ID: 1084665417

View in Genome Browser
Species Human (GRCh38)
Location 11:70573710-70573732
Sequence CTGAGGGTGAGGAGGGGAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1254
Summary {0: 1, 1: 0, 2: 13, 3: 157, 4: 1083}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084665404_1084665417 -1 Left 1084665404 11:70573688-70573710 CCACGCAAGCCCCTGGCTGCCCC 0: 1
1: 0
2: 5
3: 45
4: 451
Right 1084665417 11:70573710-70573732 CTGAGGGTGAGGAGGGGAAACGG 0: 1
1: 0
2: 13
3: 157
4: 1083
1084665403_1084665417 0 Left 1084665403 11:70573687-70573709 CCCACGCAAGCCCCTGGCTGCCC 0: 1
1: 0
2: 0
3: 33
4: 280
Right 1084665417 11:70573710-70573732 CTGAGGGTGAGGAGGGGAAACGG 0: 1
1: 0
2: 13
3: 157
4: 1083
1084665401_1084665417 6 Left 1084665401 11:70573681-70573703 CCACATCCCACGCAAGCCCCTGG 0: 1
1: 0
2: 3
3: 56
4: 719
Right 1084665417 11:70573710-70573732 CTGAGGGTGAGGAGGGGAAACGG 0: 1
1: 0
2: 13
3: 157
4: 1083
1084665407_1084665417 -10 Left 1084665407 11:70573697-70573719 CCCCTGGCTGCCCCTGAGGGTGA 0: 1
1: 0
2: 2
3: 25
4: 293
Right 1084665417 11:70573710-70573732 CTGAGGGTGAGGAGGGGAAACGG 0: 1
1: 0
2: 13
3: 157
4: 1083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084665417 Original CRISPR CTGAGGGTGAGGAGGGGAAA CGG Intronic
900000660 1:13141-13163 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900020377 1:183660-183682 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900278972 1:1853093-1853115 CACAGGGGCAGGAGGGGAAAGGG - Intronic
900397282 1:2458250-2458272 GTGAGGCTGAGGATGGGACAAGG + Intronic
900526104 1:3129586-3129608 CTGAGGGTCAGGACGGGATGGGG + Intronic
900572482 1:3365358-3365380 CTGAGGGTCAGGAAGAGGAAAGG + Intronic
900940408 1:5795047-5795069 GGGAGGGAGAGGAGGGGCAAAGG + Intergenic
901018589 1:6245027-6245049 GGGAGGGAGAGGAGGGGAAGGGG - Intronic
901171706 1:7263226-7263248 GAGAGGCTGAGAAGGGGAAATGG + Intronic
901318547 1:8324794-8324816 CTGAGGGTCCTGAGGGGAGAAGG + Intronic
901337545 1:8464297-8464319 CTGTGGGTGAGGGTGGGCAAGGG - Intronic
901635733 1:10669328-10669350 GCGAGGGTGAGGAGGGGACGGGG - Intronic
901641891 1:10696832-10696854 AGGAAGGTGTGGAGGGGAAAAGG + Intronic
901664807 1:10820088-10820110 CTCAGGGTGAGGAGGAAACAAGG + Intergenic
901712874 1:11129526-11129548 CAGAGAGTGAGGAGGAGAAGTGG - Intronic
901722973 1:11215232-11215254 CTTAGTGGGAGGAGGGGCAAGGG - Intronic
901963809 1:12849398-12849420 CTGAGTGTGAGGCAGGGAAGGGG + Intronic
902192659 1:14774403-14774425 GTGGGTGTGAGAAGGGGAAAGGG - Intronic
902255422 1:15186070-15186092 CTGAGTGGGAGGAGGGGGCAGGG - Intronic
902328978 1:15721250-15721272 TGGAGGGAGGGGAGGGGAAATGG - Intronic
902808263 1:18874122-18874144 CTGAGGCTCAGGAGGAGCAATGG - Intronic
902951950 1:19891596-19891618 TTGGAGGTGAGGAGGGGAGAGGG + Intronic
903057271 1:20644970-20644992 CAGAGGGTGAGGAAGGAGAACGG - Intronic
903949437 1:26987065-26987087 CTGAGAGTGGGGTGGGGAAGGGG - Intergenic
904229744 1:29058670-29058692 CTGAGGGGGTGGAGGGAAAGAGG - Intronic
904354179 1:29927794-29927816 CAGAGGGTGGGGAGGGGAAGTGG - Intergenic
904392103 1:30192808-30192830 TTGAGGGTGAAGAGAGGGAAAGG + Intergenic
904425703 1:30421566-30421588 CTGAGGCTCACTAGGGGAAAGGG + Intergenic
904441656 1:30535722-30535744 GTGAGGGTGGGGAAGGGAGAGGG + Intergenic
904584906 1:31575172-31575194 CTAAGGGTGACTAGGGGTAAAGG + Intergenic
904686826 1:32266702-32266724 GGGAGGGGGAGGAGGGGGAAGGG - Intronic
904686838 1:32266723-32266745 AGGAGGGGGAGGAGGGGGAAGGG - Intronic
904686863 1:32266770-32266792 AGGAGGGGGAGGAGGGGGAAGGG - Intronic
904890515 1:33776210-33776232 CTGAAGATGTGGAGGAGAAAGGG + Intronic
905037121 1:34925511-34925533 CTGAGTGAGGGGAGGGGAGAGGG + Intronic
905483800 1:38281399-38281421 CTGAGAGTGAGGGGGTGAAGGGG + Intergenic
905979638 1:42211890-42211912 CTGGGGGTGAGGAGGGCCAGGGG + Intronic
906273795 1:44501207-44501229 CTGGGGGTGGGGAGTGGGAAGGG + Intronic
906290702 1:44617672-44617694 CTGATGGTGAGGAGTGGAGAGGG - Intronic
906317614 1:44798503-44798525 CTGAGGGGGAGTTGGGGATAGGG - Intergenic
906326667 1:44850439-44850461 CTGTGGGTGAGGTGGGGGAAGGG + Intergenic
906537554 1:46560092-46560114 AAGAGAGTGAGGAGGGGAAATGG + Intronic
906646300 1:47477987-47478009 CTGAGGGTCAGAAAGGGGAAGGG - Intergenic
907030468 1:51166161-51166183 CTGAGGGTGTGGAGGGGGTGGGG - Intergenic
907787594 1:57627823-57627845 CTGAGGGTGGGGTGGGCAACAGG + Intronic
907981003 1:59480767-59480789 CTGAGTTTGAGGCAGGGAAAAGG + Intronic
909445217 1:75742145-75742167 CTGGGGGTGGGGAGGGGGGAAGG - Intronic
909561803 1:77016076-77016098 ATGAGGGGGAGGAGTGGAGAAGG - Intronic
909596710 1:77413864-77413886 CTCTGGGTGAGAAGGGGAAGTGG - Intronic
909786341 1:79618631-79618653 GTGGGGGTGAGGATGGGAGATGG + Intergenic
909893595 1:81037690-81037712 ATGAGGGTGTGGTGGGGGAAGGG - Intergenic
910104825 1:83620527-83620549 ATGAGGGTGAAGAGGAGAAGAGG - Intergenic
910251256 1:85201111-85201133 CTGAGGGGGCGGAGGCGGAACGG - Intergenic
910263689 1:85315912-85315934 ATGAGGGTTTGGAGGGGGAAGGG + Intergenic
910354605 1:86340863-86340885 CTGAGTGTTTGAAGGGGAAAGGG - Intergenic
910542655 1:88378645-88378667 CTGAGGGGGAGGAGGGAACATGG - Intergenic
910745965 1:90575283-90575305 CAGGGGGTGGGGAGGGGGAAGGG + Intergenic
911027223 1:93448300-93448322 CTGTGGGTGAGTCGGGGAGAGGG + Exonic
911140171 1:94492713-94492735 GTGAGGGTAAGTAGGAGAAAGGG - Intronic
912339111 1:108893362-108893384 CTGAGGGGGAAGTGAGGAAATGG - Intronic
912814134 1:112815451-112815473 GTGAAGGTGAGGAGGGGAGAAGG - Intergenic
912823478 1:112885596-112885618 CTGAGGGTGAGCTGGGAAGAAGG - Intergenic
912866545 1:113262856-113262878 CTGTGGCTGAAGAGGGGGAAAGG + Intergenic
912869657 1:113292345-113292367 CGGAGGGGGAGGAGGGGAAAAGG + Intergenic
913013966 1:114713979-114714001 CTGGGGGTGTGGAGGGTAAGGGG + Intronic
913117130 1:115707491-115707513 CTGGGGGTGAGGTGGGGTAGGGG + Intronic
913283001 1:117203234-117203256 CTGAGGCTGGGGTGGGGAGAAGG + Intronic
913379320 1:118191431-118191453 CTGAGGGTTAGGCTGGAAAAAGG - Intergenic
914666327 1:149835824-149835846 CTGAGGTTAAGGAAGGGAAGGGG + Intergenic
914669440 1:149857974-149857996 CTGAGGTTAAGGAAGGGAAGGGG - Intronic
915120954 1:153629279-153629301 CTGTGGCTGATGAGGGGATAAGG - Intronic
915205773 1:154269461-154269483 CTGAGGCTGTGAAGGTGAAATGG - Intronic
915562127 1:156693456-156693478 CTGGGTGGGAGGAGAGGAAAGGG - Intergenic
915597028 1:156901781-156901803 CTGAGGGAGAGGTGGAGAGAAGG + Intronic
915953860 1:160207419-160207441 CTGATGGCGAGGAGGGGAATGGG - Intronic
916065361 1:161132162-161132184 CTGAGGGTGTGAAGGGGAAGGGG - Intronic
916898835 1:169198701-169198723 CTGAGGGTGAGGTGGGAAGTAGG + Intronic
917058689 1:171013000-171013022 ATGAGAGAGAGGAGGGGAGAGGG - Intronic
917133457 1:171765011-171765033 CAGAGGCTGAGGAGGGGAAAGGG + Intergenic
917421249 1:174866079-174866101 GTGAAGGAGAGGAGGGGAGAGGG + Intronic
917591467 1:176480761-176480783 CTGAGGGAGGGGTGGGGAGAGGG - Intronic
917723600 1:177809602-177809624 CTGATGGTGAGTAAGGGAGAAGG - Intergenic
918071050 1:181133662-181133684 GAGATGGAGAGGAGGGGAAATGG - Intergenic
918134240 1:181657266-181657288 CTGAATATGAGGAGGGGAAAGGG + Intronic
919526059 1:198652292-198652314 GGGAGGGAGAGGAGGGGAAGGGG + Intronic
919786275 1:201260290-201260312 GTGTGGCTGAGGACGGGAAAGGG + Intergenic
919920946 1:202166116-202166138 CTGAGGATGAGGAGTGAGAATGG - Intergenic
920199715 1:204252093-204252115 CCGAGGGTGGGGAGGGGCAGGGG - Intronic
920295314 1:204952623-204952645 CTTATGAAGAGGAGGGGAAAAGG + Intronic
920302569 1:204997791-204997813 GACAGCGTGAGGAGGGGAAAAGG + Intronic
920387401 1:205578722-205578744 CTGAGAGAGGGGAGGGGGAAAGG - Intronic
920679647 1:208062736-208062758 CTGGGGGTGAGGGTGGGAGAAGG + Intronic
920855204 1:209656231-209656253 GTGAGGGTGGGGAGAGGAGAAGG - Intergenic
921014852 1:211179837-211179859 CTGAGGGTGGGGCTGGGGAAAGG - Intergenic
921133655 1:212241198-212241220 CTGAAGAAGAGGAGGGGACATGG - Intergenic
921808012 1:219478101-219478123 ATGAGGGTGGGGAGGGGTATTGG + Intergenic
922107783 1:222527328-222527350 CTGAGGGCAAGGAGGTGATAAGG - Intronic
922209889 1:223478954-223478976 GAGAGGGTGAGGAGGTGAGAGGG + Intergenic
922217415 1:223531632-223531654 CAGAGGGTGGGGAGAGGATAAGG - Intergenic
922434292 1:225588185-225588207 AAGAGAGGGAGGAGGGGAAAAGG + Intronic
922479340 1:225928205-225928227 CTGAAGTTGAGGAGAGGAGAGGG + Intergenic
922686155 1:227640112-227640134 CTGAGGATGTGAAGGGGGAAAGG + Intronic
922786933 1:228287516-228287538 CTGAGGGTGAGGGATAGAAAGGG - Intronic
923094127 1:230761256-230761278 CTGTGGCTGAGGAGTGGAAGAGG - Intronic
923143151 1:231178621-231178643 TTCAGTGTGAGGAGGGGAAGTGG - Intronic
923555873 1:235000000-235000022 CTGAGACTGAGGAGGAGGAAAGG - Intergenic
924010662 1:239661895-239661917 CTGTGTGTGAGAAGGGGGAAAGG + Intronic
1063407680 10:5812994-5813016 GTGAGGGGCAGGCGGGGAAATGG - Intronic
1063442982 10:6088797-6088819 CAGATGGTGAGGAGGAGAAGTGG - Intergenic
1063529761 10:6819692-6819714 CTGGGGCTGAGGAGAGGAGAAGG + Intergenic
1063747107 10:8896907-8896929 CAGAGGGGGAGGGAGGGAAAAGG - Intergenic
1063872862 10:10438386-10438408 CTTAAGGTGTGGAGGGGAAGAGG - Intergenic
1063929329 10:11013236-11013258 TTGAGAGAGAGGAGGAGAAAAGG + Intronic
1063940179 10:11120551-11120573 CTTCTGGTGGGGAGGGGAAAGGG - Intronic
1066219006 10:33317234-33317256 ATGAGGGTGAGGTGGGGATAAGG + Intronic
1066473489 10:35722220-35722242 AAGAGGGTGGGAAGGGGAAAGGG - Intergenic
1066789874 10:39050227-39050249 CTGAGGGAGAGGAGTGGCAGTGG - Intergenic
1067031662 10:42882193-42882215 CTGAGGAGGAGGAGGAGGAAGGG + Intergenic
1067544104 10:47179533-47179555 CTAAGGGTGAACAAGGGAAAGGG - Intergenic
1067833777 10:49625450-49625472 CTGAAGGAGAGGAGTGGGAAGGG - Intronic
1069202468 10:65638140-65638162 CAGAGGTTGAGGAGAGAAAAGGG - Intergenic
1069282292 10:66669913-66669935 GTGAGGGTGAGGAGAGGAAGGGG + Intronic
1069616727 10:69811093-69811115 GTGGGAGTGAGGATGGGAAAGGG - Intronic
1069710955 10:70488481-70488503 GAGAGGGGAAGGAGGGGAAAGGG - Intronic
1070157518 10:73844767-73844789 GTGAGGGTGAGGAGGGGCATGGG - Intronic
1070469151 10:76760674-76760696 TTGAGATTGAGAAGGGGAAAAGG - Intergenic
1070839826 10:79476823-79476845 CTGAAGGTGATGAGGGGAAAAGG + Intergenic
1071294176 10:84207248-84207270 CTGAGAGTGAGGAGGAGGAGAGG + Intronic
1071374665 10:84990454-84990476 TTGGGGGGGAGGAGGGGGAAAGG + Intergenic
1071721034 10:88146462-88146484 CAGAGGGTGAGGAATAGAAAGGG - Intergenic
1071945235 10:90636266-90636288 CTGGGGGTGAGGAGCTGAAAAGG + Intergenic
1072158851 10:92747943-92747965 CAGAGGGAGAAGAGGGGGAAGGG - Intergenic
1072835771 10:98710243-98710265 GTGAGGGAGAGAAGGAGAAAGGG - Intronic
1072898080 10:99384481-99384503 GTGAGGGTGGGGAGGGGGAGGGG - Intronic
1073047168 10:100646310-100646332 CTGAGTCCGGGGAGGGGAAAGGG - Intergenic
1073300069 10:102465760-102465782 TTGAGGGTGGGGAGGGCAAGTGG + Intronic
1073678384 10:105675648-105675670 CAGAGGGAGAGAAGAGGAAAGGG - Intergenic
1073925872 10:108514563-108514585 CTGAAGGGGATGAGGGAAAATGG - Intergenic
1074285551 10:112094350-112094372 ATGGTGGTGAGGATGGGAAATGG - Intergenic
1074406486 10:113184060-113184082 ATGAGGGTGAGGGGGTGCAAAGG - Intergenic
1074955775 10:118387777-118387799 CGGACGGTGAGGACGGGAAATGG - Intergenic
1075262880 10:120978104-120978126 CTGAGGGTGGGGAAGGGGAGAGG + Intergenic
1075536308 10:123275016-123275038 CGGAGGGGGCGGCGGGGAAAGGG + Intergenic
1075777704 10:124998973-124998995 CTCTGGCTGAGGAGGGTAAATGG - Intronic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076373186 10:129967786-129967808 CTGAGACTGAGGAGGGGTAAGGG - Intergenic
1076404846 10:130204883-130204905 CTGAGGGTGATGGGGGGAGTGGG + Intergenic
1076595120 10:131620447-131620469 CTAAGGCTGAGGAGGGGATGGGG - Intergenic
1076642545 10:131928601-131928623 CTGAGGCTTAGGAGAGGAAATGG + Intronic
1076699805 10:132265503-132265525 CTGGGTGTGAGGAGAGGACACGG + Intronic
1076760971 10:132605489-132605511 CTGGGGATGGGGAGGGGACAGGG + Intronic
1076827295 10:132975454-132975476 CTGAGGATAAGGAGGGGGTAAGG - Intergenic
1076839835 10:133040568-133040590 CTGAGGGTGAGGTGGGGCAGGGG + Intergenic
1076856292 10:133116926-133116948 CAGAGGGCGGGGAGGGTAAAGGG + Intronic
1076858353 10:133128158-133128180 CTGAGAGTGTGGATGGGAACCGG - Intronic
1077048423 11:556033-556055 CGGATGGAGAGGAGGGGAACGGG + Exonic
1077178210 11:1200089-1200111 CTGAGGGTGAGGCGGGAAAGGGG + Intronic
1077560964 11:3260722-3260744 CTGTGGGAGAGGAGGGTAATTGG + Intergenic
1077566861 11:3306552-3306574 CTGTGGGAGAGGAGGGTAATTGG + Intergenic
1077914434 11:6602102-6602124 CTGAGGAGGAGGAGGAGGAAAGG - Exonic
1077923203 11:6656165-6656187 CTGAGGGAGAAGAGGGGAATAGG - Intergenic
1078004020 11:7518913-7518935 CTGAGGGTTTGAAGGGGAAAGGG + Intronic
1078159413 11:8827958-8827980 CTGGAGGTGGGGAGGGGGAACGG + Intronic
1078452228 11:11448999-11449021 CTGTTTGTGAGGAAGGGAAAGGG - Intronic
1078741999 11:14075427-14075449 CTGTGGGTGGGGAGGGGGAGGGG + Intronic
1078865251 11:15291262-15291284 AGGAGGGTGAGCAGGGGAAAAGG + Intergenic
1079023318 11:16925908-16925930 CTGAGGAGGGGGAGGGAAAAGGG + Intronic
1079661738 11:23046194-23046216 CTGAAGGTGAGGCAGGCAAATGG - Intergenic
1079862315 11:25688746-25688768 CAGAAAGTGAGGAGGGAAAAGGG + Intergenic
1080409073 11:32006244-32006266 TTGGGGGAGAGCAGGGGAAAAGG - Intronic
1080784961 11:35466915-35466937 CATAGGATGGGGAGGGGAAAAGG - Intronic
1080887334 11:36378188-36378210 TAGCGGGTCAGGAGGGGAAATGG + Intronic
1080972465 11:37294841-37294863 TAGAGGGTCAGGAGGGGAGAGGG + Intergenic
1081486939 11:43538058-43538080 CTGAAAGTGAGCAGGGGAAGAGG - Intergenic
1081577509 11:44328363-44328385 CTGGGGGAGAGGAGGGGAAGGGG - Intergenic
1081770227 11:45645794-45645816 CTGAGGGAGAAGTGGTGAAAAGG - Intergenic
1081861585 11:46336091-46336113 CTGAGGGCGAGGAGTGGAAGCGG + Intronic
1081886336 11:46500054-46500076 CTGAGGCCTAGGATGGGAAAGGG + Intronic
1082759417 11:57112676-57112698 CTGAGGAGGAGGAAGAGAAAGGG - Intergenic
1082774519 11:57235265-57235287 CTGAGTGTGAGGCAGGGAATGGG - Exonic
1083273845 11:61586096-61586118 GTGAGGGTGAGGTGGGAATATGG - Intergenic
1083275476 11:61594728-61594750 CTGAGAGTGAGGACGGGGGAGGG + Intergenic
1083424347 11:62575448-62575470 CTCAGGGTGAGGCAGGGAAGGGG - Exonic
1083476669 11:62919857-62919879 CTGAGGCTGAGAAAGGGAAAGGG - Intronic
1084009354 11:66338995-66339017 GTGAGGGTGAGCAAGGGACAGGG - Intronic
1084162292 11:67356465-67356487 CTCATGGTGAGGTGGGGGAAGGG - Intronic
1084394302 11:68898746-68898768 CTGAGGGTGGGGAGGGGAAGTGG - Intronic
1084538608 11:69773631-69773653 CACAGGGTGAGAAGGGGACATGG + Intronic
1084543972 11:69804708-69804730 CTGAGGCTGGGGAGGGGCAGCGG + Intergenic
1084665417 11:70573710-70573732 CTGAGGGTGAGGAGGGGAAACGG + Intronic
1084669041 11:70594593-70594615 CTGAGGGCGGGCAGGGGCAATGG + Intronic
1084912729 11:72404218-72404240 ATGAGGGTGAGGAGAAGACATGG + Intronic
1085052033 11:73384857-73384879 CTGAGGGGGAGGTGGGGGAGAGG + Intronic
1085150249 11:74246691-74246713 CTGGGTGTGGGGAGGAGAAAAGG - Intronic
1085346942 11:75774303-75774325 CTGAGGGTAAGGAAGGGTAGTGG - Intronic
1085561244 11:77474169-77474191 GGGAGGGGGAGAAGGGGAAAGGG - Intronic
1085987224 11:81801627-81801649 ATGAGGCTTAGGAGGGGACAGGG + Intergenic
1086739688 11:90352188-90352210 CTGATGGGGATGAGGGGACATGG - Intergenic
1086917488 11:92547625-92547647 CTGGGGGTGAGAAGGGGAGAGGG - Intronic
1087091852 11:94281703-94281725 CTGGGGGTGAGGAGGGGAGGTGG + Intergenic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1087888925 11:103514311-103514333 CAGAGGCTGGGGAGGGTAAAGGG + Intergenic
1088339251 11:108744589-108744611 TTGAGGGTTAAGAGGGGACATGG - Intronic
1088458987 11:110062957-110062979 TTGAGAGTGTGGAGGGGAATGGG - Intergenic
1088770245 11:113028031-113028053 CAGAGGCTGGAGAGGGGAAAGGG + Intronic
1088835934 11:113577996-113578018 CTGGGGCTGAGAAGGGAAAAGGG + Intergenic
1088920598 11:114257708-114257730 CTGAGGGAGGGGAGGGGAGCTGG - Intergenic
1089151183 11:116365657-116365679 CTCAGGGTGAGGATGGGAGAGGG - Intergenic
1089199409 11:116714790-116714812 CTGAGTGTGGAGAGGGGGAAAGG + Intergenic
1089303483 11:117512602-117512624 CTGAGGGTGGGGAAGGGGGAAGG + Intronic
1089347294 11:117798609-117798631 CTGGGGGAGGGGAGGGGAAGGGG - Intronic
1089479429 11:118792230-118792252 CTGGGGGTGAGGCGGGGGCAGGG + Intergenic
1089614796 11:119689217-119689239 CCCAGGGTGAGGAGCGCAAACGG - Intronic
1090096401 11:123746002-123746024 CTGGGGGTGAGGTTGGGAGATGG + Intergenic
1090879455 11:130820873-130820895 CTGAGGGTGAGGAGGTCAGCTGG - Intergenic
1091027817 11:132157871-132157893 TTGAGGAAGAGGACGGGAAAAGG - Intronic
1091085187 11:132714893-132714915 CTGAGGGCTTGGAGAGGAAATGG + Intronic
1091192931 11:133709247-133709269 CTGAAGGTGGGGAGGGGAGAGGG - Intergenic
1091300504 11:134504160-134504182 GTGTGGGTGGGGTGGGGAAAGGG + Intergenic
1091305344 11:134532685-134532707 CTGAGGGGCAGGACGGGAGATGG + Intergenic
1091308588 11:134557002-134557024 CTGAGAGACAGGAGGGGAGAAGG + Intergenic
1091373758 12:13268-13290 CTGAGGCTGAGGAAGGAAAGGGG + Intergenic
1091395585 12:152439-152461 GTGAGGGAGAGGAGGGCACAGGG + Intronic
1091403703 12:196262-196284 CTGTGGGCCAGGAGGGGAACTGG + Intronic
1091602689 12:1927684-1927706 CTGAGGCTGAGGAGGACAAGGGG + Intergenic
1091683125 12:2540962-2540984 CTGAGGGTCATGAGGGAAAAGGG + Intronic
1091747167 12:2999802-2999824 CTGAGTGTGAGGAGCGGGGAAGG - Intronic
1091816963 12:3446065-3446087 CTGAGGGTGGGGAGGGGGAGTGG - Intronic
1091821652 12:3479950-3479972 GTGAGGGGGAGGATGGGAGAGGG + Intronic
1092554767 12:9545465-9545487 CTGAGGGTGAGAGTGGGCAAGGG + Intergenic
1092556347 12:9566363-9566385 CTGAGAGCCAGGAGGGGAAGAGG + Intergenic
1092648241 12:10603207-10603229 CGGAGGCTGAGGCAGGGAAATGG + Intergenic
1092738804 12:11609301-11609323 CTTAGGCTGAGCAGAGGAAAAGG - Intergenic
1092933269 12:13337201-13337223 CTAAGGGAGAGGCAGGGAAAAGG + Intergenic
1093338949 12:17947847-17947869 GTGAGGGTGAGGAGTAGAAGAGG + Intergenic
1093484863 12:19641677-19641699 CTGTGGGGGAGGAAGGGAAATGG - Intronic
1093841860 12:23912831-23912853 ATGGGGGTGGGGAGGGGAAATGG + Intronic
1094120497 12:26969064-26969086 GAGAGAGTGAGGAGGGAAAAGGG + Intergenic
1094484662 12:30915019-30915041 AGGAGGGTGGGGAGAGGAAATGG - Intergenic
1094515308 12:31122415-31122437 CTAAGGGCCAGGAGGGGAAGAGG - Intergenic
1094515746 12:31124293-31124315 CTGAGAGCCAGGAGGGGAAGAGG - Intergenic
1094517337 12:31145165-31145187 CTGAGGGTGAGAGTGGGCAAAGG - Intergenic
1094655383 12:32414563-32414585 CAGCTGGGGAGGAGGGGAAATGG - Intronic
1094766117 12:33596553-33596575 CTGCGGTTGGGGAGGAGAAAGGG + Intergenic
1095811770 12:46379615-46379637 CTGAGGGAGTGGAGGGGAGGAGG - Intergenic
1096194015 12:49637391-49637413 CTGAGGGGGAAGAGAGGGAATGG - Exonic
1096358884 12:50966503-50966525 CTGAGGGTGTGGAGGTGGGAAGG - Intronic
1096673715 12:53215096-53215118 CTGAGAGGGAGAATGGGAAATGG + Intronic
1096714720 12:53484175-53484197 TTGAGGGGGAGGCTGGGAAATGG - Intronic
1096793889 12:54061967-54061989 AGGAGGGGGAGGAGGGGGAAAGG - Intergenic
1096801883 12:54115789-54115811 CTGGGGGTGAGGATGTCAAACGG + Intergenic
1096816939 12:54207802-54207824 GTGAGGATGAGGTGGGGAAGGGG - Intergenic
1096842429 12:54387897-54387919 TGGAAGGGGAGGAGGGGAAAAGG + Intronic
1096886159 12:54721350-54721372 CTGAGGAGGAGGAGGGGAGGAGG - Intergenic
1096886182 12:54721434-54721456 CTGAGGAGGAGGAGGGGAGGAGG - Intergenic
1097223416 12:57463191-57463213 CTGAGTGAGGGGAGGGGTAAGGG - Intronic
1097275151 12:57808072-57808094 CTGAGGTGCCGGAGGGGAAAGGG + Intronic
1097655920 12:62363386-62363408 GTGAGGGTGAGGATGGAACAAGG - Intronic
1098086797 12:66854212-66854234 GCGAGGGTGAGGAGGAGACAGGG + Intergenic
1098358846 12:69635696-69635718 GTGAGGCTGAGGAGGGGACCAGG + Intergenic
1098582432 12:72116004-72116026 CAGAGGGTAAGTGGGGGAAAGGG - Intronic
1099391017 12:82078465-82078487 CAGAGGGTGAGGTGGGGATGGGG + Intergenic
1099861353 12:88228811-88228833 TTGAGGGTTTGAAGGGGAAAGGG - Intergenic
1100259001 12:92914125-92914147 CTGAGGGTGTGGTGGGGGTAGGG - Intronic
1100535319 12:95503438-95503460 GTGAGGGAGTGGAGGGGAAAGGG + Intronic
1100854633 12:98748287-98748309 CTAAGGGTGAGGAGGTGAGCAGG + Intronic
1101412703 12:104482493-104482515 CTGAGGGTGGGGAAAGGGAAGGG - Intronic
1101706297 12:107224138-107224160 CTGGGGGTGAGGAGTGGAGAGGG + Intergenic
1101710001 12:107256462-107256484 CCCAGGGAGGGGAGGGGAAAGGG - Intergenic
1101998537 12:109542138-109542160 CATAGGGTGAGGGGGTGAAAAGG + Intergenic
1102123167 12:110458971-110458993 CTGAGGGTGAGGAAGGCAGAGGG - Intronic
1102151514 12:110691583-110691605 CTCTGGTTGAGGAAGGGAAAAGG + Intronic
1102527612 12:113522970-113522992 CTGGGGATGAGCAGGTGAAACGG + Intergenic
1102777294 12:115531669-115531691 GTGAGGGTGAGGATGGGAATTGG - Intergenic
1102902473 12:116648941-116648963 TTTAGTGTGGGGAGGGGAAAGGG + Intergenic
1103005643 12:117418121-117418143 AGGAGGGAGAGGAGGGGGAAAGG + Intronic
1103185620 12:118954656-118954678 GAGAGGATGAGGAGGGGACAAGG + Intergenic
1103325383 12:120116785-120116807 CTGAGGAGGAGGAGGGGGAGCGG - Exonic
1103725376 12:122995143-122995165 TTGAGGGTGAGGGTGGGGAATGG - Intronic
1103943919 12:124516031-124516053 CTGGGGGTGACAAGGGGACATGG + Intronic
1104075621 12:125387145-125387167 CTGGGGGTGGGGCGGGGAGATGG + Intronic
1104616350 12:130273290-130273312 AGGAGGGGAAGGAGGGGAAAAGG - Intergenic
1104753107 12:131252296-131252318 GTGAGGGTGATGCTGGGAAATGG - Intergenic
1104973640 12:132542456-132542478 CTGCTGGTGAGGAGGGGTCAGGG + Intronic
1105223707 13:18408378-18408400 CTCAGGTTGAGGAGGGGCCAGGG + Intergenic
1105544117 13:21339435-21339457 GGGAGGGTGAGGAGGGAAAATGG - Intergenic
1105617817 13:22036240-22036262 GGGAGGGTGAGGAGGAGATATGG - Intergenic
1105643520 13:22291072-22291094 CGGAGGCTGAGGTGGGAAAATGG + Intergenic
1105859043 13:24393567-24393589 GAGAGGGTGAGGAGGGGAGGGGG + Intergenic
1106588334 13:31076363-31076385 CAGATGGTGTGGAGGGGAGATGG + Intergenic
1106616279 13:31331561-31331583 CTGGGAATGGGGAGGGGAAATGG + Exonic
1107635440 13:42387747-42387769 AGGAGAGTGAGGAGAGGAAATGG + Intergenic
1107792773 13:44018678-44018700 CTGGGGCCCAGGAGGGGAAAGGG + Intergenic
1108270128 13:48751265-48751287 CTGAGGGTGAAGAGAGCACATGG - Intergenic
1108610958 13:52083466-52083488 CTGAAGCTGTGGCGGGGAAAAGG - Intronic
1110149945 13:72239123-72239145 CTGAGGAGGAGTAGGGTAAAGGG - Intergenic
1110788998 13:79566861-79566883 GTGAGAGGGAGGAGGGGAGAAGG - Intergenic
1111739965 13:92192070-92192092 CTAAGGGTTAGGAGGTGAAGGGG + Intronic
1111876381 13:93902220-93902242 CAGAGGCTGAGGAGGGGAGAGGG - Intronic
1112601309 13:100858288-100858310 CAGAGGCTGAGGAAGGAAAATGG - Intergenic
1113122280 13:106936241-106936263 AGGAGGGAGAGGAGGAGAAAAGG + Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113740959 13:112712130-112712152 CTCAGGGTGGGGAGGGAGAACGG - Intronic
1114057246 14:18982153-18982175 CTGAGGCTGAGGAGGGGGATTGG + Intronic
1114105300 14:19419593-19419615 CTGAGGCTGAGGAGGGGGATTGG - Intronic
1114237452 14:20835195-20835217 CTGAGGGTTTGAAGGGGGAAGGG + Intergenic
1114864809 14:26577007-26577029 ACCAGGGTGGGGAGGGGAAATGG - Intronic
1114899793 14:27043415-27043437 CTGTGGGTGAAGAAGGAAAAGGG + Intergenic
1116267498 14:42712505-42712527 ATGAGGGCCAGCAGGGGAAATGG + Intergenic
1116627639 14:47286381-47286403 CAGAGGGTGGGAAGGGGAATAGG - Intronic
1116665125 14:47764851-47764873 CTGAGGAGGAGGAGGAGGAAGGG + Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117525582 14:56599235-56599257 CAGAGGGACAGGAGGGCAAAAGG - Intronic
1117636505 14:57750037-57750059 CTCAGGGTGAGGAGATGAGAGGG - Intronic
1117994442 14:61466094-61466116 TTGAGGCTGGGGAGGGGAACGGG - Intronic
1118030431 14:61812925-61812947 CCAAGGGTGAGGAGCGGAGAGGG - Intergenic
1118345714 14:64939312-64939334 CAGAGGGTTGGGAGAGGAAAAGG + Exonic
1118411137 14:65479607-65479629 AAGAGGGAGAGCAGGGGAAAGGG - Intronic
1118678160 14:68211210-68211232 CACTGGGTGGGGAGGGGAAAGGG - Intronic
1118776264 14:68976261-68976283 GTGAGTGTGAGGAGGGGAAGAGG - Intronic
1118985888 14:70754574-70754596 CTGAGGCTGAGGCGGGAGAATGG - Intronic
1119328817 14:73778665-73778687 GGGAGGCTGAGGAGGGGACATGG + Intronic
1119339363 14:73863193-73863215 GGTGGGGTGAGGAGGGGAAATGG - Intronic
1119365602 14:74089065-74089087 CCGGGGGTGTGAAGGGGAAAGGG + Intronic
1119464978 14:74849977-74849999 CTGAGGATAAAGTGGGGAAAGGG + Intronic
1121120912 14:91375472-91375494 ATGTGGGTGAGGTGGGGAAGAGG + Intronic
1121234118 14:92379901-92379923 GTGAGGGTGGAGAGGGGAGAGGG - Intronic
1121310560 14:92933158-92933180 CTGGGGGCCAGGAGGGGACACGG - Intronic
1121445167 14:93974042-93974064 CTGCAGGTGAGGAGGGGCTATGG - Intronic
1121504012 14:94462420-94462442 CTGAGAGTGAGGATAGGACAAGG - Intergenic
1121709464 14:96026843-96026865 CTGAGGGTGCAGAGGGAACATGG + Intergenic
1122050986 14:99059658-99059680 CTGGGGATAAGGAGGGGAATAGG - Intergenic
1122602826 14:102929907-102929929 CTGAGGCTGGGGAGGGGGACGGG - Exonic
1122679933 14:103451895-103451917 CTGCGGGAGAGGAGAGGACACGG - Intronic
1122738932 14:103859645-103859667 TTGAGGGTGGGGAAGGGAAAGGG + Intergenic
1122882537 14:104696569-104696591 CTGAGTGTGAGGGAGGGGAATGG + Intronic
1122892959 14:104741540-104741562 GTGGGGGTGAGGACGGGATATGG - Intronic
1123103235 14:105819651-105819673 CCGTGGGTGGGGAGGGCAAATGG + Intergenic
1123498187 15:20851931-20851953 CTGAGGCTGAGGAGGGGGATTGG - Intronic
1123555418 15:21425559-21425581 CTGAGGCTGAGGAGGGGGATTGG - Intronic
1123591661 15:21862890-21862912 CTGAGGCTGAGGAGGGGGATTGG - Intergenic
1124020567 15:25918590-25918612 CAGAGGGTGAGAAGGAGAAGGGG - Intergenic
1124364807 15:29063934-29063956 CTGGGGGTGAGGTCGGGTAAGGG + Intronic
1124463363 15:29913732-29913754 TTGAGGGAGAGGAAGGGAGAGGG + Intronic
1125500692 15:40238908-40238930 CTGAAGGGGAGGAGGAGGAAGGG - Intronic
1126533472 15:49734930-49734952 ATGAGGGTGAGGGGGTGATATGG - Intergenic
1126540516 15:49817293-49817315 CTGAGGTCAAGGAGGGGAGAGGG + Intergenic
1126663352 15:51053585-51053607 CTGAGGGCAAGGTGGGGAGAAGG - Intergenic
1127133228 15:55890353-55890375 CTGAAGGAGGGGTGGGGAAATGG - Intronic
1127188351 15:56504930-56504952 CTCAGGGAGAGGAATGGAAAAGG + Intergenic
1127500908 15:59553447-59553469 CTGAGAGGGAGGAGAGGAGATGG + Intergenic
1127578145 15:60312623-60312645 GTGGAGGTGAGGAGGAGAAAAGG + Intergenic
1127635692 15:60867245-60867267 CTGAGCCTGAGGAGGGGTACTGG + Intronic
1128072832 15:64807989-64808011 CTGCGGGGGAGGAGTGGAGATGG + Intergenic
1128096332 15:64959178-64959200 CTGAGGGGCAGGAGGGGGAGGGG + Intergenic
1128107580 15:65055929-65055951 TTCATGGTGAGGAGGGCAAAAGG + Intronic
1128515172 15:68337519-68337541 CGGAGGAGGAGGAGGAGAAAAGG + Intronic
1128556936 15:68638182-68638204 CTGAGGGTCAGGAGGAGGGAGGG - Intronic
1128578420 15:68791745-68791767 CAGAGGGGAAGGAGGGGACAGGG + Intronic
1128747351 15:70123873-70123895 CTAAGGATAAGGAGGGGCAAAGG - Intergenic
1128798867 15:70484398-70484420 CTCAGGGTGGGGAGTGGAATGGG - Intergenic
1129018806 15:72495206-72495228 CAGAGGCTGAGTGGGGGAAATGG + Intronic
1129205975 15:74037197-74037219 CTGAGGGTGAGGCTGGGACAAGG - Intronic
1129450243 15:75647566-75647588 CGGAGGGAGAGGAGGGGAGGTGG + Intronic
1129674244 15:77623684-77623706 CTGAGGAGGAGGAGGGGAAAGGG - Intronic
1129792674 15:78351994-78352016 CTGGGGGTTTTGAGGGGAAATGG + Intergenic
1130174398 15:81553288-81553310 TCGACGGTGAGGAGAGGAAATGG - Intergenic
1130298275 15:82662427-82662449 GTGAGGGTGAGTGGGGGAAAGGG - Intronic
1130392733 15:83473290-83473312 CCAGGGGTGAGGAGGGGAGAGGG + Intronic
1130510708 15:84587051-84587073 GAGAGGATGGGGAGGGGAAAAGG - Intergenic
1130635858 15:85619269-85619291 CTGCGGGTGCGGAGCTGAAAGGG + Intronic
1130877588 15:88028039-88028061 GTGAGGGTGAGGAGGGAAAATGG + Intronic
1130931694 15:88433178-88433200 ATGAGGGTGAAGAGGTGAAGAGG - Intergenic
1131048144 15:89329111-89329133 CTGAGGAGGAGGAGGAGAAAAGG + Intronic
1131078038 15:89510685-89510707 TTGGGGGTGAGGAAGGGAGAGGG + Intergenic
1131579217 15:93625599-93625621 CTGAGGGGGAGGAAGAGGAATGG + Intergenic
1132162318 15:99554332-99554354 CTGTGGGTGAGGTGGGGAGTGGG - Intergenic
1132452847 15:101977804-101977826 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1202963762 15_KI270727v1_random:152769-152791 CTGAGGCTGAGGAGGGGGATTGG - Intergenic
1132454050 16:12822-12844 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1132868435 16:2104945-2104967 CTGGGGGGGAAGAAGGGAAAGGG + Intronic
1133041898 16:3065343-3065365 CTGAGAGTGGGGAGGGGCAGAGG - Intronic
1133083037 16:3338640-3338662 GGGAGGGTGAGGAAGGGGAATGG - Intergenic
1133235543 16:4385787-4385809 GTGAGGATGAGGAGGGGACGGGG + Intronic
1133520152 16:6549183-6549205 GGGAGGAGGAGGAGGGGAAAAGG + Intronic
1133707601 16:8369994-8370016 TTGGGGGTGAAGAGGAGAAAAGG + Intergenic
1133741658 16:8656377-8656399 CTGTGGGGGAAGTGGGGAAAAGG - Intergenic
1133857474 16:9563307-9563329 CTGGGGCTGGGGATGGGAAAAGG + Intergenic
1134014217 16:10877474-10877496 ATGGGGGTGAGGATGGGAACAGG + Intronic
1134166431 16:11933717-11933739 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1134494282 16:14720012-14720034 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1134499663 16:14759132-14759154 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1134526211 16:14945759-14945781 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1134546197 16:15110614-15110636 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1134580913 16:15369912-15369934 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1134713789 16:16344230-16344252 GTGAGAGTGAGGAGAGGAGAAGG - Intergenic
1134721659 16:16387584-16387606 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1134841561 16:17405828-17405850 CTGAGGGCAGGGAGGGGAAATGG - Intronic
1134945767 16:18324291-18324313 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1134953028 16:18364427-18364449 GTGAGAGTGAGGAGAGGAGAAGG + Intergenic
1135293964 16:21263510-21263532 CCGGGGGTGAGGAGAGGGAAAGG - Intronic
1135311822 16:21411134-21411156 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1135447069 16:22527751-22527773 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1135914572 16:26594069-26594091 CTGGGGGTGAGGGAGGGAAGGGG + Intergenic
1136150991 16:28349034-28349056 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1136167225 16:28462874-28462896 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1136187544 16:28597017-28597039 CTGCGGGCGAGGAGGGCACAAGG - Intronic
1136195752 16:28652142-28652164 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1136212090 16:28766267-28766289 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1136256809 16:29046195-29046217 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1136284514 16:29233265-29233287 CTGGGGGTGAGGAGGTGATGAGG + Intergenic
1136308526 16:29390141-29390163 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1136321941 16:29491667-29491689 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1136366849 16:29812947-29812969 CTTGGGGTGAGGAGGGAAGAGGG - Intronic
1136407631 16:30057734-30057756 CTGAGGGGCAGAAGGGCAAAAGG + Intronic
1136436622 16:30231640-30231662 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1136591902 16:31222804-31222826 CTGGGGGTGGGGAGGGGAAGGGG - Intronic
1137295518 16:47089076-47089098 CTTACAGTGAGGAGGGGGAAGGG - Intronic
1137431451 16:48421112-48421134 CTGCTGGTGAGAATGGGAAATGG + Intronic
1137568533 16:49549509-49549531 CTGGAGGAGAGGAGAGGAAATGG - Intronic
1137578796 16:49621125-49621147 GTGAAGGGGAGGTGGGGAAAGGG + Intronic
1137586276 16:49665618-49665640 CTGAGAGTGAGGAGCGGAGGAGG - Intronic
1137933560 16:52611531-52611553 GTGAGGCTGAGAAGGGGAATAGG - Intergenic
1138027554 16:53534363-53534385 CTGAGGGTGAGCTGTGGGAAGGG + Intergenic
1138116059 16:54361632-54361654 CTGAAGGGGAGGAGGGGAAGTGG + Intergenic
1138448316 16:57078250-57078272 CTGAGGCTGAGAAGGGGCAGGGG - Intronic
1138537311 16:57666922-57666944 GTGAGGGTGAGGTGGGGCAGTGG - Intergenic
1138773075 16:59687855-59687877 TTGAGAGTGAGGAGGGGCTAGGG - Intergenic
1138995651 16:62449502-62449524 CTGAGAGGGAGGAGAGGAAGTGG - Intergenic
1139008852 16:62607742-62607764 GTGGGGGTGGGGTGGGGAAATGG - Intergenic
1139010794 16:62631458-62631480 GTGAGGTGGAGGAGGGGGAAGGG - Intergenic
1139856227 16:69982550-69982572 GTGAGAGTGAGGAGAGGAGAAGG + Intergenic
1139908654 16:70383087-70383109 CTGAGGTTCTGCAGGGGAAATGG + Intronic
1140177663 16:72679958-72679980 TGCAGGGTGAGGAGGGGGAATGG + Intergenic
1140366501 16:74385527-74385549 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1140469635 16:75206851-75206873 CTGGGGGTGAGGAAGGGGAGCGG + Intronic
1141053914 16:80798412-80798434 CTGAGGAGGAGGAGGAGGAAGGG - Intronic
1141445443 16:84055042-84055064 CTGAGTGGGAGGAGGAGAAAGGG + Intronic
1141638467 16:85328212-85328234 CTGTGGAGGAGGAGCGGAAAGGG - Intergenic
1141729914 16:85815194-85815216 CAGGGGCTGGGGAGGGGAAATGG - Intergenic
1142089549 16:88202778-88202800 CTGGGGGTGAGGAGGTGATGAGG + Intergenic
1142596810 17:1033760-1033782 CTGAGGGGGAGGTGGAGAGACGG + Intronic
1143071188 17:4294954-4294976 GAGAGGGAGAGAAGGGGAAAAGG + Intronic
1143564924 17:7715570-7715592 CAAAGGCTGAGGAGGGGGAAAGG - Intergenic
1144049338 17:11485248-11485270 CTGCGGCAGAGGAGGGGAAGAGG + Intronic
1144095173 17:11893706-11893728 GTCAGGGGGTGGAGGGGAAAGGG + Intronic
1144361295 17:14496765-14496787 CTGATGGGGAGGAGGGGGACTGG + Intergenic
1144701654 17:17344517-17344539 CTGGGTGTGAAGAGGGGACAGGG + Intronic
1144797158 17:17899868-17899890 AGGAAGTTGAGGAGGGGAAAGGG + Intronic
1145806139 17:27732398-27732420 CTTGGGTTGAGGATGGGAAAGGG + Intergenic
1145898083 17:28472277-28472299 GTCAGGGTGAGGAGGGGTGAGGG + Intronic
1145898369 17:28473964-28473986 CTGAGGGCTAGGAGGTCAAAGGG + Intronic
1146153846 17:30502184-30502206 CAGGGGTTGAGGATGGGAAATGG + Intronic
1146884013 17:36459013-36459035 CTGAGGCTGAGGAAGGTGAAGGG + Intergenic
1146947686 17:36884946-36884968 CTGAGGGTGAGGAGGGGCCCGGG - Intergenic
1147002924 17:37377845-37377867 CAGAGGGGGAGGAGGGGAACCGG - Intronic
1147130525 17:38405228-38405250 CTGAGGGTGGGATGGGGAAAGGG + Exonic
1147206173 17:38839177-38839199 CAGAGTCTGGGGAGGGGAAAAGG - Intronic
1147357065 17:39906469-39906491 CTGGGGGTGAGCTGGGGAGATGG - Intronic
1147401210 17:40180974-40180996 ACGGGGGTGTGGAGGGGAAAGGG + Intronic
1147755939 17:42767851-42767873 CTGAGGGAGAGGAGAGGTTAGGG + Intergenic
1148162577 17:45459273-45459295 CTGAGAGTGGCCAGGGGAAATGG - Intronic
1148235181 17:45964002-45964024 CTCTGGGTGAGGAGGTGAGAGGG + Intronic
1148405989 17:47416569-47416591 GGGAGGGGGAGAAGGGGAAAGGG - Intronic
1148807708 17:50272551-50272573 CTGCAGGGGAGGAGGGGAGACGG + Intronic
1148848214 17:50541328-50541350 CTGTGGGTGAGCAGGGCAAGGGG + Exonic
1149414371 17:56443517-56443539 CTGCGGGTGAGGAAGGGAAGAGG - Intronic
1149432510 17:56605636-56605658 CTGAGGGCGAGGATGGAAGATGG - Intergenic
1149579740 17:57741274-57741296 CTGAGAGTGGGGAGGAGAAATGG + Intergenic
1149625499 17:58077628-58077650 CTGACAGTGAGGTGGGGAATGGG - Intergenic
1149833827 17:59894467-59894489 CTGAGGGTGAGGCAAGGGAAAGG - Intronic
1149960468 17:61104205-61104227 CTGTGGGTGGGGAGGTGGAATGG - Intronic
1150185751 17:63179774-63179796 GGGAGGGTGAGGGGAGGAAAGGG - Intronic
1150286857 17:63959528-63959550 CTGCGGGGGCGGAGGGGAAGGGG + Intronic
1150291217 17:63983456-63983478 CTGTGGGTGGGGACGGGAAGGGG + Intergenic
1150393806 17:64805937-64805959 CTGAGAGTGGCCAGGGGAAATGG - Intergenic
1150621078 17:66808072-66808094 TTCAAGGTGGGGAGGGGAAAGGG - Exonic
1150947568 17:69765300-69765322 CTGGGGGAGGGGAGGGGGAAGGG - Intergenic
1150984032 17:70175218-70175240 ATGTGGGTGAGAAGGGGCAACGG + Exonic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151469021 17:74306333-74306355 ATGAAGGGGAGGAGGAGAAAGGG - Intronic
1151740945 17:75981615-75981637 CTGAGGGAGAGGAGGACAGAAGG - Intronic
1151829438 17:76540918-76540940 CAGAGGAGGAGGAGGGGGAAGGG - Intronic
1151830064 17:76544349-76544371 CTGAAGGGAAGGAAGGGAAAGGG + Intronic
1152003469 17:77662110-77662132 CTGAAGGAGTGGAGGGGACAAGG - Intergenic
1152072195 17:78139370-78139392 CTGAGAGTGAAGACGGGGAAGGG + Intronic
1152098218 17:78285253-78285275 CTGGGGGAGGGAAGGGGAAATGG + Intergenic
1152238384 17:79149971-79149993 CTGAGGGTGGGGATGGGGATGGG + Intronic
1152271163 17:79325706-79325728 CGGAGGGGGAGGTAGGGAAAGGG - Intronic
1152493042 17:80650729-80650751 ATGAGGGAGAGGAAGGGATAAGG - Intronic
1152599201 17:81253036-81253058 CTGGGGGTGCGGATGGGGAAGGG - Intronic
1152766410 17:82142633-82142655 ATGATGGTGAGAAGGAGAAATGG + Intronic
1203170144 17_GL000205v2_random:140874-140896 CTGAGGGGGAGTGGGGGTAAGGG - Intergenic
1153833681 18:8945255-8945277 CTGAGGGAGAGGAAGGGACCAGG + Intergenic
1153985646 18:10348628-10348650 CTGGGAGTGAGGAGTGGGAAGGG + Intergenic
1154117699 18:11625776-11625798 GTGAGAGTGAGGAGAGGAGAAGG + Intergenic
1154456189 18:14528356-14528378 CTGAGGCTGAGGAGGGGGATTGG - Intronic
1154529597 18:15330695-15330717 CTCAGGTTGAGGAGGGGCCAGGG - Intergenic
1155428981 18:25735869-25735891 CGGAGGGTGAGGATGGGGCAGGG - Intergenic
1155454430 18:25996260-25996282 CAGAGGCTGAGGCGGGAAAATGG + Intergenic
1155541036 18:26868522-26868544 CTGAGGGCAAGGATGGGAGAAGG - Intergenic
1155763205 18:29591734-29591756 CTGTCGGGGAGTAGGGGAAAAGG + Intergenic
1155856055 18:30836301-30836323 GGGACTGTGAGGAGGGGAAATGG - Intergenic
1156108271 18:33691969-33691991 CTGAGGGTCAGGGAGGAAAAAGG + Intronic
1156147702 18:34205743-34205765 CCCAGAGTGAGGAGGGGATAGGG - Intronic
1156500414 18:37554061-37554083 TTGTGGCTGAGGAGGGGAGAGGG + Intronic
1156511234 18:37638390-37638412 TTGAGGGTGAGGAGGGAAATGGG + Intergenic
1156577057 18:38329352-38329374 CTCAGGGTGAGTGGGGGAAGAGG - Intergenic
1157300080 18:46472941-46472963 CTCAGAGCCAGGAGGGGAAAAGG + Intergenic
1157446701 18:47751624-47751646 GTGTGGATGAGGAGGGGACAAGG + Intergenic
1157604992 18:48920771-48920793 ATGAGGGAGAGGAGGGGCAGGGG + Exonic
1157753578 18:50198665-50198687 CTAGTGGTGAGGAGGAGAAAGGG - Intergenic
1158312206 18:56170971-56170993 CTGGGGTTGGGGAGGGGGAAAGG + Intergenic
1159346448 18:67212864-67212886 CTGAGGGTGAAGATGGGAGGAGG - Intergenic
1159704174 18:71666073-71666095 AGAAGGATGAGGAGGGGAAAGGG + Intergenic
1159943429 18:74426176-74426198 CTGAGGGTGGGAAGTGGAGAGGG - Intergenic
1160242650 18:77133952-77133974 CTGAAGGTGAGGAGGGAAAAGGG + Intergenic
1160381825 18:78463512-78463534 ATGTTGGTGAGGAGGTGAAATGG - Intergenic
1160788937 19:913807-913829 CTGAGGCTAAGCAGGGGAAGGGG - Intergenic
1160983468 19:1827149-1827171 CTGAGGCTGGGGAGGGCAGAGGG + Exonic
1161028275 19:2046572-2046594 CCGAGGGGGAGGAGGGCACAGGG - Intronic
1161238823 19:3210730-3210752 GTGAGGGTGGGGAAGGGACAGGG + Intergenic
1161360586 19:3847152-3847174 ATGAGGGAGAGCAGGGGAGAGGG + Intronic
1161402239 19:4071977-4071999 CAGAGGCTGGGGAGGGGAATGGG + Intergenic
1161410324 19:4113383-4113405 CTGAGGGTGTGCAAGGGGAAAGG + Intronic
1161719756 19:5896239-5896261 GGGAGGGTGGGGAGGGGACAGGG + Intronic
1161734633 19:5983950-5983972 CTGTGGGTGAGGAATGGGAAGGG - Intergenic
1161791198 19:6361435-6361457 TTAAGGGTGAGGCGGGGATAGGG - Exonic
1161814944 19:6494344-6494366 TTGAGGGTGAGGCAGGGAAGCGG + Exonic
1162017368 19:7852902-7852924 CTGAGCGTGAGGGGAGGGAATGG - Intronic
1162054172 19:8052949-8052971 CTGAGGAAGAGGAGGGGAGTGGG - Intronic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162520326 19:11175821-11175843 CTGAGGATGAGGAGAGGCCACGG + Intronic
1162566130 19:11446618-11446640 GTGTGGGGGAGGAGGGGAATAGG - Intronic
1162584581 19:11551283-11551305 CAGACTGTGGGGAGGGGAAAGGG + Intronic
1162727573 19:12699321-12699343 AAGAGGGTGAGGAGGGAAAGAGG + Exonic
1163029850 19:14537086-14537108 CTGAGGAGGAGGAGGGGGCAGGG + Intronic
1163164027 19:15483097-15483119 CTGAGGGGGAGGAAGGGAAGGGG - Intronic
1163262479 19:16199559-16199581 CTGAGAGTGAAGAGGTGAAATGG + Intronic
1163455644 19:17404354-17404376 TTGAGGGTGAGAAAGGGAGAAGG - Exonic
1163894422 19:20045224-20045246 TTGAGATTGAGGATGGGAAATGG + Intergenic
1164531485 19:29051656-29051678 TTGAGGGTGTGGAGGGGAGGAGG - Intergenic
1164534790 19:29077007-29077029 CTGAGTGTGTGGTGGGGGAAAGG - Intergenic
1164543442 19:29139716-29139738 CAGAGGCTGAGGAAGGGAGATGG + Intergenic
1164583141 19:29447564-29447586 CAGAGGGTTAGAAGGGGAGAGGG - Intergenic
1165343310 19:35227547-35227569 CTGGGGGAGAGGAGGGGAAGGGG + Intronic
1165427300 19:35753240-35753262 CTGAGGATGAGGAGGTGGGATGG + Exonic
1165728505 19:38129294-38129316 CTGAGGAGGAGATGGGGAAAGGG + Intronic
1165742073 19:38210649-38210671 CTGAGGCTGGGGTGGGGAACGGG - Intergenic
1165808400 19:38596044-38596066 CTGGGGGTGGTGTGGGGAAAGGG - Intronic
1165885705 19:39076710-39076732 CAGGGGGTGAGGAGGGGGACAGG + Intergenic
1165898715 19:39158447-39158469 CTGAGGCTGGGCAGGGGGAAGGG - Intronic
1165993448 19:39828584-39828606 CTGCGGGGGAGGGGAGGAAATGG + Intronic
1166144862 19:40826772-40826794 CTGAGGGTGAAGAATGGAATGGG + Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166225452 19:41392258-41392280 CTGAGGGATATGAGGGTAAAAGG + Intronic
1166527858 19:43524415-43524437 CTAAGGCTGAGGGGGGAAAAGGG + Intronic
1166567774 19:43775661-43775683 GAGAGGGGGAAGAGGGGAAAGGG + Intronic
1166568620 19:43779969-43779991 TTGGGGGTGGGGATGGGAAATGG - Intronic
1166704602 19:44901630-44901652 CTGAGGCTGAGGCGGGAAAATGG + Intronic
1166721939 19:45001847-45001869 CAGAGGGTGATGAGGGGGTACGG + Intronic
1167077936 19:47260450-47260472 CTGAGGATGGGGAGGGGCAGAGG + Intronic
1167253507 19:48414188-48414210 CTAAGAGGGAGGAGGGGACAAGG + Intronic
1167401049 19:49269695-49269717 CTGAGGGAGAGGAGGAGGAAGGG - Intergenic
1167502090 19:49854202-49854224 CTGAGGGTGGGCAGCGGGAAAGG + Intronic
1167705325 19:51078160-51078182 CTGAGGGGGAGGAACAGAAATGG + Intronic
1167751361 19:51382310-51382332 TTGAGTGTGAGGAGGAGTAAGGG + Intronic
1167793551 19:51694747-51694769 CTGAAGGTGGTGAGGGGGAAGGG + Intergenic
1168110201 19:54188173-54188195 GAGAGGGAGAGGAGGGGAGAGGG - Intronic
1168153331 19:54460548-54460570 GTGAGGGTGAGGGGGGCACAGGG + Intronic
1168286931 19:55339935-55339957 CTGAGGAGGAGGAGGAGAAGCGG + Exonic
1168401342 19:56087688-56087710 CTGAGGAAGAGCAGGGAAAATGG + Exonic
1168411272 19:56141617-56141639 CTGAGGGAGAGGACGGGGGAGGG + Intronic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925146295 2:1585378-1585400 CAGAGGGTGAGGAGGCCAAGAGG - Intergenic
925539986 2:4956497-4956519 CTGGGGGTGCTGAGGGGAATGGG + Intergenic
925737171 2:6973573-6973595 GTGAGGATGAGGTTGGGAAAGGG + Intronic
925777633 2:7350165-7350187 CTGAGGGAGATGAGGGACAAGGG + Intergenic
925902081 2:8515927-8515949 AGGAGGAGGAGGAGGGGAAAGGG - Intergenic
926153331 2:10436456-10436478 CTGGGGGTGAGGGGGGCAAGTGG - Intergenic
926339697 2:11894846-11894868 CTGAGGGTAAGGAGGTGGGAAGG + Intergenic
926783244 2:16495026-16495048 GGGAGAGTGAGGTGGGGAAAGGG + Intergenic
927113433 2:19880195-19880217 GTGAGGGTGAGTAAGGCAAAAGG + Intergenic
927232068 2:20833930-20833952 CGGAGGCTGAGGCGGGGGAACGG + Intergenic
927288623 2:21382434-21382456 AGGAGGGTGAAGAGGGGAGAGGG + Intergenic
927330610 2:21858909-21858931 CAGAGGATGATGAGGGGAAGAGG + Intergenic
927332844 2:21886276-21886298 CTGAAGGTGAGGAAAGAAAATGG - Intergenic
927507054 2:23621474-23621496 AGGAGGGTGAGGAGAGGTAAGGG + Intronic
927951680 2:27174466-27174488 CAGTGGGAGAGGAGGGGTAAGGG - Intergenic
928021175 2:27706270-27706292 CTGAGGGTGGGGAGGTGGGAGGG + Exonic
928083931 2:28334006-28334028 CGGAGTGGGAGGAGGGGGAAAGG - Intronic
928251142 2:29681760-29681782 ATGAGGTTGAGGGGGGGAAGGGG - Intronic
928265271 2:29805990-29806012 ATGTGAGTGAGGAGGTGAAATGG + Intronic
928287345 2:30004439-30004461 GTGGGGGTGAGGAGGAAAAAAGG - Intergenic
928294044 2:30067095-30067117 CTGAGGGTTAGTGGGGGAAGTGG + Intergenic
928570976 2:32608387-32608409 CAGAGGGAGAGGAGAGGAAAAGG - Intronic
928703308 2:33921086-33921108 CTGAGAGTGAGGAGGAGAAAAGG - Intergenic
929533850 2:42768298-42768320 CTCAGGAGGAGGAGGGGACAAGG + Intronic
929949111 2:46392923-46392945 CTGGAGGTGAGGAGGGGTGAAGG + Intergenic
930002892 2:46873184-46873206 CTGAGGATGAGAAGGAGGAATGG - Intergenic
930534554 2:52630139-52630161 CTGGGGGTGGGGCGGGGACAGGG - Intergenic
930578782 2:53184844-53184866 GAGAAGGTGAGGAAGGGAAAAGG - Intergenic
930842651 2:55864662-55864684 ATGAGGGTGGGGAGGGGTGAGGG + Intergenic
931214446 2:60228146-60228168 CTCAGCGTGAGGAGGGGGAGGGG - Intergenic
931443620 2:62308512-62308534 CTGAGAGAGAGGAAGGAAAAGGG + Intergenic
931969466 2:67569606-67569628 GTGAGGGTGAGGTGAGGAATGGG - Intergenic
932209764 2:69917097-69917119 ATGAGGGTGAGGGAGGGATAAGG - Intronic
932217427 2:69976006-69976028 CTGGGGGTGGGGTGGGGAAGGGG - Intergenic
932331234 2:70899682-70899704 CCGAGGCTGAGGAGAGGTAAAGG - Intergenic
932495978 2:72146016-72146038 CTGGAGGTGAGGAGGGAAATAGG - Intronic
932582265 2:72999720-72999742 TTGGGGGAGAGGAGGGGAATAGG - Intronic
933538691 2:83610621-83610643 CTGAGGCTGGGGTGGGGAAAAGG + Intergenic
933580454 2:84120214-84120236 ATGGGGGTGAGGAGAGGAAAGGG + Intergenic
933947766 2:87301546-87301568 GTGAGGGTGAGGAGGCGGACAGG + Intergenic
934652370 2:96099883-96099905 GGGAGGGGGAGGAGGAGAAAGGG + Intergenic
934689325 2:96346258-96346280 GGGGGCGTGAGGAGGGGAAAGGG + Intronic
934712967 2:96527656-96527678 CTGGGGGTGGGGAGGGGGGAGGG - Intergenic
935005953 2:99077294-99077316 CTGAGGGTGAGGCAGGGGCATGG - Intronic
935050229 2:99518966-99518988 CTGGGGGTGAGGTGGGGAGTGGG - Intergenic
935078814 2:99772077-99772099 CTGAGGTGGAGGATGGGAAAGGG - Intronic
935328973 2:101962387-101962409 CGGAGGGCGAGGAGGGCACAGGG + Intergenic
935363734 2:102268619-102268641 CTCAGGGTGAGGATGGGAGGAGG - Intergenic
935634192 2:105237342-105237364 CTGATCTTGAGGATGGGAAAGGG + Intergenic
935634199 2:105237385-105237407 CTGATCTTGAGGATGGGAAAGGG + Intergenic
936071788 2:109375960-109375982 CTGAGGCTCAGGAAGGTAAAGGG - Intronic
936232111 2:110712161-110712183 AGCAGGGTGAGGAGGGAAAATGG - Intergenic
936569060 2:113600276-113600298 CTGAGGCTGAGGAGGGAGAAGGG - Intergenic
936789016 2:116127826-116127848 CTGAGGGAGAAGAGAGGAAGAGG + Intergenic
936857606 2:116979494-116979516 CAAAGTGTGAGGTGGGGAAAAGG + Intergenic
937009605 2:118550807-118550829 CTGAGGGTGAGAGGGTGAGAGGG - Intergenic
937156026 2:119719685-119719707 CTGAGGATGGGAAGGTGAAATGG + Intergenic
937317215 2:120939342-120939364 CTTAGAGTGAGCAGGGGATAAGG - Intronic
937907986 2:127061634-127061656 CTGAGGCTGAGGACAGGAAGAGG + Intronic
937982098 2:127621958-127621980 TGGTGGGTGAGGAGGGGAGAAGG - Intronic
938025283 2:127942332-127942354 ATGAGGGAGACGGGGGGAAACGG + Intronic
938195548 2:129324401-129324423 TTGCGGGTGAGGAGAGGCAAAGG - Intergenic
938283902 2:130091313-130091335 CTGAGGCTGAGGAGGGGGATTGG - Intronic
938285053 2:130105878-130105900 CTGAGGCTGAGGAGGGGGATTGG - Intronic
938334547 2:130479877-130479899 CTGAGGCTGAGGAGGGGGATTGG - Intronic
938335696 2:130494427-130494449 CTGAGGCTGAGGAGGGGGATTGG - Intronic
938354125 2:130626237-130626259 CTGAGGCTGAGGAGGGGGATTGG + Intronic
938355279 2:130640793-130640815 CTGAGGCTGAGGAGGGGGATTGG + Intronic
938430552 2:131233014-131233036 CTGAGGCTGAGGAGGGGGATTGG + Intronic
938431705 2:131247580-131247602 CTGAGGCTGAGGAGGGGGATTGG + Intronic
938475377 2:131606184-131606206 CTGAGGCTGAGGAGGGGGATTGG + Intergenic
938528693 2:132162137-132162159 CTCAGGTTGAGGAGGGGACAGGG - Intronic
938612306 2:132960336-132960358 CTGAGGGAGAGGAGAGTAAGTGG + Intronic
938739844 2:134220701-134220723 AGGAGGGTGAGGAGGGGAGAAGG - Intronic
939398074 2:141658148-141658170 TTGAGGGGGATGAGAGGAAAAGG + Intronic
939407991 2:141784672-141784694 CTTAAGTTGAGGAAGGGAAAGGG - Intronic
939496906 2:142935794-142935816 CTGAGGGTATGAAGGGGGAAGGG + Intronic
940457876 2:153924204-153924226 CTGAGGGTGGGGGTGGGAAGAGG - Intronic
941180047 2:162248563-162248585 CTGAGGGTAAGAAAGGGAGATGG + Intergenic
941439132 2:165511655-165511677 CTGAGAGTGAGGAGGTGGGAAGG + Intronic
942098714 2:172557024-172557046 GTGAAGGCGATGAGGGGAAAAGG + Intronic
942189061 2:173453294-173453316 CTGGGGGTGTGATGGGGAAAGGG + Intergenic
942507329 2:176656939-176656961 AGGAGGAGGAGGAGGGGAAAGGG + Intergenic
942611518 2:177746789-177746811 CTGAGGGTGAGAGGGGAAGAGGG + Intronic
942741966 2:179191431-179191453 GGGAGGGAGAGAAGGGGAAAAGG + Intronic
942795396 2:179812646-179812668 CAGAGGGAGAGAAGGGGGAAAGG + Intronic
944187657 2:196967299-196967321 CTGCGGTTGGGGAAGGGAAAGGG - Intronic
944362836 2:198878545-198878567 CTGAGAGTGAGCAGGAAAAATGG - Intergenic
944386637 2:199172293-199172315 CTGAAGTTGAGGAGTAGAAATGG + Intergenic
944621172 2:201517311-201517333 CAGGGGTTGGGGAGGGGAAATGG - Intronic
945019980 2:205560637-205560659 CTGAGGCTGATGAGGGACAAAGG + Intronic
945255901 2:207802894-207802916 CCAGGGGTGGGGAGGGGAAATGG - Intergenic
945711570 2:213303527-213303549 CAGAGGCTGGGGAGGGGAGAGGG - Intronic
945769402 2:214021943-214021965 CTTTAGGTGATGAGGGGAAAAGG - Intronic
945920225 2:215748233-215748255 CTGAGGAGGAGGTGGGAAAACGG + Intergenic
946137530 2:217659904-217659926 CTGAGGGGGAGGAGGTGGAATGG + Intronic
946210160 2:218141162-218141184 CTGGGGTTGAGGGTGGGAAAAGG + Intergenic
946249241 2:218402773-218402795 CTGAGGTTGAGGCAGGGGAAGGG + Intronic
946312714 2:218891867-218891889 CTGAGGGAAAGGAGGGGATGTGG + Intronic
946409826 2:219510424-219510446 CTGAGGCTGCAGAGGGCAAAGGG - Intergenic
946603386 2:221375168-221375190 CTGAGTGTGAGGAGGAAGAAAGG + Intergenic
946764066 2:223023822-223023844 CAGTGGTTGAGGAGGGGCAATGG + Intergenic
947526462 2:230879459-230879481 TTCCGGGTGAGGAGGGGAACAGG + Intergenic
947628710 2:231637662-231637684 AAGTGGGGGAGGAGGGGAAAAGG + Intergenic
947647402 2:231753444-231753466 CGGAGGGTGAGGCGGGAGAATGG + Intronic
947727222 2:232408198-232408220 CTGTGCATGAGGAGGGGACACGG + Intronic
948091779 2:235301717-235301739 ATGAGGGGGAGAAGGGGGAAGGG - Intergenic
948183674 2:236002376-236002398 AAGAGAGTGAGGATGGGAAAGGG - Intronic
948326917 2:237131860-237131882 CTGAGGGTGGGGAGGGGAGCAGG - Intergenic
948372569 2:237498939-237498961 CAGAGGGTCAGGAGGGACAAAGG - Intronic
948465683 2:238150590-238150612 CTGAGGGTCAGAGAGGGAAAGGG + Intronic
948716906 2:239871023-239871045 CTGAAGGAGCGGAGGGGAGAGGG + Intergenic
948786458 2:240355403-240355425 CTGAGGTTGAGGAAGGGACAGGG - Intergenic
948963241 2:241356383-241356405 CCGAGGGTGAGGACGTGAAGCGG + Exonic
949064591 2:241982100-241982122 GTGAGAGTGATGAGGGGAAAAGG - Intergenic
1168749793 20:274330-274352 GTGAGTGTGAGGAGAGGAAGGGG + Intronic
1168770077 20:408891-408913 CTGATGGGGAGGAGGGTAGAGGG - Intronic
1168773100 20:428584-428606 CTGAAGGTGAGGCTGGGACAGGG + Exonic
1168872130 20:1138715-1138737 CTTAGGGTGCTGAGGTGAAAGGG + Intronic
1168949797 20:1789272-1789294 CTGGGGGTGGGGTGGGGAAGAGG + Intergenic
1168964954 20:1893801-1893823 CTGAGGAAGATGAGGGGAAGGGG - Intergenic
1169064714 20:2688464-2688486 CTGAAGGTGAGGAGGGGCCCGGG - Intergenic
1169165759 20:3422165-3422187 CTGAGGGAGTGGAGGGACAATGG + Intergenic
1169209581 20:3758736-3758758 TTGGGGGTGACGAGGGGACAAGG - Intronic
1169867950 20:10219882-10219904 CAGGAGGTGAGGAGGGGAACAGG - Intronic
1170004357 20:11648872-11648894 ATGAGGATGAGGAGGGGCATAGG - Intergenic
1170425257 20:16228936-16228958 GTGGGGTTGGGGAGGGGAAATGG - Intergenic
1170645238 20:18191740-18191762 CTGGGGGTGAGGTGGGGAGAGGG + Intergenic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1170837260 20:19895051-19895073 CTGATGGTGGGGAGGGGTAAGGG - Intronic
1170946639 20:20896693-20896715 TTGAAGCTGAGGAGTGGAAAGGG + Intergenic
1171151429 20:22829494-22829516 GAGAGCGGGAGGAGGGGAAATGG - Intergenic
1171257125 20:23697877-23697899 ATGATGGTGAGGAGGGGAGCAGG + Intergenic
1171317086 20:24204827-24204849 CTGAGAGTGAGGTTGGGACAAGG - Intergenic
1171395903 20:24832893-24832915 CTGAGGATGCGGATGGCAAAAGG - Intergenic
1171399074 20:24860011-24860033 CAGAGGGTGAGGAAGAGGAACGG - Intergenic
1171496651 20:25561026-25561048 GAGAGGGAGAGGAGGGGAGAGGG - Intronic
1171794828 20:29558677-29558699 CTGGGGGTGAGGATGTCAAACGG - Intergenic
1171812560 20:29757023-29757045 CTGGGGGAGAAGAGGGGACAAGG + Intergenic
1171853628 20:30325588-30325610 CTGGGGGTGAGGATGTCAAACGG + Intergenic
1171906681 20:30905264-30905286 CTGGGGGAGAAGAGGGGACAAGG - Intergenic
1172031899 20:31988255-31988277 CTAATGGGCAGGAGGGGAAAAGG - Intronic
1172704858 20:36875755-36875777 CTGAGGCTCAGGAGTGCAAATGG + Intergenic
1173181111 20:40807031-40807053 CTGAGGGACAGGAGGGGCAGTGG + Intergenic
1173528254 20:43749370-43749392 CTGGGGGAGAGGAGGGGACATGG - Intergenic
1173705541 20:45107761-45107783 CATGGGGTGGGGAGGGGAAAGGG + Intergenic
1174087493 20:48019531-48019553 CTGAGGTTGAGGAGGGAAGAGGG + Intergenic
1174525059 20:51164014-51164036 CTGAGAGTGAGGGAGGAAAAGGG - Intergenic
1174764849 20:53243497-53243519 CTAAGTGTGAGGAATGGAAATGG + Intronic
1174882175 20:54292014-54292036 CTGTGGGTTAGGTGGGGAGAGGG - Intergenic
1174967873 20:55239802-55239824 CTGGGGGAAAGGAGGGGAAGGGG - Intergenic
1175010514 20:55729830-55729852 TTGTGGGTGAGGAGGAGACAAGG + Intergenic
1175039812 20:56038220-56038242 CTGAAGGTGGGGAGTGGAAAAGG + Intergenic
1176111882 20:63414587-63414609 CTGGGGCTGAGGCGGGGAATGGG + Intronic
1176326134 21:5502670-5502692 CTGAGGGGGAGTGGGGGTAAGGG - Intergenic
1176401623 21:6318281-6318303 CTGAGGGGGAGTGGGGGTAAGGG + Intergenic
1176435534 21:6670823-6670845 CTGAGGGGGAGTGGGGGTAAGGG - Intergenic
1176459796 21:6997893-6997915 CTGAGGGGGAGTGGGGGTAAGGG - Intergenic
1176483357 21:7379671-7379693 CTGAGGGGGAGTGGGGGTAAGGG - Intergenic
1176636603 21:9249657-9249679 CTGGGGGTGAGAAGAGAAAATGG - Intergenic
1176817975 21:13624980-13625002 CTGAGGCTGAGGAGGGGGATTGG + Intronic
1177201652 21:17963454-17963476 CTGAAGGTGAAGAGGGGCAAAGG + Intronic
1178139702 21:29668868-29668890 ATGAGAGTGAGGAGGAGCAATGG + Intronic
1178343697 21:31807293-31807315 TTGAGGTTTAAGAGGGGAAAAGG - Intergenic
1178708724 21:34895590-34895612 GTGACGGTGGGGTGGGGAAATGG + Intronic
1178806298 21:35842390-35842412 CTGAGGGGGAGGAGGGAATGGGG + Intronic
1178974721 21:37210906-37210928 GGGAGGGGGAGGAAGGGAAAGGG + Intergenic
1179025288 21:37674495-37674517 CAGTGGGTGAGGAGGGGAGTGGG - Intronic
1179026532 21:37683446-37683468 CAGAGGAGGAGGAGGGGAGAAGG - Intronic
1179340152 21:40500121-40500143 CTGGGAGGGAGGAGGAGAAAAGG + Intronic
1179481423 21:41681269-41681291 CTCAGGGCGAGGAGGCGGAAGGG - Intergenic
1179543715 21:42100791-42100813 GGGAGGGTGAGGAGGGCACAGGG - Intronic
1179885016 21:44310148-44310170 CTAAGGGTGTGGAGAGGAGAAGG - Intronic
1180475736 22:15704765-15704787 CTGAGGCTGAGGAGGGGGATTGG + Intronic
1180855412 22:19041960-19041982 CTGAGGGGGAGGGGAGGAAATGG + Intronic
1181035843 22:20169394-20169416 CTGGGGGGTAGGAGGGGACAGGG + Intergenic
1181533921 22:23532147-23532169 CTGAGGGAGAGAAAAGGAAAAGG + Intergenic
1182020147 22:27074901-27074923 CTAAGGGCTAGGAGAGGAAAGGG + Intergenic
1182080424 22:27524834-27524856 CTGAGGCCCAGAAGGGGAAACGG + Intergenic
1182301098 22:29337607-29337629 CTGAGTGTGATGAGGGGATCAGG + Intronic
1182371111 22:29811677-29811699 CTCAGGGTGAGGAGGAAGAAAGG - Intronic
1182550923 22:31100373-31100395 CTGAGGGTGAGGTGAGCAGACGG - Intronic
1183104687 22:35607449-35607471 GGGAGGGTGAGGAGAGAAAATGG + Intronic
1183122775 22:35743188-35743210 AAGAGGGTGAGGAAGGGAAAAGG - Intronic
1183251308 22:36732277-36732299 ATGAGGGAGAGGAGGGGCATGGG - Intergenic
1183291084 22:37002388-37002410 ATGGGGGTGAGGAGGGGAAACGG + Intronic
1183339362 22:37271072-37271094 ATGGGGGTGAGGAGGGTAGAGGG + Intergenic
1183366863 22:37411448-37411470 CCCTGGGTGAGGAGGGGAAGCGG + Intronic
1183948201 22:41338642-41338664 ATGAGGAAGAGGAGGGGAAAGGG - Intronic
1184045640 22:41970860-41970882 GAGAAGGTGAGGATGGGAAATGG - Intergenic
1184089306 22:42283913-42283935 AGGCGGGGGAGGAGGGGAAAGGG + Intronic
1184557916 22:45243039-45243061 AGGAGGGTGGGGTGGGGAAAGGG - Intergenic
1184705379 22:46208695-46208717 CTGAGGTTGAGGGAGGGAATGGG - Intronic
1185006176 22:48278230-48278252 CTGGGTGGGAGGAGGGGGAAGGG - Intergenic
1185173784 22:49307709-49307731 CTGAGGGTGAAGATGGGGAGGGG + Intergenic
1185398672 22:50605065-50605087 GTGAGTGAGAGGTGGGGAAAAGG + Intronic
949382811 3:3464969-3464991 CTGAGAATTAGGAGGGGAAAAGG + Intergenic
949729488 3:7092111-7092133 CGGAGGTTGAGGAGGGAGAATGG - Intronic
949894894 3:8761670-8761692 ATTAGGGTGAGGAGCAGAAATGG + Intronic
950187034 3:10951681-10951703 AGGAGGGAGAGGAGGGGAGAGGG - Intergenic
950241348 3:11372603-11372625 CTGAGGGTGGGGAGATGAACTGG - Intronic
950545628 3:13636422-13636444 CTGGGGGAGAAGAGGGGCAATGG - Intronic
950640356 3:14344542-14344564 CTGAAAGGGAGGAGGGGACATGG + Intergenic
950661772 3:14471329-14471351 CTGAGGGAGAGCTGGGGAGATGG - Intronic
951496327 3:23331581-23331603 AAGATGGTGAGGAGGGGACAAGG + Intronic
951601433 3:24380473-24380495 CTGGTGGAGAGGAGGGGGAAGGG - Intronic
951719086 3:25679511-25679533 GGGAAAGTGAGGAGGGGAAAGGG + Intergenic
952002646 3:28804319-28804341 TTCAGGGTGAGTAGGGGAGAAGG - Intergenic
952049700 3:29369539-29369561 GTGAGGGTGAGGAGGAGAGAGGG + Intronic
952070972 3:29635476-29635498 CTGGTGGAGAGGAGGAGAAATGG - Intronic
952179439 3:30902445-30902467 ATGAGGGTGGGGAAGGGAACAGG + Intergenic
952687255 3:36164027-36164049 CTGAGGGTGAGATGGGGCTATGG - Intergenic
952967538 3:38630544-38630566 CTGAGGGAGGAGAGGGGGAAGGG + Intronic
953020335 3:39108978-39109000 CTGAGGAGGAGCAGGGGATAGGG + Intronic
953090957 3:39725798-39725820 CTAAGGCTGGGGAAGGGAAAAGG - Intergenic
953116069 3:39993616-39993638 CTGAGAGTGAGGAGGTGACAAGG - Intronic
953238660 3:41128154-41128176 TTGAGGGTGAGCAGGGGGACGGG + Intergenic
953365429 3:42340474-42340496 AGGAGGGGGAGGAGGGGAAGGGG + Intergenic
953715227 3:45311679-45311701 TGGAGGGTGAAGAGGGGAAATGG + Intergenic
954392504 3:50274989-50275011 CTGAGAGGGAGGAGGGGCGACGG - Intronic
954414041 3:50384308-50384330 CTGAGAGTGAGGATGTGGAAAGG - Exonic
954512059 3:51133924-51133946 CTGAGGGTGAGGGTGGGAGGAGG - Intronic
954671665 3:52294357-52294379 CTGAGGGTGTGGAGGGGCCCTGG + Intergenic
954750347 3:52810056-52810078 CTGGGGGTGGGGAGGGGGTAAGG + Intergenic
954787994 3:53109062-53109084 ATGAGGGTGAGGTTGGCAAAGGG - Intronic
954794878 3:53156479-53156501 AAGAGGGTGAGGAGGCGAAAGGG + Intronic
955321130 3:57975153-57975175 GTGAGGGTGAGGAAGAGGAATGG + Intergenic
955953814 3:64267953-64267975 CTGCGGGGGAGCCGGGGAAAGGG + Intronic
956260703 3:67337352-67337374 TTGAAGGTAAGGAGAGGAAAGGG + Intergenic
956748991 3:72331583-72331605 CTGAGGTTGCAGCGGGGAAATGG - Intergenic
956948588 3:74253426-74253448 CTAATGGTGAGGAGGACAAAGGG + Intergenic
957092322 3:75743579-75743601 CTGAGGAAGAGAATGGGAAAGGG + Intronic
957104160 3:75865607-75865629 CTGGGGGTGATGAGAGAAAATGG + Intergenic
957106153 3:75890188-75890210 CTGAGGGTCAGGAGTGTAGATGG - Intergenic
957329177 3:78738012-78738034 CTAGGGGAGAGGAGGGGAAGAGG + Intronic
957609262 3:82446674-82446696 GGGAGGCTGAGGAGGGGAAATGG + Intergenic
958735650 3:98006769-98006791 TGGAGGGTGAGGAGGGCAGAGGG + Intronic
960428941 3:117545201-117545223 CTGAAGGTGTGCAGAGGAAACGG - Intergenic
960474102 3:118102849-118102871 CTGATGGGGATGAGGAGAAAAGG - Intergenic
960607520 3:119522388-119522410 TGGAGGCTGAGGAGGGGACAGGG + Intronic
960648343 3:119915991-119916013 AGTAGGGGGAGGAGGGGAAAAGG + Intronic
960905075 3:122592437-122592459 CTGGGAGTGAGGTGGGGGAAGGG + Intronic
961194802 3:124992584-124992606 CTGGGGGTGAGGAGGGGCAGGGG + Intronic
961214273 3:125147563-125147585 CTGCGGATGAGGAGGGGATCCGG - Intronic
961624853 3:128254771-128254793 CTGAGAGTGGGGAGGGGAGAGGG + Intronic
961738141 3:129015163-129015185 CTGCAGGAGAGGATGGGAAAGGG - Intronic
961935171 3:130575445-130575467 CTGAAAGTGATGAGGGGCAAAGG - Intronic
962337054 3:134543773-134543795 GTGAGGGTGAGAAGGAGAAAAGG - Intronic
962750205 3:138429245-138429267 TGGAGGGTGTGGAGGGGAATGGG + Intergenic
962986928 3:140544701-140544723 CTCAGGGTGGGGAGGGGGCAGGG + Intronic
963459828 3:145597231-145597253 TTGAGGGTGAGGAGGAGAGGAGG - Intergenic
963556927 3:146803513-146803535 CTTGGGGTGGGGATGGGAAAAGG + Intergenic
964323534 3:155523077-155523099 CGGAGGCTGAGGCGGGAAAATGG - Intronic
964405140 3:156340753-156340775 GTCAGTGTGAGGAGAGGAAATGG + Intronic
964563853 3:158027853-158027875 CTGAGGGTAGGGGGAGGAAATGG - Intergenic
964570932 3:158106541-158106563 CGGGGGTTGGGGAGGGGAAAAGG + Intronic
965488985 3:169313695-169313717 CTGACAGTGAAGAGGGGAAAAGG + Intronic
966184171 3:177213355-177213377 GGGAAAGTGAGGAGGGGAAAAGG + Intergenic
966693228 3:182762673-182762695 CTGAGGCTGGGGAGGGGTAAAGG - Intergenic
967174823 3:186853500-186853522 ATGAGGGTGAAGATGGGAAAGGG - Intronic
967470762 3:189858951-189858973 CAGAGGCTGAGAAGGGGACACGG + Intronic
967507606 3:190270758-190270780 CTGTCGGTGAAGTGGGGAAAGGG - Intergenic
967735386 3:192946412-192946434 AAGAGCGTGAGGAGAGGAAAGGG - Intergenic
967927559 3:194663356-194663378 CTGAGGCGGAAGAAGGGAAAGGG - Intronic
968091362 3:195900244-195900266 CCGAGAGAGAGGAGGGGAACAGG + Intronic
1202750292 3_GL000221v1_random:155362-155384 CTGGGGGTGAGAAGAGAAAATGG + Intergenic
968737309 4:2304123-2304145 CTGTGTGTGAGGAGGGGCAGGGG - Intronic
968814532 4:2815134-2815156 CTGAGGGTGATGATGGGCCATGG - Intronic
968948487 4:3678050-3678072 CTGAGGGTGAGGAGGAGAGGAGG + Intergenic
969154052 4:5194433-5194455 CTGAGGATGAGGATGAGCAAAGG - Intronic
969349606 4:6590809-6590831 ACAAGGATGAGGAGGGGAAAGGG - Intronic
971631816 4:29002394-29002416 CTAAGGCTCAGGAGAGGAAATGG + Intergenic
971963132 4:33515622-33515644 AAGAGGGAGAGGAGGGGGAAAGG - Intergenic
972051711 4:34743260-34743282 CAGAGGCTTAGGAGGGAAAATGG - Intergenic
972734071 4:41823220-41823242 CTGAAGGTAAGGAGGAAAAAAGG + Intergenic
973782403 4:54300753-54300775 CTGAGGCTGCTGGGGGGAAATGG - Intergenic
974021828 4:56698404-56698426 CTGGGAGTGAGGAGGGGGAGGGG - Intergenic
974887106 4:67833302-67833324 CTGAGGCTGAGGAGGGAAGCTGG - Exonic
974925279 4:68291181-68291203 CTGAGGATGATGAGGAGGAAGGG - Intergenic
976300207 4:83509354-83509376 CTGAGGGTTTGAAGGGGGAAGGG + Intronic
976474499 4:85468303-85468325 CTCAGGCTGGGGAGGGCAAATGG - Intergenic
976572755 4:86632665-86632687 CGCAGGGGGAGGAGGGGAAAAGG - Intronic
976636914 4:87295547-87295569 CTGAGGGAGAGGAGCGGCAGTGG + Intergenic
977174152 4:93798760-93798782 CTGAGGGTGGGGAGAGGCATTGG - Intergenic
977294131 4:95192611-95192633 AGGAGGGTGAGCAGGGGAGAAGG - Intronic
977313377 4:95414203-95414225 GTGGGGGGGAGGTGGGGAAAAGG - Intronic
977464660 4:97368826-97368848 GTGGGGTTGGGGAGGGGAAATGG - Intronic
979558171 4:122074652-122074674 TTGAGAGTGAGGAGGACAAAAGG + Intergenic
980048774 4:128017952-128017974 GTTAGGGTGTGGAGGAGAAATGG - Intronic
981547257 4:145906510-145906532 CTGAGGGTGTGGAGGGGGTTAGG - Intronic
981550708 4:145938060-145938082 CCCAGAGTGAGGAGGGGGAAGGG + Intronic
981567348 4:146115018-146115040 CTCATGGAGAGGAGGAGAAATGG + Intergenic
981702499 4:147622180-147622202 GTGAGGCTGAGGAGGGCAGATGG - Intronic
982117633 4:152110907-152110929 CTCAGGGTGGGGTGGGGACAGGG - Intergenic
982213792 4:153063010-153063032 CTGAGGTTGAGTTGAGGAAAGGG + Intergenic
982316331 4:154035801-154035823 CTGTCGGGGAGGAGGGGAAAGGG + Intergenic
982384090 4:154781431-154781453 GAAGGGGTGAGGAGGGGAAAGGG + Exonic
982689548 4:158532472-158532494 CAGAAGGGGAGAAGGGGAAAAGG - Intronic
982741437 4:159061299-159061321 CTGAAGGTGATGAGGGGACAGGG - Intergenic
982911296 4:161145985-161146007 GAGAGGGGGAGGAGGGGAATGGG - Intergenic
983190784 4:164751249-164751271 CTGAGGGAGAGGAGCGGCAGTGG - Intergenic
985223389 4:187732041-187732063 CTGAGGGGGAGGAGGAGGACGGG - Intergenic
1202751491 4_GL000008v2_random:8096-8118 CTGGGGGTGAGAAGAGAAAATGG - Intergenic
985576137 5:674328-674350 CTGAGGGGGAGGAGGAGCACTGG + Intronic
985578396 5:684232-684254 CTGAGGGAGCGGAGGGGATCGGG + Intronic
985593327 5:776372-776394 CTGAGGGAGTGGAGGGGATCAGG + Intergenic
985658097 5:1142406-1142428 GAGAGAGTGAGGAGGGGAGAGGG - Intergenic
985756654 5:1723490-1723512 GAGAGGGAGAGGAGGGGAAAGGG - Intergenic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
985868633 5:2536438-2536460 CTGTGGGTGAGGAGAGGCCAGGG - Intergenic
985957686 5:3276996-3277018 CTGAGGGTGCCGAGGAGACAAGG + Intergenic
986377821 5:7150452-7150474 CTGAGGATGTGGAGGAGAACAGG - Intergenic
986555630 5:9007863-9007885 CTGGGTGTGAGGAGGGGAGGTGG + Intergenic
986975363 5:13387787-13387809 CAGAGGGATAGGAGGGAAAATGG + Intergenic
987121922 5:14775958-14775980 CCGAGGGTGAGTAGTGGAGAGGG + Intronic
988434602 5:31159238-31159260 CTGGGGGTGAGGGAGGGATATGG - Intergenic
988690014 5:33562452-33562474 GTGAGGATGAGCAGGGGAGAGGG - Intronic
989125912 5:38052239-38052261 CTGAGGGGTAGGAGGGAGAAAGG + Intergenic
989344210 5:40411135-40411157 GTGAGGGTGGGGAAGGGAAAAGG + Intergenic
989585970 5:43074150-43074172 CTGAGTGTTTGAAGGGGAAAGGG + Intronic
989748820 5:44866190-44866212 CAGATGGTGAGGAGGGAAAGAGG - Intergenic
990470812 5:56113687-56113709 GTGAGGGTGAGGTGGGGGAATGG + Intronic
991285383 5:64969484-64969506 CTGAGGCTGGCGAGGGGAAGAGG + Intronic
991486867 5:67145985-67146007 CTGGGACTAAGGAGGGGAAAGGG + Intronic
991528428 5:67589791-67589813 CTTAGGGTGAGATGTGGAAAAGG + Intergenic
992136185 5:73748762-73748784 CTGTGGGAGTGGCGGGGAAATGG - Intronic
992162648 5:74017651-74017673 CTGAAGATGAGGAGGGGACAAGG - Intergenic
993276186 5:85862061-85862083 CTGAGGAGGAGGAGCAGAAAAGG - Intergenic
993866438 5:93202216-93202238 GACAGGGTGATGAGGGGAAAGGG - Intergenic
994403597 5:99315261-99315283 GTGAGAGTGAGGATGGAAAAGGG - Intergenic
994448543 5:99909719-99909741 CAGAGGGTGAAGAGAGGAATGGG + Intergenic
994645697 5:102466165-102466187 CAGAGGGTGGGGGGAGGAAAAGG - Intronic
994691803 5:103028783-103028805 CAGAAGGTGGGGATGGGAAAGGG - Intronic
994977247 5:106825438-106825460 CTGAGTGTCAGCAGGGCAAAAGG - Intergenic
995036527 5:107540133-107540155 CTGGGGGTGAAGAGGGGGAGGGG + Intronic
995734545 5:115285946-115285968 TTGTGGGGGATGAGGGGAAAAGG + Intronic
995860062 5:116631490-116631512 CTGAGTGAGAGGAGCAGAAATGG + Intergenic
996551882 5:124739467-124739489 CTGGAGGCAAGGAGGGGAAAAGG - Intronic
996978022 5:129458965-129458987 CTGAGGGAGAGTTGTGGAAAGGG + Intergenic
997230068 5:132235819-132235841 CTGTGGGTGAGTGGGGGAGAAGG + Intronic
997264254 5:132485951-132485973 CTGAGGGTGAGGAAGGAAGTAGG - Intronic
997473197 5:134128175-134128197 CTGGGGTTGAGGAGTGGGAAGGG - Intronic
997665999 5:135629907-135629929 ATGAGAATGAGGAGGAGAAACGG + Intergenic
997745832 5:136299381-136299403 TGGAGGAGGAGGAGGGGAAAAGG + Intronic
997933182 5:138088806-138088828 CTGAAGGTGAGACAGGGAAATGG - Intronic
997952446 5:138253103-138253125 CTGAGGCTGAGGTAGTGAAAGGG - Intronic
998042963 5:138965002-138965024 CTGAGGGTGACGCTGGGAAGAGG + Intronic
998056555 5:139083138-139083160 AAGAGGGTGTGGAGGGGAAGGGG + Intronic
998059012 5:139104527-139104549 CTAGGGGAGAGGAGAGGAAAAGG - Intronic
998163435 5:139826603-139826625 CTGAGAGTGAAGATGGGAAGGGG + Intronic
998364710 5:141621878-141621900 CTGAAGGTGATGAGAGGAAAAGG + Intronic
998461826 5:142315156-142315178 CTGGGGGTGGGGTGGGGAAAAGG + Intronic
998528206 5:142861548-142861570 CTGACGGTGAGGAGGGCGAGAGG + Intronic
998753537 5:145351591-145351613 ATGAGATTTAGGAGGGGAAAAGG - Intergenic
998862999 5:146463650-146463672 CTGAGGGTGCGGCTGGGGAACGG - Exonic
999213904 5:149915535-149915557 CTGAGGGTCAGCAGAGGACAGGG - Intronic
999382647 5:151132293-151132315 CTGAGGCTGGGGACGGGAAGGGG - Intronic
999612801 5:153388639-153388661 CAGCGGGTGGGGTGGGGAAAAGG - Intergenic
999869596 5:155735483-155735505 CTGAGGCTCAGAGGGGGAAAGGG + Intergenic
1000850073 5:166329256-166329278 CTGAGGTTGGGGCGGGGAACTGG - Intergenic
1000873437 5:166605581-166605603 TTTAAGGTAAGGAGGGGAAATGG + Intergenic
1000919410 5:167120382-167120404 CTGTGGGAGAGGAGGGGAAGTGG + Intergenic
1001545979 5:172570794-172570816 AGGAGGGAAAGGAGGGGAAAAGG + Intergenic
1001563105 5:172683089-172683111 AAGAGGGAGAGAAGGGGAAAGGG + Intronic
1001958487 5:175864922-175864944 CAGAGGGTGAGAAAGGGGAAAGG - Intronic
1002130034 5:177075296-177075318 ATGAGGCTGAGGCGGGAAAATGG + Intronic
1002320886 5:178375257-178375279 CTGGGGGAGAGGAGGGGAGGTGG + Intronic
1002327633 5:178420386-178420408 CTCAGGGAGGGGAGGGGGAAAGG - Intronic
1002359499 5:178659587-178659609 CTAAGGGTGAGGAAGAGAATAGG + Intergenic
1002453232 5:179331396-179331418 TGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453241 5:179331416-179331438 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453250 5:179331436-179331458 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453259 5:179331456-179331478 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453268 5:179331476-179331498 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453277 5:179331496-179331518 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453286 5:179331516-179331538 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453295 5:179331536-179331558 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453304 5:179331556-179331578 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453313 5:179331576-179331598 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453322 5:179331596-179331618 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002558497 5:180063025-180063047 CTGGGGGTGGGGAGGAGGAAGGG + Intronic
1002813071 6:652701-652723 CTGGGGGTGGGGAAGGGAAGAGG + Intronic
1002858854 6:1062005-1062027 TTGAGGCTGAGGAGGGGATGAGG - Intergenic
1003428679 6:6018873-6018895 CTGAAGGGGGTGAGGGGAAAAGG - Intergenic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1004020250 6:11770503-11770525 CTAAGGGACAGGAAGGGAAAGGG + Intronic
1004200128 6:13540630-13540652 CTTAGGGTTGGGAGTGGAAAAGG + Intergenic
1004382306 6:15143131-15143153 GGGATGGTGAGGAGGGAAAAGGG - Intergenic
1004549092 6:16629326-16629348 CTCAGGGGGAGGCGGGGAGAAGG - Intronic
1004739885 6:18448442-18448464 CTGAGAGTGAGAAGAGAAAAGGG + Intronic
1004762454 6:18683271-18683293 CTGAGCATGAGGAGGTGGAATGG - Intergenic
1005255378 6:23997269-23997291 CAGAGGTGGAGGAGGGGGAAGGG - Intergenic
1005280336 6:24267165-24267187 GTGAGGGTGAGGAGTGGAGATGG + Intronic
1005440249 6:25859857-25859879 GTAAGGGGGAGGAGTGGAAATGG - Intronic
1005610016 6:27514714-27514736 CTGAGGGTGAGAGGGGAATAAGG + Intergenic
1005883031 6:30074768-30074790 CTGAGGGTGAGGAGGGGTCCTGG - Intronic
1006108647 6:31731004-31731026 CTGAGGATGGGGAGAGGAGAGGG + Intronic
1006174106 6:32111539-32111561 CTGGGAGAGAGGAGGGGGAAAGG + Intronic
1006313178 6:33275873-33275895 CTGAGGATGAGGTGAGGACAAGG + Exonic
1006322890 6:33330865-33330887 CTGAGGGAGGGGAGGGGGAACGG + Intergenic
1006414248 6:33893933-33893955 GGGAGGGTGGGGAGGGGAAGAGG + Intergenic
1006450964 6:34105499-34105521 CTGAGAGGAAGGAGGGGACAAGG - Intronic
1006459590 6:34150671-34150693 CTGAGGCTGGGGAAGGGAAGTGG - Intronic
1006667401 6:35705703-35705725 CTGGGGGTGAGGAGGGTGAGGGG + Intronic
1006686012 6:35834881-35834903 ATAAGGATGAGGAGGGGGAAAGG - Exonic
1006803873 6:36776428-36776450 CTGGTGGTGAGGATGGGAATGGG + Intronic
1006941730 6:37756192-37756214 CTGAGGGTGGGGAGGAGCAGAGG - Intergenic
1006976030 6:38102408-38102430 GTAGGGGTGAGGTGGGGAAATGG - Intronic
1007181356 6:39931643-39931665 ATGAGGGGGAGGAGGGAAAGAGG - Intronic
1007285545 6:40744822-40744844 CTGGGGGTGGGGAGAGAAAAAGG - Intergenic
1007670599 6:43549935-43549957 CTAAGGGAGAGGAGGAAAAAAGG + Intronic
1007753234 6:44082642-44082664 CTGAGGCTGAGCAGGTGAAATGG + Intergenic
1007772795 6:44204689-44204711 AAGAGGGTGAGGGGAGGAAATGG - Intergenic
1007967762 6:46017738-46017760 GTTGGGGTGAGGAGAGGAAAAGG + Intronic
1008048189 6:46873126-46873148 CACAGGGTGAGGAAGGGCAAAGG - Intronic
1008223274 6:48879509-48879531 ATGAGGGGGAGGAAGGGATAAGG - Intergenic
1008228949 6:48959784-48959806 AGGAAGGAGAGGAGGGGAAAGGG - Intergenic
1008322595 6:50135212-50135234 CTGATGGTGAGGAGAGCCAAAGG - Intergenic
1009593696 6:65708660-65708682 GAGAGGAGGAGGAGGGGAAAAGG - Intergenic
1009866850 6:69408604-69408626 TTAAGAGTGAGGAGGGGTAATGG + Intergenic
1009933801 6:70208201-70208223 CTGAGGGTGATGAGGTCATAAGG - Exonic
1011686890 6:89830591-89830613 CTGAGGGAGATGGGGGGGAAAGG - Intronic
1011698563 6:89934681-89934703 GTGAGGGTGAGGGGAGGAGATGG + Intronic
1011731523 6:90269242-90269264 CTGGGGGTGAGGGGTGGGAAGGG + Intronic
1011870424 6:91886085-91886107 CTGAGGCTTAGGAGGAAAAATGG + Intergenic
1012525320 6:100170202-100170224 CTGAAGGGGTGGAGGGGGAAGGG - Intergenic
1012950982 6:105517605-105517627 CTGTGAGGGAGGCGGGGAAATGG + Intergenic
1014159717 6:118154002-118154024 CTGAGGATGAGGTGGGAATATGG + Intronic
1014548133 6:122756076-122756098 GTTGGGGAGAGGAGGGGAAAGGG - Intergenic
1014644390 6:123954991-123955013 CAGAAGGGGAGGAGGGGAGAAGG + Intronic
1014796506 6:125731332-125731354 ATGAGGGGGAGGAGGAGAAATGG - Intergenic
1015089003 6:129331384-129331406 CTGAGGGTAAGGATGGGAGGGGG - Intronic
1015370239 6:132442698-132442720 CTGAGGTTGAGAATAGGAAAAGG - Intergenic
1015602944 6:134928197-134928219 GTCAGGGTGAGGAGGGGAAAAGG - Intronic
1015999352 6:139028026-139028048 CTGGGGGTGGGGAGGGGGTAAGG + Intergenic
1016519980 6:144936183-144936205 CCTAGGGTGAGGAGGGGATAGGG + Intergenic
1017063195 6:150505977-150505999 GTGAGGGAGGGGAGGGGAAATGG + Intergenic
1017089667 6:150748042-150748064 CTGAGGCTGGGGTGGGGAATGGG - Intronic
1017198029 6:151723219-151723241 CTGAGGGGTGGGAGGGGAAGAGG + Intronic
1017329805 6:153183147-153183169 CTGAGAGTGAGGATGGAAAAGGG + Intergenic
1017385276 6:153875875-153875897 GTGAGGGTGTGGAGGGGTGAGGG - Intergenic
1017403891 6:154095507-154095529 CAAAGGCTGAGGAGGAGAAAAGG - Intronic
1017408696 6:154147066-154147088 CTGAGGGAGAGGTGGGGAAGGGG + Intronic
1017650529 6:156577400-156577422 CTGTGTGTGATGGGGGGAAAGGG + Intergenic
1017708465 6:157146176-157146198 CTGTGGCAGAAGAGGGGAAAGGG - Intronic
1017768750 6:157628604-157628626 CTGGAAGTGAGGAGGGGAAAGGG - Intronic
1017780992 6:157715165-157715187 CTGAGCGTGAGGAAGGCATAGGG - Intronic
1017850186 6:158298791-158298813 CTGAGGGAGAGGAGCGGCAGTGG + Intronic
1018019851 6:159751545-159751567 CTGAGAGTGCTGATGGGAAATGG + Intronic
1018597299 6:165495335-165495357 GAGAGGGGGTGGAGGGGAAAGGG + Intronic
1018837803 6:167498330-167498352 GTGCAGGTGAGGAGGGGGAAGGG - Intergenic
1018936485 6:168277152-168277174 CTGAAAGTGAGGAGGGGGAAAGG - Intergenic
1018996160 6:168712012-168712034 CTGACCCTGAGGAGGGGAGAAGG + Intergenic
1019129439 6:169862891-169862913 CTCAGGTTGAGAAGAGGAAATGG + Intergenic
1019143935 6:169964824-169964846 CTGAGGGTGAGCAGGGGTGAGGG + Intergenic
1019718647 7:2555015-2555037 AGGAGGGTGAGGAGGGGAAGGGG + Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1019999099 7:4744772-4744794 CTGGGCGGAAGGAGGGGAAAGGG - Intronic
1020654992 7:10918319-10918341 CGGAGGGAGTGGAGAGGAAAGGG - Intergenic
1021889331 7:25172301-25172323 AAGAGGGAGAGGAGAGGAAAGGG + Intronic
1021988445 7:26119647-26119669 CTGAGGGAGGTGAGGAGAAATGG + Intergenic
1022053933 7:26709361-26709383 CAAAGGGTGTGGAGTGGAAAAGG + Intronic
1022370491 7:29766497-29766519 CTGGAGGTGAGGAGGAGAAGGGG - Intergenic
1022483734 7:30761295-30761317 CTGTGGGGGAGGTGGGGAAGAGG + Intronic
1022617299 7:31944427-31944449 CTGAGGGTGGGCAGGTGAGAGGG + Intronic
1022734555 7:33063389-33063411 CTGGGGGTGAGGAGGGGCGCAGG + Intergenic
1023481741 7:40642433-40642455 CTGAGGGTAAGGAGAAGGAAGGG + Intronic
1023523554 7:41073458-41073480 CTGAGGGTGAAGCAGGGGAAGGG + Intergenic
1023640179 7:42249720-42249742 ATGAGGGTTAGGAAAGGAAAAGG - Intergenic
1023956600 7:44891650-44891672 CTGAGGCTGAGGAGAGGAGAGGG + Intergenic
1024097140 7:45991260-45991282 CTGAGGGAGAGGAGAGGAGGGGG + Intergenic
1024353973 7:48395605-48395627 CTGAGGAGGAGGAGGAGGAAGGG - Intronic
1024596386 7:50941119-50941141 CTGTGGATGAAGAGAGGAAACGG - Intergenic
1024613267 7:51085179-51085201 CTGAGGATAAGGAGGAGAACAGG - Exonic
1024804147 7:53116775-53116797 CTGGGGGAGAGGAGGGCATATGG + Intergenic
1024872780 7:53984945-53984967 GTGAGGGGGAGGAGGAGAATGGG + Intergenic
1024896238 7:54265462-54265484 CTGAGGGTTAAGAAGGAAAAGGG + Intergenic
1025913005 7:65842442-65842464 CTGGGGGTGAGGAGGGGAATGGG + Intergenic
1026372131 7:69710998-69711020 CTAAGGGTGAGCAGGAGGAAAGG - Intronic
1026806121 7:73430443-73430465 TGGAGGGGGAGGAGGGGAAGGGG - Intergenic
1026806133 7:73430467-73430489 GGGAGGGGGAGGAGGGGAAGGGG - Intergenic
1026867689 7:73833494-73833516 CAGAGGGTGGAGAAGGGAAAAGG - Intergenic
1027130247 7:75585568-75585590 CTGAGAGTGTGGAGGGGAGGGGG - Intronic
1027399036 7:77788461-77788483 CAGAGGCTGAGGTGGGGAGATGG + Intergenic
1027794419 7:82674652-82674674 TGGAGGGAGAGGAGAGGAAAAGG - Intergenic
1027808080 7:82855698-82855720 CTGGGAGTGAGATGGGGAAAAGG - Intronic
1028080959 7:86575349-86575371 CTGACGGTGAGGATGCAAAATGG + Intergenic
1028983718 7:96993852-96993874 CTGGGGATGAGGTGGAGAAAGGG - Intergenic
1029547183 7:101216678-101216700 GTGCGGGTGAGGAGAGGGAAAGG - Exonic
1029977506 7:104848629-104848651 GGGAGGGAGAGGAAGGGAAAAGG + Intronic
1030858994 7:114599934-114599956 CTGAGGGTGGGGAGTGGAAGAGG - Intronic
1031466567 7:122119547-122119569 TTGGGGGTGAGGATGGGGAATGG - Intronic
1032443669 7:131961865-131961887 GGGAGGCTGAGGAGGGGACAAGG - Intergenic
1032576063 7:133056368-133056390 GTGGGGGCGAGGAGGAGAAAGGG - Intronic
1032746306 7:134790117-134790139 CAGAGAGGGAGGAAGGGAAAAGG + Intronic
1032948702 7:136882386-136882408 AAGAGGGGGAGGAGGAGAAAGGG - Intronic
1033220117 7:139522244-139522266 CTGCGGGTGTGGAGGGGGAGGGG + Intergenic
1033459029 7:141528734-141528756 CTGTTGGAGAGGAGGGGAGATGG - Intergenic
1033597567 7:142868050-142868072 GTGGGGATGAGGAGAGGAAATGG + Intronic
1033996237 7:147353294-147353316 CTGTCGGGGAGTAGGGGAAAGGG - Intronic
1034122017 7:148636806-148636828 AAGAGGGTGAGGAGGGTGAAGGG - Intergenic
1034338660 7:150338969-150338991 CTGCGGGTAAGAAGGGGCAAGGG - Exonic
1034691395 7:153017250-153017272 CAGAGGGAGAGGAGGAGGAAGGG + Intergenic
1034829344 7:154295664-154295686 CTGAGGGTAGGGAGGGGAAGGGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034922093 7:155091661-155091683 TTGAGGCTGAGAAGGGGGAAGGG + Intergenic
1035226362 7:157435180-157435202 CTGAGGGTGAGGCGTGGAGGTGG + Intergenic
1035237619 7:157509033-157509055 GAGAGGGAGAGAAGGGGAAAGGG + Intergenic
1036216559 8:6884458-6884480 CTGAGTGTGAAGAGGGGAGGGGG + Intergenic
1036537619 8:9665903-9665925 ATGAGGTTAGGGAGGGGAAAAGG - Intronic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037691281 8:21183445-21183467 AGGAGGAGGAGGAGGGGAAAAGG - Intergenic
1037886591 8:22599224-22599246 GAGAGGGTGGGGAGGGGAGAGGG - Intronic
1038353405 8:26803087-26803109 GGGAGGGTGAAGATGGGAAATGG + Intronic
1038435400 8:27532190-27532212 GAGAGGGTGAGGAGGGAAAGGGG - Intronic
1038617940 8:29112656-29112678 TTGAGGGTGAGGGTGGGAGAAGG + Intronic
1038691192 8:29765035-29765057 CAGTGGGTGTGAAGGGGAAAGGG - Intergenic
1039435356 8:37556171-37556193 GTGTGGGTGTGGAGGGGAAGGGG - Intergenic
1039444538 8:37620686-37620708 CTGGGGGTGGGGAGGGTGAAGGG - Intergenic
1039612077 8:38928037-38928059 CAGAGGCTGGGGAGGGGAGAGGG + Intronic
1039868989 8:41529448-41529470 CTGAGAGGGAGGAGGGGAGGGGG + Intronic
1040069139 8:43175359-43175381 CTGATGAGGAGGTGGGGAAAAGG - Intronic
1040082868 8:43306867-43306889 CTGAAGCTGAGGAGGGGGATTGG + Intergenic
1040508954 8:48076601-48076623 CTGCTGGTGAGGATGTGAAATGG - Intergenic
1041570246 8:59329943-59329965 TGGAGGGTGAGTAGGGGAAGGGG + Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1042649727 8:71025996-71026018 CAGAGGATGAGGAGAGGAGATGG - Intergenic
1043837654 8:85064677-85064699 CTGGGTGTGAGGAGGGGAGGTGG - Intergenic
1044014201 8:87030932-87030954 AAGAGGGGGAGGAGGGGGAAGGG - Intronic
1044020248 8:87096819-87096841 CTAAAGGTGTGGAGAGGAAAAGG - Intronic
1044503728 8:92992234-92992256 CTGGGGGAGTGGAGGAGAAATGG + Intronic
1044602050 8:94015092-94015114 CAGAGGGTGTGGATGGAAAAAGG - Intergenic
1044817745 8:96130523-96130545 TTGATGGTGGGGAGGGGACAGGG - Intergenic
1044952443 8:97447422-97447444 GTGAGGGTGAAGATAGGAAAGGG - Intergenic
1045424168 8:102046948-102046970 AGGAGGGAGAGGAGCGGAAAAGG - Intronic
1045534296 8:103012631-103012653 CAGAGGATGAGGAAGGGAAGAGG - Intergenic
1045581301 8:103483280-103483302 TTGAGGGTGGGGATGGGGAATGG + Intergenic
1045804404 8:106140437-106140459 CAGAGGGTGAGAGGAGGAAAAGG + Intergenic
1045905377 8:107338454-107338476 AGGAGGGTGAGGAGGGGATGGGG + Intronic
1046712898 8:117532818-117532840 TAGAGGGTGAGGAGGAGAATGGG + Intronic
1046829633 8:118730340-118730362 GTGAGGGTGGGGAAGGGAGATGG - Intergenic
1047210332 8:122835354-122835376 CTGAGGGTTTGAAGGGGGAAGGG + Intronic
1047318640 8:123757502-123757524 CTGAGGCTGAAGAGGGGAGAGGG + Intergenic
1047750370 8:127876023-127876045 CTGAGGGTGAGGGGGGGTGGAGG - Intergenic
1048037234 8:130688816-130688838 CTGAAGGGCAGGAGGGGTAAAGG - Intergenic
1048047382 8:130785657-130785679 CTAAGGGTCAGGAGTGGAGATGG + Intronic
1048337322 8:133512707-133512729 CTGAGGGTCGGGAGGAGACAGGG + Intronic
1048425475 8:134319372-134319394 CTGAGGGTGAGGAATTGAGATGG - Intergenic
1048717148 8:137282805-137282827 CTGAGGGTTTGAAGGGGGAAGGG - Intergenic
1048916093 8:139184314-139184336 CTGAGGCTGAGAATAGGAAAGGG + Intergenic
1049251923 8:141593854-141593876 CTGAGGGTGAAGAGGGGTCTGGG + Intergenic
1049281977 8:141754114-141754136 CTGTGGGTGAGGCGGGAGAATGG - Intergenic
1049304054 8:141889452-141889474 ATGAGGATGAGGATGTGAAAGGG + Intergenic
1049436055 8:142586782-142586804 CCAAGGGTGAGGAGGAGCAAAGG + Intergenic
1049556701 8:143286091-143286113 CTGGGGGAGGGGAAGGGAAAGGG - Intergenic
1049807108 8:144546074-144546096 CTGAGGGTGAGGCGGGAGGAAGG + Intronic
1049883470 9:13254-13276 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1050151364 9:2622077-2622099 GTGGGGGCGGGGAGGGGAAAGGG - Exonic
1050904305 9:10984822-10984844 TTGAGGGTGTGGAAGGCAAATGG - Intergenic
1051075581 9:13230747-13230769 CAGAGGGAGAGGAGGGAAACGGG + Intronic
1052156010 9:25191609-25191631 CTGAGGATGATGAGGAGGAAGGG - Intergenic
1052198683 9:25750047-25750069 TTGAGGGTGGGGAGGAGTAAAGG + Intergenic
1052331684 9:27276549-27276571 CTGTGGGTGGGGTGGGGAAACGG + Intergenic
1052425871 9:28303780-28303802 CTAAGGAGGAGGAAGGGAAAGGG + Intronic
1052695761 9:31875836-31875858 CAAAGGGTGAGCAGGGGAAGAGG - Intergenic
1052851585 9:33381509-33381531 CTGAGCGTGAGAGGGGGGAAGGG + Intergenic
1052994894 9:34546713-34546735 CTGAGGATGGGGAGGAGAAATGG - Intergenic
1053150285 9:35738904-35738926 CTGTGGGAGAGGAGGGGACTTGG + Intronic
1053179150 9:35953003-35953025 GAGAGGGTGAGAAGGAGAAAGGG - Intergenic
1053477652 9:38393621-38393643 CTGAGGGTGAGGAGACCAAAAGG - Intronic
1053554014 9:39115801-39115823 CTGAGTTTGAGGAGGGGAATGGG - Intronic
1053707311 9:40768477-40768499 CTCAGGTTGAGGAGGGGCCAGGG - Intergenic
1053791432 9:41688885-41688907 CTGGGGGTGAGGATGTCAAACGG + Intergenic
1054417227 9:64889245-64889267 CTCAGGTTGAGGAGGGGCCAGGG - Intergenic
1054473509 9:65557005-65557027 CTGGGGGTGAGGATGCCAAACGG - Intergenic
1054657760 9:67680242-67680264 CTGGGGGTGAGGATGTCAAACGG - Intergenic
1055413273 9:76054016-76054038 CAGAAGGTGAGGAGGAGCAAAGG + Intronic
1055584939 9:77748941-77748963 CTCAGGGTAAGAAAGGGAAAGGG + Intronic
1055625412 9:78172281-78172303 CTGGGGGTGAAGATGGGGAAAGG + Intergenic
1055786988 9:79881627-79881649 GACAGGGAGAGGAGGGGAAAGGG - Intergenic
1056223379 9:84471514-84471536 CTCATGGGGAGGAGGGGAGAAGG - Intergenic
1056280933 9:85040752-85040774 CTGAGGCTGAGGAGGGGGTGGGG - Intergenic
1057502084 9:95603977-95603999 GGGAGGGTGGGGAGGGGAAAAGG - Intergenic
1057831301 9:98409250-98409272 ATGAGGGTGGGGAGGTGAAGCGG + Intronic
1058071854 9:100609459-100609481 CTGGGAGTGAGGAGGTTAAAGGG + Intergenic
1058104477 9:100955069-100955091 CTGATGGTGAGGATGAGACATGG + Intergenic
1058139437 9:101342375-101342397 GAGAGGGAGAGGAGGGGAAGGGG + Intergenic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1058923592 9:109640733-109640755 GTGCGGGTGGGGAGGGGAGACGG + Intergenic
1059009910 9:110445756-110445778 CTGACATTGAGGATGGGAAATGG - Intronic
1059182292 9:112228704-112228726 CTGGGAGTGGGGAGAGGAAAGGG - Intronic
1059305046 9:113347430-113347452 CTGGGGGTGGGGAGGGAAATAGG - Intergenic
1059403455 9:114085320-114085342 CAGAGGGTGAGAAAGGGAGAGGG + Intergenic
1059463262 9:114448861-114448883 CTGTGGGTGAGGAAGTGACAAGG - Intronic
1059844232 9:118254374-118254396 AAGAGGCTGAGGAGGGTAAAGGG - Intergenic
1060268792 9:122127224-122127246 CTGAGGCTGGGGAGGAGAAGGGG - Intergenic
1060548095 9:124472311-124472333 CAGAGGGTGAGAAGGGCACAGGG - Intronic
1060877860 9:127096141-127096163 CTGAGGGAGTGGTGGGGGAAAGG - Intronic
1061136822 9:128739395-128739417 CTGAGGCTGAGGCAGGAAAATGG + Intronic
1061419218 9:130464217-130464239 CTGATGGGGAGGAGGGCACAGGG + Intronic
1061669020 9:132178186-132178208 ATGAGGGTGGGGAGGGGAAGGGG - Intronic
1061690090 9:132320487-132320509 GGGAGGTTGAGGAGGGAAAATGG + Intronic
1061717534 9:132529892-132529914 CTGCTGGTGAGGATGGAAAATGG - Intronic
1062111184 9:134782901-134782923 CTGAGGAAGAGGAGGTGAAGAGG - Intronic
1062145026 9:134984381-134984403 CTGAGGCTGAGGCGGGGGAGCGG + Intergenic
1062185649 9:135216871-135216893 GTGTGAGTGAGGAGGGGGAAGGG + Intergenic
1062235607 9:135506288-135506310 CTGAGGCTGGGGAAGGGCAAGGG + Intergenic
1062530391 9:136997029-136997051 GTGTGGGTGAGCAGGAGAAATGG + Intergenic
1203435991 Un_GL000195v1:137817-137839 CTGAGGGGGAGTGGGGGTAAGGG + Intergenic
1203529384 Un_GL000213v1:124523-124545 CTGAGGCTGAGGAGGGGGATTGG - Intergenic
1203718932 Un_KI270742v1:185455-185477 CTGGGGGTGAGAAGAGAAAATGG + Intergenic
1203653166 Un_KI270751v1:149130-149152 CTGGGGGTGAGAAGAGAAAATGG + Intergenic
1185608471 X:1380518-1380540 AAGAGGGGGAGGAGGGGGAAGGG + Intronic
1185645209 X:1610838-1610860 CAGAGGGAGAGGAGGGGAGGGGG - Intergenic
1186081043 X:5932136-5932158 CTGGGGGTGTGGAGGGGAAGGGG - Intronic
1186148167 X:6646448-6646470 ATGGGGGTGAGGAGGGGCACAGG + Intergenic
1186405828 X:9301472-9301494 CTGAGGGAGGACAGGGGAAAAGG + Intergenic
1186906006 X:14111211-14111233 ATGAGGCTGAGGAGGTGACAAGG - Intergenic
1187414246 X:19078873-19078895 CAGAGGGAGGGGAGGGAAAAAGG + Intronic
1187461073 X:19487122-19487144 CTGGGGGTGGGGGGGGGGAAGGG + Intronic
1187631905 X:21182537-21182559 CTGAAGCTGATGAGAGGAAATGG - Intergenic
1188010394 X:25049146-25049168 CTGGGGGTGAGGAGTGGACAAGG + Intergenic
1188434308 X:30142952-30142974 CTCAGTGTGAGGATGGGAACTGG + Intergenic
1188515144 X:30977402-30977424 CTGAGAGTGAGGAGGCAGAAAGG - Intergenic
1188697082 X:33207100-33207122 ATGAGAATGAGGAAGGGAAATGG - Intronic
1188761435 X:34036070-34036092 CTGAGGGACAGGAAGAGAAATGG + Intergenic
1188842146 X:35029281-35029303 CTGAGGGGGAGGAAGAGAAGGGG + Intergenic
1189197070 X:39161915-39161937 AGGAGGAGGAGGAGGGGAAATGG - Intergenic
1189214863 X:39314281-39314303 GGGAGGCTAAGGAGGGGAAAGGG + Intergenic
1190081590 X:47360854-47360876 AGGAGGCTGAGGAGGGGAGATGG - Intergenic
1190221814 X:48516754-48516776 GGTAGGGTGAGGAGGGGAGATGG + Intronic
1190375625 X:49785708-49785730 CTGAGGCTGATGAGGAGACAAGG + Intergenic
1190862765 X:54359272-54359294 TTGAGGCTCAGGAGGGGAAATGG + Intergenic
1190879044 X:54479670-54479692 CTGGGGGTGGGGTGGGGAAAGGG + Intronic
1190980907 X:55455962-55455984 GTGAGGGAGAGGCAGGGAAAGGG + Intergenic
1190987790 X:55517218-55517240 GTGAGGGAGAGGCAGGGAAAGGG - Intergenic
1191670681 X:63745623-63745645 CTAAGGCACAGGAGGGGAAAGGG - Intronic
1191780807 X:64863200-64863222 CTGTGGGGGAGGTGGGGAGAGGG - Intergenic
1191844016 X:65533176-65533198 ATGAGGGAGAGAAGGGGAAAAGG + Intronic
1192229372 X:69254617-69254639 CTGGGGGTGGGGAAGGGAGAAGG + Intergenic
1192242823 X:69348291-69348313 CAGAGACTGAGCAGGGGAAAAGG + Intergenic
1192405289 X:70879109-70879131 CTGAGGGTGAGGGAGGGAAGAGG + Intronic
1192554538 X:72079454-72079476 CTGAGGCTCAGAAAGGGAAAGGG - Intergenic
1192659895 X:73030941-73030963 CTGAGTGAGAGGAGAGGAAATGG - Intergenic
1192925162 X:75748204-75748226 CTGAGGCTCAGAAGTGGAAAGGG - Intergenic
1192947879 X:75985339-75985361 CTGAGGCTCAGAAGTGGAAAGGG - Intergenic
1193585639 X:83318418-83318440 CAGAGGCCTAGGAGGGGAAATGG + Intergenic
1193926320 X:87489727-87489749 CTGGGGGTGGGGTGGGGAGAGGG + Intergenic
1193981601 X:88187617-88187639 CTCTGCGTGAGGAGAGGAAATGG + Intergenic
1194682616 X:96872242-96872264 AAGTGGGTGGGGAGGGGAAATGG - Intronic
1195081837 X:101378478-101378500 CTCAGGGTGAAGGGTGGAAATGG + Intronic
1195557333 X:106241882-106241904 CTGAGGGAAAGGATGGGAAGGGG - Intergenic
1195756606 X:108205044-108205066 AGGAGGGGGAGGAGGAGAAAGGG + Intronic
1195889133 X:109672284-109672306 ATGGGGGTGGGGAGGGGAGAGGG + Intronic
1195939966 X:110159874-110159896 CTTAGGGTGAGGAGGTGAAAGGG + Intronic
1196230837 X:113219117-113219139 CTGAGGTGGAGGAGGAGAGAAGG - Intergenic
1196638629 X:118033124-118033146 CTGAAAGTGAGGGGGGGGAATGG + Intronic
1196899643 X:120370105-120370127 CACAGGGTGGGGAAGGGAAAAGG - Intronic
1197188220 X:123612513-123612535 CAGGGGCTGAGAAGGGGAAATGG + Intronic
1197861849 X:130979551-130979573 CTCTGGGTGAGGTGGGCAAAAGG - Intergenic
1198018004 X:132631319-132631341 CTGGGAGTGAGGATGGAAAAGGG + Intronic
1198370718 X:135986061-135986083 CTGGGGGTGCGGAGGAAAAAGGG - Intronic
1198382988 X:136101553-136101575 CTGTGGATGAGGATGGGAAGAGG + Intergenic
1198627686 X:138596856-138596878 CTGGGGCTGTGCAGGGGAAAAGG + Intergenic
1198670457 X:139074737-139074759 CTGAGGCTGAGGAGTTGAGAAGG - Intronic
1199492233 X:148413066-148413088 CTGAGGGGATTGAGGGGAAATGG + Intergenic
1199667730 X:150114105-150114127 ATGAGGGTGAAGATGGGGAAGGG - Intergenic
1199833904 X:151569747-151569769 CTGAGGGTGGGGTGGGGAGAGGG + Intronic
1199893384 X:152110041-152110063 CTGAGGGAAAGAAGGGGGAAGGG - Intergenic
1199950985 X:152706146-152706168 CTGAGGGAGAGAAGGGGGAAGGG + Intergenic
1199953282 X:152722760-152722782 CTGAGGGAGAGAAGGGGGAAGGG + Intergenic
1199956400 X:152745690-152745712 CTGAGGGAGAGAAGGGGGAAGGG - Intergenic
1199958697 X:152762315-152762337 CTGAGGGAGAGAAGGGGGAAGGG - Intergenic
1200154958 X:153970430-153970452 GGGAGGGGGAGGAGGGGAGAAGG + Intronic
1200165273 X:154031195-154031217 CAGAGGGTGTGCAGGTGAAAAGG - Exonic
1200172250 X:154085740-154085762 CAGAGGGTGGGGTGGGGGAAAGG + Intronic
1200402346 X:156026895-156026917 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1201173088 Y:11290297-11290319 CTGGGGGTGAGAAGAGAAAATGG + Intergenic
1201645534 Y:16225822-16225844 CTGAGGAGGAAGAAGGGAAAGGG + Intergenic
1201657279 Y:16359492-16359514 CTGAGGAGGAAGAAGGGAAAGGG - Intergenic