197140 6:84793126-84793148 AACGCCATCCCCATTGATATTGG - Intergenic
1014098561 6:117484698-117484720 AATGCTACCATCTGTGTTATAGG + Intronic
1014906087 6:127029763-127029785 AATGCCACCACAATTCTGAATGG - Intergenic
1015125334 6:129747976-129747998 AATGCCTCCACTTTTGCTATTGG + Intergenic
1018401485 6:163425238-163425260 ATTGCCAGCACCATGGTGATGGG + Intronic
1023067446 7:36392233-36392255 CATGCCACTACCATTTTTAGTGG + Intronic
1023195086 7:37628286-37628308 ATTGCCACCAACAGTGTAATAGG + Intergenic
1023671263 7:42579135-42579157 ACTACCACCACCACTATTATTGG + Intergenic
1026573872 7:71555534-71555556 AATGTGATCACCAGTGTTATAGG - Intronic
1028397191 7:90383714-90383736 AATGAAACCACCATTGCCATAGG - Intronic
1031139364 7:117924866-117924888 AATACCACCACCATTCTTCACGG + Intergenic
1036276264 8:7354685-7354707 AATGCCACCAACACTGTTAATGG + Intergenic
1036345080 8:7955662-7955684 AATGCCACCAACACTGTTAATGG - Intergenic
1036840416 8:12116429-12116451 AATGCCACCAACACTGTTAATGG - Intergenic
1036862206 8:12362666-12362688 AATGCCACCAACACTGTTAATGG - Intergenic
1037266013 8:17061143-17061165 ACTGCCACCACCTTTGTTCAGGG - Intronic
1037689572 8:21170784-21170806 ACTGCTACCACCACTGTTGTCGG - Intergenic
1043704635 8:83332717-83332739 AATTCCAATACCAGTGTTATAGG + Intergenic
1044361677 8:91292838-91292860 AATGGCAACAGCATTGTTGTAGG + Intronic
1047983825 8:130212250-130212272 AATGCCACCACCACTTTCAAAGG + Intronic
1048074931 8:131059458-131059480 AATGCCATCAAAATTGTAATAGG - Intergenic
1051386702 9:16517104-16517126 AAAGACACCACCATCATTATGGG - Intronic
1052411231 9:28124056-28124078 AATGACATCTCCATTGTTGTGGG - Intronic
1058150351 9:101456992-101457014 AATCACACCACCATTGTTTTAGG - Intergenic
1060088467 9:120722042-120722064 AATGGCACCAACTTTGTGATTGG + Intergenic
1060919670 9:127411127-127411149 AATGCCTTCACCATTGGCATTGG + Intergenic
1203555294 Un_KI270743v1:202377-202399 CATGTCACCCCCATTGTTTTGGG - Intergenic
1186727168 X:12369579-12369601 AATGCCACAGGCATGGTTATTGG - Intronic
1187021081 X:15382668-15382690 ACTGCCACCAGCCTTGATATTGG - Intronic
1187922346 X:24217317-24217339 AAGGCCACCACCTTTATTAAAGG + Intergenic
1188146997 X:26626295-26626317 AATGCCACCACTGTTGTGACAGG + Intergenic
1189098997 X:38169901-38169923 AATGTAACCACTATTGTTTTCGG - Intronic
1190171753 X:48116416-48116438 AATGCAACCAGAATTGTTATGGG + Intergenic
1190180821 X:48190855-48190877 AATGCAACCAGAATTGTTATGGG - Intronic
1190183410 X:48213904-48213926 AATGCAACCAGAATTGGTATGGG + Intronic
1190193868 X:48300316-48300338 AATGCAACCAGAATTGGTATGGG - Intergenic
1190199750 X:48350707-48350729 AATGCAACCAGAATTGGTATGGG - Intronic
1190209410 X:48432952-48432974 AATGCAACCAGAATTGGTATGGG + Intergenic
1190655340 X:52607260-52607282 AAAGCAACCAGAATTGTTATGGG - Intergenic
1190658074 X:52629668-52629690 AATGCAACCAGAATTGGTATGGG + Intergenic
1190660384 X:52648973-52648995 AATGCAACCAGAATTGGTATGGG - Intronic
1190666525 X:52701165-52701187 AATGCAACCAGAATTGGTATGGG - Intronic
1190672893 X:52757245-52757267 AATGCAACCAGAATTGGTATGGG + Intronic
1192759881 X:74086007-74086029 AATTCCACCACCATTGCTGTGGG + Intergenic
1194837759 X:98702136-98702158 AATGCCACCACAATTTTATTGGG + Intergenic
1195485408 X:105399192-105399214 ATTGGCACCACCAATGTTTTGGG + Intronic
1196505655 X:116437938-116437960 AATACCTCCACCATTGCTGTAGG - Exonic
1198013386 X:132583425-132583447 CAGGCCACCTCCATTATTATAGG - Intergenic
1198535201 X:137578622-137578644 AATTTTACCAACATTGTTATGGG - Intergenic