ID: 1084667680

View in Genome Browser
Species Human (GRCh38)
Location 11:70585208-70585230
Sequence TGGTCCATCCACTGGCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084667673_1084667680 11 Left 1084667673 11:70585174-70585196 CCGCCTGACTCGAGGGTGGGCTC 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1084667680 11:70585208-70585230 TGGTCCATCCACTGGCTGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 163
1084667667_1084667680 21 Left 1084667667 11:70585164-70585186 CCCTGGGAGACCGCCTGACTCGA 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1084667680 11:70585208-70585230 TGGTCCATCCACTGGCTGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 163
1084667674_1084667680 8 Left 1084667674 11:70585177-70585199 CCTGACTCGAGGGTGGGCTCCTG 0: 1
1: 0
2: 1
3: 16
4: 308
Right 1084667680 11:70585208-70585230 TGGTCCATCCACTGGCTGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 163
1084667668_1084667680 20 Left 1084667668 11:70585165-70585187 CCTGGGAGACCGCCTGACTCGAG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1084667680 11:70585208-70585230 TGGTCCATCCACTGGCTGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084667680 Original CRISPR TGGTCCATCCACTGGCTGGC AGG Intronic
900510923 1:3060731-3060753 TGGTCCACCCACAGGCTCCCTGG - Intergenic
901527941 1:9835844-9835866 AGCCCCATCCACTGGCTGTCAGG - Intergenic
901532579 1:9862887-9862909 TGCTCCATCCAATGGCTGGACGG - Intronic
901693577 1:10990258-10990280 TGGTCCCTCCCCTTGCTGGCTGG - Intergenic
902214852 1:14928065-14928087 TGGGACATCCACTGGCTGTGTGG - Intronic
903711424 1:25327771-25327793 TAGTTCACCCACTGGCAGGCTGG + Intronic
903715524 1:25363658-25363680 TAGTTCACCCACTGGCAGGCTGG - Intronic
904304936 1:29582573-29582595 TGATCTATCCACTGCCTGGATGG + Intergenic
904443890 1:30551837-30551859 TGGTCCAGCCACAGCCTCGCAGG + Intergenic
905938102 1:41840740-41840762 TCGTCCAGTGACTGGCTGGCTGG - Intronic
906552202 1:46674325-46674347 TGGTCCATGAACTGGCTTGGAGG + Intergenic
906939948 1:50247333-50247355 TGGTCCAGACAGTGGCTGGAGGG - Intergenic
908134614 1:61117885-61117907 TGGAACATCGTCTGGCTGGCCGG + Intronic
909283756 1:73789305-73789327 AAGGCCATCCACTGGCTGGACGG + Intergenic
910340773 1:86184458-86184480 TGTTCCATCTTCTGGCTGGGAGG + Intergenic
912391121 1:109303756-109303778 CAGTCCCTGCACTGGCTGGCTGG + Intronic
912718318 1:111998668-111998690 TTCTCCATCCACTGGCTGAATGG + Intergenic
914990063 1:152491725-152491747 TGCTCCCTCTACTGGCTGCCAGG + Intergenic
914992942 1:152514477-152514499 TGCTCAATCCACTGCCTAGCAGG + Intronic
916164689 1:161955472-161955494 AGGTCCCTCCCCTGGGTGGCTGG - Intronic
916681642 1:167110085-167110107 TGGTGGCTCCACTGGGTGGCTGG + Intronic
924205553 1:241707979-241708001 TGCTCCATCCACTTTATGGCAGG + Intronic
1062899199 10:1129290-1129312 TGTTCCAACCAATGGCTTGCCGG - Exonic
1063034960 10:2277337-2277359 TGGTACAGTCACTGGATGGCAGG + Intergenic
1066198907 10:33127734-33127756 TGCTCCCTGCACTGGCGGGCAGG + Intergenic
1067098224 10:43316240-43316262 TGGTCCATCCCCTGGAGGCCAGG + Intergenic
1067150236 10:43726504-43726526 TGGCCCCTCCACTGGCTGCTGGG - Intergenic
1068197221 10:53732383-53732405 TGGACTATCCAGTGGCTGGGTGG + Intergenic
1068664394 10:59657831-59657853 GGGTCCATCAGCTGGCTGGGTGG - Intronic
1069906272 10:71734417-71734439 TGGCCCATACATTGGGTGGCTGG - Intronic
1073733666 10:106320931-106320953 TGGTCCAGCCACAGCCTTGCAGG + Intergenic
1076091305 10:127688545-127688567 TGGTCAGTCCACAGCCTGGCAGG + Intergenic
1076427530 10:130378391-130378413 TGGTCCTCCCACTGCCTGGATGG + Intergenic
1076469926 10:130711195-130711217 TGGTCCAGCATCTGGCTGCCTGG - Intergenic
1076546002 10:131246111-131246133 GGGCCCATCCCCTGGCTGGAGGG + Intronic
1076559134 10:131349748-131349770 TGGTCCAACCCCTGACTTGCAGG + Intergenic
1076848561 10:133081957-133081979 GGGTGCAGCCACTGGCTGGCGGG + Intronic
1076883260 10:133249665-133249687 GGCTCCATCCACCTGCTGGCAGG + Intergenic
1077287548 11:1774375-1774397 AGATGCATCCCCTGGCTGGCGGG - Intergenic
1083276103 11:61597925-61597947 TGGTCCTCCCACTACCTGGCAGG - Intergenic
1084667680 11:70585208-70585230 TGGTCCATCCACTGGCTGGCAGG + Intronic
1085365466 11:75938637-75938659 TGGGCCATACTCTGGCTGTCAGG + Intronic
1085718979 11:78896774-78896796 GGGTCCATCCCCAGGCTGGCTGG - Intronic
1086249443 11:84795861-84795883 TGGTTCAACCACAGGCTCGCAGG + Intronic
1088111191 11:106263813-106263835 TGGCCCCTCCACATGCTGGCAGG + Intergenic
1088495780 11:110430178-110430200 TGGTGCAGCCACCGGCCGGCCGG - Exonic
1088573668 11:111248433-111248455 TGGTCCATTCTCTGCCTGTCAGG - Intergenic
1089900062 11:121972632-121972654 TGCTCCTTCCACTGTCTGGAAGG - Intergenic
1091657915 12:2359309-2359331 AGGTCCACCCACTGGCTCACTGG - Intronic
1095939349 12:47716087-47716109 TGGCACATCCTCTGGCTGGCTGG - Intronic
1097950138 12:65418764-65418786 TTTGCCATCCACTGTCTGGCGGG + Intronic
1101846715 12:108368690-108368712 TGGTCAGTCCATTGACTGGCTGG + Intergenic
1102261755 12:111447356-111447378 TGGTCCGTCTTCTGGCAGGCCGG - Exonic
1103456579 12:121071654-121071676 TGCTCCCTGCAGTGGCTGGCAGG - Intergenic
1103593493 12:122008877-122008899 TGGTCCCCTCACTGGCTGCCTGG + Intergenic
1108016910 13:46086031-46086053 TGGTCCAGCCACAGCCTTGCAGG - Intronic
1109982378 13:69924884-69924906 TGGTCCAGCCACAGCCTTGCAGG + Intronic
1113880106 13:113620148-113620170 TGCTCCACCCACAGGCCGGCCGG - Intronic
1117880454 14:60308338-60308360 TGATCCATCCACTGTGTGGTAGG - Intergenic
1118839984 14:69502678-69502700 TGGCCCACCCTCTGGCTGGCAGG + Intronic
1120405834 14:84092108-84092130 TGGTCCAGCCACAGCCTTGCAGG + Intergenic
1121472438 14:94165888-94165910 TCCTCCATCCACTTCCTGGCTGG + Intronic
1122114258 14:99520053-99520075 CCCTCCATCCACTGGCTGTCAGG - Intronic
1128621114 15:69150764-69150786 TCTCTCATCCACTGGCTGGCTGG - Intergenic
1129167481 15:73786944-73786966 TGGCACATCCCCTGGCGGGCTGG + Intergenic
1129702431 15:77775474-77775496 TGGAGCATCAACTGGCTGGGTGG + Intronic
1130577536 15:85105747-85105769 TGTTCTCTCCACTGGCAGGCCGG + Intronic
1132849145 16:2016655-2016677 TGGACCCTCCCCTGACTGGCTGG + Intronic
1132853685 16:2035605-2035627 TGGCCCACCCCCTGGCTGGGAGG + Intronic
1134126312 16:11618623-11618645 TGCTCCACCCACTGGGAGGCGGG - Intronic
1134677229 16:16099213-16099235 TTGTCCATCCACTGTGTGCCAGG - Intronic
1138730958 16:59194665-59194687 TGGTCCAACCACTGACTGATTGG - Intergenic
1139183217 16:64771320-64771342 TGGTCCAGCCACAGGCTGACAGG + Intergenic
1139759806 16:69175624-69175646 TTTGCCATCCACTGTCTGGCGGG + Intronic
1141289787 16:82707057-82707079 TGGACCATCCCCTGTTTGGCGGG + Intronic
1141384821 16:83611063-83611085 TCTTCCATCCACTGGCTGTTGGG + Intronic
1141471632 16:84242636-84242658 AGTGCCATCCACTGGCTGGGAGG - Intergenic
1141692188 16:85602650-85602672 TGGTCCATCCACTGGCTCAGAGG - Intergenic
1142195523 16:88737664-88737686 TGAGCCATGCACGGGCTGGCCGG + Intronic
1142519515 17:495023-495045 TGTTTAATCCACTGTCTGGCAGG - Intergenic
1142957230 17:3530263-3530285 TGGACCAGCCAGAGGCTGGCTGG + Intronic
1148852420 17:50561445-50561467 TCGTCCATCCTCTGGCCAGCCGG - Exonic
1149541645 17:57472253-57472275 TGGTTCATGGACTGCCTGGCAGG + Intronic
1152321975 17:79612813-79612835 GGGCCCAGCCACTGCCTGGCAGG + Intergenic
1152999701 18:443012-443034 TGGTCCAGCCACCTGCTAGCAGG + Intronic
1158069565 18:53454622-53454644 TGTTAGAACCACTGGCTGGCTGG + Intronic
1160229666 18:77037675-77037697 TCTTCCATCCTCTGGCTTGCAGG + Intronic
1162301914 19:9849265-9849287 GGGTTCGGCCACTGGCTGGCGGG - Exonic
1164859250 19:31549780-31549802 TGGTCCAGCACCTGGCTGGCTGG - Intergenic
1167804016 19:51766672-51766694 TGCTGCCTCCACTGACTGGCTGG + Intronic
925331375 2:3061414-3061436 TGGTCCCTATGCTGGCTGGCAGG - Intergenic
927181939 2:20452866-20452888 TGGTCCATCTTCTGGCTGGAAGG + Intergenic
927878603 2:26675024-26675046 TGGCGCATCCTCTGGCTGGTTGG + Intergenic
930780933 2:55224375-55224397 AGGACCATCCACTGGGTGTCGGG - Intronic
931372838 2:61680114-61680136 TCGTCCATCCACAGGCTTGATGG - Intergenic
932338136 2:70942729-70942751 TGGGTCAGCCACAGGCTGGCAGG - Intronic
932465995 2:71924682-71924704 TGGCTCCTCCACTTGCTGGCTGG + Intergenic
933657614 2:84902710-84902732 TTCCCCATCCACTGGCTGGATGG + Intronic
935894896 2:107724879-107724901 TGGTCCATCTTCTGTCTGACAGG - Intergenic
939458073 2:142463711-142463733 TGTTTTACCCACTGGCTGGCTGG - Intergenic
942114242 2:172712571-172712593 TGGTCCAACCACAGCCTAGCAGG - Intergenic
942315488 2:174693220-174693242 TGGTCCAGCCACAGCCTTGCAGG + Intergenic
943548567 2:189311302-189311324 TTGGCCATCCACTATCTGGCAGG + Intergenic
943858521 2:192829036-192829058 TGGTCCACCCACAGCCTTGCAGG + Intergenic
947610165 2:231520154-231520176 TGATCTATCCACTGGCTTGAAGG - Intergenic
947621327 2:231593071-231593093 TGTCGCATCCACTGACTGGCAGG + Exonic
947717796 2:232350619-232350641 GGGTCCAGCCACAGGCTGGGGGG - Intergenic
947740869 2:232484300-232484322 GGGTCCAGCCACAGGTTGGCGGG - Intronic
1172379510 20:34476395-34476417 TGGTGCAGCCACCGGCCGGCCGG + Intronic
1173984036 20:47247264-47247286 TGTTCCAGCCAATGCCTGGCAGG - Intronic
1174349676 20:49957968-49957990 TTTGCCATCCACTGTCTGGCGGG - Intergenic
1175687755 20:61043967-61043989 TTGTCCTTCCACTGGCTACCTGG - Intergenic
1176181816 20:63753037-63753059 TGTCCCACCCACTGTCTGGCAGG + Intronic
1177387279 21:20424991-20425013 TTTGCCATCCACTGTCTGGCAGG + Intergenic
1179626539 21:42652675-42652697 TGGCCCTGGCACTGGCTGGCCGG + Intergenic
1182058314 22:27378644-27378666 TGGTCTCTCCACAGCCTGGCAGG + Intergenic
1183722599 22:39571222-39571244 GGGTCAGTCCAGTGGCTGGCTGG + Intronic
1185042955 22:48514979-48515001 AGGTTCAGCCACTTGCTGGCTGG - Intronic
950262592 3:11553635-11553657 CGGCCCATCCACAGCCTGGCTGG + Intronic
953585917 3:44200956-44200978 TGCTTCATCCACTGTCTAGCTGG - Intergenic
956478295 3:69646848-69646870 AGGTTCATCCGCTGCCTGGCGGG - Intergenic
961942867 3:130655966-130655988 TGGTCCAGCCACAGCCTCGCAGG - Intronic
963130297 3:141851672-141851694 TGGTCAAGGCACTGGCAGGCGGG + Intergenic
964999624 3:162936698-162936720 TGGGCCATCCAATGACTGGGTGG + Intergenic
969460374 4:7325876-7325898 GGATCCATGCACTGGCGGGCGGG + Intronic
969931817 4:10638044-10638066 TGGACCTGCCACTGGCTTGCAGG - Intronic
971820031 4:31539794-31539816 TGTTACCTCCACTGGCTGGCAGG + Intergenic
974420245 4:61663395-61663417 TGGTCCAGCCACAGCCTCGCTGG + Intronic
976660332 4:87534166-87534188 GGGTCCATCCTCTGGATGGGAGG - Intergenic
976734423 4:88295950-88295972 TGGTCCAGCCACAGACTTGCAGG - Intergenic
977394211 4:96451109-96451131 TGGTGCTACCAGTGGCTGGCTGG + Intergenic
977645825 4:99410414-99410436 TGGTCCAGCCACAGACTTGCAGG - Intergenic
977816142 4:101416234-101416256 TGGTCCAGCCACAGCCTTGCAGG - Intronic
978219612 4:106255494-106255516 TGGTCCAACCACAGCCTTGCAGG - Intronic
981015415 4:139969070-139969092 TCTCCCATTCACTGGCTGGCTGG - Intronic
982364782 4:154565671-154565693 AGATCCATCAACTGGCTGGTTGG - Intronic
982611155 4:157575448-157575470 TGGTCCAGCCACAGCCTTGCAGG + Intergenic
983856367 4:172651133-172651155 TTGTCCATCCACTGGATTCCAGG + Intronic
984169337 4:176342673-176342695 TGGTCCAGCCACAGTCTAGCAGG - Intergenic
984337947 4:178416021-178416043 TGGTCCAGCCACAGACTTGCAGG + Intergenic
994040231 5:95250570-95250592 TGGTCCATCCACATCCTAGCTGG + Intronic
996183690 5:120451209-120451231 TGGTCCAGCCACAGCCTTGCAGG - Intergenic
998596549 5:143536455-143536477 TGGTACATCCACAAGCTGCCTGG + Intergenic
999613004 5:153391127-153391149 TGCTCCCTCCACTGGCTGCCAGG + Intergenic
1004877301 6:19968652-19968674 AGGTCCATCCTCTTGCTGACCGG + Intergenic
1005987060 6:30882147-30882169 TGGTCCGTCCTCTCGCTCGCTGG + Intronic
1006444748 6:34073943-34073965 TGGTCCAGCAACTGGATGGAGGG + Intronic
1009243266 6:61204346-61204368 TGGTCCAGCCACAGCCTTGCAGG - Intergenic
1011775218 6:90722289-90722311 TGGGCCATACACTGGGTGCCTGG - Intergenic
1021991126 7:26142567-26142589 CGCTCCATCCACTGGCTGAATGG + Intergenic
1023955412 7:44883379-44883401 TGTTACAGCCACTGGTTGGCTGG - Exonic
1026982107 7:74532910-74532932 TGGTCCAGCCACTCCATGGCAGG + Intronic
1027528538 7:79301228-79301250 TGGTAGATCCACTGGCAGCCTGG + Intronic
1029375768 7:100176223-100176245 TGGTTCACACACTGGCTGCCAGG - Exonic
1032858428 7:135856559-135856581 TCCTCCATCCACTGGCGTGCTGG + Intergenic
1035546045 8:483207-483229 TGGCCCCTCCACTGGCTGTTCGG + Intergenic
1043554846 8:81419675-81419697 TGGTCCCCCCACTTGATGGCAGG + Intergenic
1047512505 8:125526395-125526417 TGGATCATCCACTCACTGGCTGG - Intergenic
1048049708 8:130805755-130805777 TTGTCTATTCAGTGGCTGGCAGG + Intronic
1048506963 8:135030446-135030468 GGGTCCATTCACTGAGTGGCTGG + Intergenic
1048525160 8:135195884-135195906 TGGCTCATCCCCTGGCTGCCAGG - Intergenic
1048979302 8:139694586-139694608 TGGCCCATTCATTGGATGGCTGG + Intronic
1049352599 8:142172062-142172084 TGGGGCACCCACAGGCTGGCTGG + Intergenic
1049795073 8:144493478-144493500 TGGTCCATCTTGTGGCTGGGAGG + Intronic
1052580520 9:30349188-30349210 TGGTCCAGCCACAGCCTTGCAGG - Intergenic
1052652286 9:31320750-31320772 TGGTCCAGCCACAGCCTTGCAGG - Intergenic
1053417393 9:37955351-37955373 TGGGCCTACCACTGGCTGGGTGG + Intronic
1054778575 9:69145287-69145309 TAGTTCATCCAGTGGCAGGCAGG + Intronic
1055708756 9:79036450-79036472 TTTGCCATCCACTGTCTGGCAGG + Intergenic
1055930995 9:81559781-81559803 CAGTCCATCCAGTGGCTGTCAGG - Intergenic
1062117512 9:134817421-134817443 TGGTCCAGCCACTTGCTGGTGGG + Intronic
1062585014 9:137245288-137245310 TGGTGCATCCCCTGGCTGCCTGG + Exonic
1187082593 X:16006871-16006893 TGTTCCAGCCCCTGGCTGTCTGG - Intergenic
1188239955 X:27773805-27773827 TGCTTCATTCACTGCCTGGCTGG + Intergenic
1188567745 X:31545779-31545801 TGGACCCTCCACTAGCAGGCAGG + Intronic
1188714831 X:33448601-33448623 TGCTGCTACCACTGGCTGGCTGG - Intergenic
1195697784 X:107679461-107679483 TGGCCCTTCCCCTGGCAGGCAGG + Intergenic
1198132747 X:133714918-133714940 TGCTCCCTCCAGTGGCTGCCAGG - Intronic