ID: 1084668707

View in Genome Browser
Species Human (GRCh38)
Location 11:70592586-70592608
Sequence GGGTGCAGACAGAGGGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 717
Summary {0: 1, 1: 0, 2: 6, 3: 56, 4: 654}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084668707_1084668718 13 Left 1084668707 11:70592586-70592608 CCTCTGTCCCTCTGTCTGCACCC 0: 1
1: 0
2: 6
3: 56
4: 654
Right 1084668718 11:70592622-70592644 AATGTGTGCAGCCCTGGTCCTGG 0: 1
1: 0
2: 2
3: 10
4: 168
1084668707_1084668717 7 Left 1084668707 11:70592586-70592608 CCTCTGTCCCTCTGTCTGCACCC 0: 1
1: 0
2: 6
3: 56
4: 654
Right 1084668717 11:70592616-70592638 AGGGCAAATGTGTGCAGCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084668707 Original CRISPR GGGTGCAGACAGAGGGACAG AGG (reversed) Intronic
900009154 1:90313-90335 TGGCAGAGACAGAGGGACAGAGG - Intergenic
900009164 1:90372-90394 TGGCAGAGACAGAGGGACAGAGG - Intergenic
900025267 1:266890-266912 TGGCAGAGACAGAGGGACAGAGG - Intergenic
900028869 1:356272-356294 TGGCAGAGACAGAGGGACAGAGG - Intergenic
900105663 1:979863-979885 GGGTGTAGACAGAGCCACACTGG + Exonic
900241194 1:1618372-1618394 GGGTGGAGGCAGAGGGAGTGAGG + Intronic
900351533 1:2237279-2237301 GGGCGTGGACAGAGAGACAGAGG - Intronic
900623510 1:3597974-3597996 GGATGGAGACAGAGGCAGAGAGG + Intronic
900638363 1:3676428-3676450 GGGAGAGGACAGAGGAACAGGGG + Intronic
900701882 1:4053622-4053644 GGCTGCAGGAAGAGAGACAGGGG - Intergenic
901225735 1:7611966-7611988 GGGTGCACAGAGATGGGCAGGGG + Intronic
901475239 1:9485014-9485036 GGGTCCATGCAGAGGGGCAGGGG - Intergenic
901625617 1:10623189-10623211 GAGTGGAGACAGAGGGAGAGGGG - Intronic
902374337 1:16023227-16023249 GGCTGCAGCCAGCGGGCCAGGGG + Intronic
902384291 1:16067606-16067628 GGTTGAAGACAGAGGGATGGAGG - Intronic
902468195 1:16630844-16630866 GGGCGCAGCCAGAGGCCCAGGGG - Intergenic
902532859 1:17101585-17101607 TGGGACAGAAAGAGGGACAGGGG + Intronic
902684516 1:18067224-18067246 GGATGAAGACAAAGGGAGAGAGG + Intergenic
903154944 1:21436833-21436855 GGGTGCAGCCAGAGGCCCGGGGG + Intergenic
903282356 1:22257276-22257298 GGGAGGACACAGAGGCACAGGGG + Intergenic
903334273 1:22614472-22614494 GAGTGGGGACAGAGAGACAGAGG - Intergenic
903510220 1:23869067-23869089 GGGTACTGAAAGAGGGAGAGCGG + Intergenic
903808609 1:26022261-26022283 GGGTGCAGCCAGGAGGGCAGGGG + Exonic
903858738 1:26352791-26352813 GGCTGCAGAGAGAGGGAAGGGGG - Intronic
904380938 1:30110492-30110514 GGGGGCTGACCGAGGGGCAGGGG - Intergenic
904392999 1:30198028-30198050 GGGAGGAGAGAGAGAGACAGGGG + Intergenic
904393005 1:30198068-30198090 GGGAGGAGAGAGAGAGACAGAGG + Intergenic
904393037 1:30198230-30198252 GGGAGGAGAGAGAGAGACAGAGG + Intergenic
904562509 1:31408264-31408286 CTGTGCAGAGAGATGGACAGAGG - Intergenic
904585298 1:31576679-31576701 GATGGCAGAGAGAGGGACAGTGG + Intronic
904990590 1:34589613-34589635 GGGTCCAGCCAGAGGGTCTGTGG + Intergenic
905388712 1:37622647-37622669 GGGAGGAGACTGAGAGACAGAGG + Intronic
905628203 1:39502605-39502627 GGGGGCAGTCAGAAGGACACAGG + Intronic
905803185 1:40858935-40858957 GACAGCAGACAGATGGACAGGGG - Intergenic
905933732 1:41807428-41807450 AGGTACAGAGAGAGAGACAGAGG + Intronic
906646315 1:47478047-47478069 GGGAGGGGACAAAGGGACAGTGG - Intergenic
907108506 1:51905650-51905672 AGATTCAGACAGAGGGACAAAGG - Intergenic
907456606 1:54580425-54580447 GGGTGGAGACAGAGGAAGAGGGG - Intronic
907505290 1:54913724-54913746 GGGTGCAGTGAGAGTGAAAGGGG + Intergenic
907827912 1:58036695-58036717 GAGTGGAGGCAGAGGTACAGAGG + Intronic
907866314 1:58402649-58402671 GGGGGGAGAGAGAGGGAGAGAGG + Intronic
908374726 1:63523670-63523692 AGCTGCACAGAGAGGGACAGAGG - Intronic
908605312 1:65792271-65792293 GGCTGCACAAAGAGGGACTGGGG - Intergenic
908788923 1:67761799-67761821 GGGTGCAGGGAGAGAGGCAGGGG + Intronic
911260992 1:95685221-95685243 GGGAGGTGACAGAAGGACAGAGG - Intergenic
912274480 1:108242035-108242057 GGGGGCAGGCAGATGGGCAGGGG - Intronic
912286787 1:108377823-108377845 GGGGGCAGGCAGATGGGCAGGGG + Intronic
912293739 1:108452306-108452328 GGGGGCAGGCAGATGGGCAGGGG + Intronic
912412098 1:109486626-109486648 GGGAGGAGATAAAGGGACAGGGG + Intronic
912681928 1:111734240-111734262 AGGGGCAGACAGATGGAGAGGGG + Intronic
916446859 1:164880706-164880728 GGGGGCAGCAAGAGTGACAGTGG - Intronic
916894895 1:169151817-169151839 GGGAGGAGGCAGATGGACAGAGG - Intronic
917061536 1:171047260-171047282 GGATGCAGAGAAAGAGACAGGGG - Intronic
918250143 1:182696154-182696176 GGGTTCTTACAGAGGGATAGAGG - Intergenic
918407367 1:184224166-184224188 GGGTGGAGAGAGAGGGAAGGAGG - Intergenic
919714349 1:200759996-200760018 GGGAGCAGACATTGGGAGAGTGG + Intronic
919977162 1:202620180-202620202 CTGGGCAGACAGAAGGACAGCGG - Intronic
920165209 1:204031055-204031077 GGGTGCAGGCAAAGGGAAAAGGG - Intergenic
920957778 1:210634896-210634918 GGCAGGAGAAAGAGGGACAGTGG + Intronic
921089532 1:211830329-211830351 GCCTGCGGACAGAGGGACGGCGG + Intronic
921805407 1:219448568-219448590 AGGTGTAGACAGATGGACAATGG - Intergenic
922574157 1:226651235-226651257 GGCTGCAGACAGAGGGAGATAGG + Intronic
922966703 1:229696724-229696746 GGTTGAAGACAGAGGGAGAGGGG - Intergenic
923125150 1:231028142-231028164 GGATGCAGCCAGAGGGTCTGTGG - Intronic
923280857 1:232441708-232441730 GGGGGCAGAGAGGGGGAAAGGGG + Intronic
923435556 1:233964673-233964695 AGCTACAGACAGAGGGACAAAGG + Intronic
923779231 1:237007410-237007432 GGGAGGAGAGAGAGGGAGAGAGG - Intergenic
923783055 1:237042630-237042652 GGGTCCGGGCAGAGTGACAGCGG + Intronic
1063364197 10:5479995-5480017 TGGTGCAGACACAGTGGCAGGGG - Intergenic
1064140113 10:12783336-12783358 GGGAGCAGCCTGGGGGACAGGGG - Intronic
1065483885 10:26218021-26218043 CGGGGCAGAGAGAGGGGCAGGGG - Intronic
1066048918 10:31617933-31617955 GAGTGGAGACACAGGGATAGGGG - Intergenic
1066113872 10:32222560-32222582 GCATGCAGACAGAGGGAGAACGG - Intergenic
1066290602 10:34011164-34011186 GGGTGCAGTAACAGGGAGAGTGG + Intergenic
1066491492 10:35899206-35899228 GGGAGCCGACAGAGTGGCAGCGG + Intergenic
1067059165 10:43069064-43069086 GGCTGCAGAGAGTGGGGCAGCGG + Intergenic
1067099102 10:43321887-43321909 GGGTGTTCACAGTGGGACAGAGG + Intergenic
1067569386 10:47360410-47360432 CGGGGCAGACACAGGGACACAGG - Intergenic
1067908102 10:50315390-50315412 GGGTGCAGACAGAGCTCCAAGGG - Intronic
1067999122 10:51311055-51311077 GGGTGCAGAAAAAGGGAATGAGG + Intronic
1069874553 10:71553561-71553583 GGCTTGGGACAGAGGGACAGGGG + Intronic
1070168435 10:73914751-73914773 GGGGGAGGACAGAGGGTCAGAGG - Intronic
1070170393 10:73928476-73928498 GGGAGCAGACAGAAGGGCAATGG + Intergenic
1070964038 10:80518614-80518636 TGGTGGACACAGGGGGACAGTGG - Exonic
1071264739 10:83954862-83954884 AGGTGAAGACTGAGGGAAAGTGG - Intergenic
1071564572 10:86665159-86665181 GGGAGCAGCCAGAGGGACCCTGG + Intronic
1073148022 10:101293006-101293028 GGGTGGAGACAGAGAGAGGGCGG - Intergenic
1075743870 10:124712887-124712909 GGGTGCAGACACGGTGGCAGGGG + Intronic
1075805681 10:125187243-125187265 GGGTGGGGGCAGAGGGAAAGAGG - Intergenic
1075911123 10:126126683-126126705 GGGTGGAGACAGAAGCACAGTGG + Intronic
1076199043 10:128543512-128543534 GCGTGCAGACGGACGGATAGAGG - Intergenic
1076563891 10:131385575-131385597 AGGAGCAGAGAGAGGGATAGAGG + Intergenic
1076564109 10:131386566-131386588 AGGAGCAGAGAGAGGGGCAGAGG + Intergenic
1076602733 10:131669511-131669533 GGGTGGAGAAAGAGAGAGAGGGG + Intergenic
1076987506 11:249537-249559 GGGTGCAGGGAGGGGGAGAGCGG + Intronic
1077471480 11:2762899-2762921 GTGGGCAGACAGATGAACAGTGG - Intronic
1077490627 11:2859340-2859362 AGGTGTAAAGAGAGGGACAGAGG + Intergenic
1077778918 11:5303543-5303565 TGGTGGAGAGAGATGGACAGAGG + Intronic
1078424510 11:11238457-11238479 GGTTGCAGACCAAGGGAAAGGGG - Intergenic
1078433065 11:11302454-11302476 GGGTGCAGGCAGAGGGCAGGAGG - Intronic
1078577503 11:12514313-12514335 GGGTGCAGAGAAAGAGAGAGAGG - Intronic
1078590077 11:12632941-12632963 GGGAGCAGCCAGAAAGACAGAGG - Intergenic
1079329997 11:19525444-19525466 GGGTGCAGGCAGAGGAAGTGAGG + Intronic
1079532734 11:21474609-21474631 TGGTGCAGTGAAAGGGACAGGGG - Intronic
1079601021 11:22313619-22313641 GGGTGCAGTGAGAGTGAAAGAGG + Intergenic
1081189307 11:40083006-40083028 GGGGGGAGAGAGAGGGAAAGGGG + Intergenic
1081736863 11:45410427-45410449 GGGAGAAGATGGAGGGACAGAGG - Intergenic
1081742357 11:45449562-45449584 GGGGGCAGAGAGAGAGACAAGGG - Intergenic
1082084916 11:48041997-48042019 GGGTGGAGAGAGAGAGAGAGAGG + Intronic
1082085966 11:48049794-48049816 GTGGGCAGACAGATTGACAGTGG + Intronic
1083043996 11:59715879-59715901 GGGTGGAGATAGAGGGAGGGTGG + Intronic
1083427122 11:62593920-62593942 GGGTGCAGGTAGAGGGACAGGGG + Exonic
1083429154 11:62604971-62604993 GGCTGCAGGGAGAGGCACAGAGG + Intronic
1083431170 11:62614237-62614259 GGCTGCAAAGGGAGGGACAGAGG - Exonic
1083619233 11:64040774-64040796 GGGTGCAGGCAGAGGGAGAAGGG + Intronic
1083743955 11:64724951-64724973 GGCTGCAGGAAGAGGAACAGTGG - Intergenic
1084107090 11:66987325-66987347 GAGTGCAGACAGAGGCTCAGAGG + Intergenic
1084376252 11:68779834-68779856 AGGTGCAGGCAGGGGGACAGGGG + Intronic
1084536095 11:69758047-69758069 GGGCGCAGACAGAGGGAAACTGG + Intergenic
1084563525 11:69917180-69917202 GAGTGAAGAGAGAGGGAGAGAGG - Intergenic
1084596970 11:70122765-70122787 AGGAGGAGACAGAGAGACAGAGG - Intronic
1084668707 11:70592586-70592608 GGGTGCAGACAGAGGGACAGAGG - Intronic
1084919803 11:72459829-72459851 GCCTGCAGACAGAGGGACTGTGG + Intergenic
1084941979 11:72617834-72617856 AGGGGCAGAGAGAGGGAAAGGGG - Intronic
1084972537 11:72779770-72779792 AGGTGCAGACAGAGTCAGAGGGG + Intronic
1086114821 11:83237872-83237894 GGGAGCAGTCAAAGGGAGAGAGG - Intronic
1087104767 11:94398447-94398469 TAGTGCAGACAGAGGGACCAGGG - Intronic
1087902944 11:103663114-103663136 GGGTGCAGGGAGGGAGACAGTGG + Intergenic
1087945679 11:104157555-104157577 GGGTGCAGTGAGAGGGAGAAGGG - Intronic
1088072005 11:105798591-105798613 GGGTGTGGACAGAGACACAGAGG + Intronic
1088096405 11:106105852-106105874 GGAGGAAGACAGAAGGACAGAGG - Intergenic
1088339278 11:108744909-108744931 AGGTGAAGAAAGAGGGAAAGAGG + Intronic
1089009519 11:115121178-115121200 TGGTGCAGACAGAGGGGGAGTGG + Intergenic
1089480310 11:118799440-118799462 GGGTACAGAGTGAGGGAGAGGGG - Intergenic
1089505318 11:118958382-118958404 GGGGGCAAGGAGAGGGACAGAGG - Exonic
1089534353 11:119151401-119151423 GGGGGCAGAGAAAGGGACAACGG - Intronic
1089655907 11:119946784-119946806 GGGTCAAGGCAGTGGGACAGTGG + Intergenic
1089983337 11:122790339-122790361 GGGAGCAGAGTGAGGGAGAGGGG - Intronic
1090204765 11:124878110-124878132 GAGTGGAGCCAGGGGGACAGTGG + Exonic
1090252582 11:125262187-125262209 GGGGCCAGACAGTGAGACAGTGG + Intronic
1090264751 11:125346889-125346911 GAGTTCAGAGAGAGGGATAGAGG - Intronic
1090362790 11:126185274-126185296 GAGAGACGACAGAGGGACAGAGG + Intergenic
1090468526 11:126957220-126957242 GGGAGCAGCCAGAGAGTCAGAGG - Intronic
1090475313 11:127014877-127014899 GGGTACAGACTGAGTGACTGGGG + Intergenic
1090966422 11:131601209-131601231 GGGAGCATACAGATGGACAGTGG + Intronic
1090983557 11:131745954-131745976 GGCAGCAGAAAGAGGGACACAGG - Intronic
1091776503 12:3188383-3188405 GGAAGCAGACAGAGCGGCAGGGG + Intronic
1091828767 12:3534563-3534585 GGGTGCAGATGGAGAGACTGAGG - Intronic
1091830814 12:3550137-3550159 GGGTGGAGGCAGAGGGCAAGAGG - Intronic
1092118127 12:6024059-6024081 GGAGGTAGGCAGAGGGACAGAGG - Intronic
1092263357 12:6963767-6963789 TGTTGCTGACACAGGGACAGGGG - Intergenic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1094482683 12:30897300-30897322 GGGTGCAGATGGGGGGCCAGAGG - Intergenic
1095393711 12:41739947-41739969 GGGGGCAGACAGAGAGAGAGGGG - Intergenic
1095421863 12:42032346-42032368 GGGTGGAGAGAGAGAGAGAGAGG - Intergenic
1095425886 12:42074376-42074398 GGGTGCAGACTCAGGAACATTGG + Intergenic
1096085866 12:48864811-48864833 GTTTGGAGACAGAGGAACAGAGG - Exonic
1096460618 12:51819934-51819956 GGATGGAGACAGAAGCACAGAGG + Intergenic
1096513183 12:52143175-52143197 GAGGCCAGACAGGGGGACAGTGG + Intergenic
1096777890 12:53974861-53974883 GGGAGCAGACAGGGGGCCCGAGG + Intronic
1096984376 12:55746223-55746245 GGGTACAGACTGAGGAACAAAGG - Intronic
1097288007 12:57892499-57892521 AGGTGCAGATAGAGGGTGAGAGG + Intergenic
1098222737 12:68287114-68287136 GAGTGCACACAAAGGAACAGTGG + Intronic
1100215023 12:92438788-92438810 GGATGAAGGCAGAGGGAGAGGGG - Intergenic
1100568227 12:95819398-95819420 TGGTGGATAGAGAGGGACAGAGG - Intronic
1100814771 12:98375629-98375651 GGGTGGGGACAAAGAGACAGTGG + Intergenic
1101557538 12:105824388-105824410 GGGAGAAGGCAGAGGGGCAGTGG + Intergenic
1102226997 12:111235841-111235863 AGGTGGAGACAGAGGGTCTGGGG + Intronic
1102257217 12:111423132-111423154 GGGAGCAGAGAGAGGGAGATGGG + Intronic
1102348194 12:112172866-112172888 GGGTGGGGACAGGGGGAGAGGGG + Intronic
1103013759 12:117478066-117478088 GGGAGCAGTCAGCGGGAGAGGGG + Intronic
1103052530 12:117792648-117792670 TGATTCAGACACAGGGACAGAGG - Intronic
1103166664 12:118775748-118775770 GTGTGCAGACAGAAGCAGAGAGG - Intergenic
1103811184 12:123615167-123615189 AGGTGCTGCAAGAGGGACAGAGG - Exonic
1103867618 12:124065177-124065199 GGGTGCACTTAGAAGGACAGTGG + Intronic
1104938242 12:132378530-132378552 GGGGGGAGAGAGAGGGAGAGAGG + Intergenic
1106394457 13:29366934-29366956 GGATGCAGACACAGGGAGGGAGG - Intronic
1107301626 13:38971999-38972021 GGGGGCAGGCATAAGGACAGAGG - Intronic
1108279126 13:48843377-48843399 AGGGGCAGACAGAGCTACAGGGG - Intergenic
1108591593 13:51917360-51917382 GGGTGCTCACAGAAGGAAAGAGG + Intergenic
1109589806 13:64463182-64463204 GGGAGCAGACAGATGGACAGGGG - Intergenic
1112314749 13:98351111-98351133 GGCTGGAGGCAGAGGGAGAGGGG - Intronic
1113001858 13:105648443-105648465 AGGTGCAGACAAAGAAACAGTGG + Intergenic
1113481698 13:110626230-110626252 GGGTGCAGTCAGATGGTGAGAGG + Intronic
1113572974 13:111371827-111371849 GGGAGGAGACAGAAGCACAGAGG + Intergenic
1113670880 13:112175314-112175336 ACGTGAAGACAGAGGTACAGAGG + Intergenic
1113670890 13:112175410-112175432 ACGTGAAGACAGAGGTACAGAGG + Intergenic
1113889887 13:113730275-113730297 GGGTGCAGCCGCAGGGACTGGGG - Intronic
1113929157 13:113957339-113957361 GGGTGCATGCAGAGGTGCAGGGG - Intergenic
1114227391 14:20751760-20751782 GGGTGCAGTCATGGGGACAGGGG - Intergenic
1114426558 14:22628853-22628875 GGGTTCAGATACAGGGAAAGGGG - Intergenic
1115333038 14:32218888-32218910 GAGTGAAGAAAGAGGGAAAGAGG - Intergenic
1118599859 14:67464422-67464444 GGGTGGGGGCAGGGGGACAGAGG - Intronic
1118693689 14:68363819-68363841 GGGAGCACACAGAAGCACAGTGG - Intronic
1118760258 14:68876686-68876708 GGGAGCAGGAAGAGGGACTGTGG - Intronic
1119484524 14:74979084-74979106 GGGTGGTGAGAGAGGGACAGAGG - Intergenic
1121050568 14:90816651-90816673 GGGTGAAGACCGAGGGGAAGTGG + Intergenic
1121104410 14:91271137-91271159 GGGTGCAGAGGGAGGGGCACAGG + Intergenic
1121231921 14:92364646-92364668 TGCAGCAGGCAGAGGGACAGAGG - Intronic
1121582008 14:95038700-95038722 GGGTGCACACAGAGTGAGTGGGG + Intergenic
1121681781 14:95799478-95799500 GGGTGAAGAAATAGAGACAGTGG + Intergenic
1121928715 14:97952533-97952555 GGGTGGAGAGGGAGGGAAAGGGG - Intronic
1122463654 14:101916395-101916417 GGGTGAATAAGGAGGGACAGAGG + Intronic
1122480076 14:102041556-102041578 GGGTGCTGAAACAGGTACAGAGG - Exonic
1122736997 14:103848510-103848532 GAGAGCAGACAGGGGGACTGAGG + Intergenic
1122828499 14:104383794-104383816 GGCTGCCGACAGAGAGACAAGGG - Intergenic
1123969498 15:25493794-25493816 GGGTGGAGGCAGAGGCAGAGAGG - Intergenic
1124492825 15:30168564-30168586 CTGGGCAGACAGAAGGACAGTGG - Intergenic
1124672105 15:31649741-31649763 GGCTGCACCCAGTGGGACAGAGG - Intronic
1124682064 15:31740316-31740338 GGTTTCACACAGAGGGAAAGCGG - Intronic
1124750709 15:32369761-32369783 CTGGGCAGACAGAAGGACAGTGG + Intergenic
1125035634 15:35121198-35121220 AGCTGCAGACCGAGGAACAGAGG - Intergenic
1126654122 15:50957248-50957270 GGGAGCTGACAGGGGGACTGGGG + Intronic
1127038875 15:54951245-54951267 GGGGGCAGACCCAGGGCCAGTGG + Intergenic
1127130004 15:55852614-55852636 GAGAGTAGACATAGGGACAGAGG - Intronic
1127372878 15:58356896-58356918 GGGTGCAGCCTGAGGGAGAGAGG - Intronic
1127429347 15:58887006-58887028 GGGAGCAGAGAGGGAGACAGAGG - Exonic
1128050119 15:64656752-64656774 GGGAGGAGAAAGAGGGAGAGAGG - Intronic
1128239769 15:66093983-66094005 GGGTGCCCACAGAGGCTCAGAGG - Intronic
1128751986 15:70156383-70156405 GCGGGCAGACAGACAGACAGAGG - Intergenic
1128785685 15:70395236-70395258 GGGAACAGACAGAAGGACACAGG + Intergenic
1128818252 15:70629885-70629907 GGGTGCTGACAGAGGCAGGGAGG - Intergenic
1128827683 15:70735193-70735215 GAGGGCAGACAGAGGGATGGGGG + Intronic
1129034520 15:72641355-72641377 GGGAGGAGGCAGAGGGACAGAGG + Intergenic
1129139558 15:73584924-73584946 GGAACCAGACAGAGGGACAGTGG - Intronic
1129215362 15:74095861-74095883 GGGAGGAGGCAGAGGGACAGAGG - Intergenic
1129294659 15:74593310-74593332 GTGTTCAGACAGAGGGTAAGAGG - Intronic
1129325858 15:74800019-74800041 GAGTGAATACAGAGGGACACGGG - Intronic
1129360255 15:75019951-75019973 GGGAGGAGGCAGAGGGACATAGG - Exonic
1129388155 15:75207085-75207107 GGGTGCTGGGAGAGGGGCAGAGG - Exonic
1129392264 15:75226346-75226368 GGGAGGAGGCAGATGGACAGAGG + Intergenic
1129472130 15:75761819-75761841 GGGAGGAGGCAGATGGACAGAGG - Intergenic
1129598521 15:76983287-76983309 GGGTGTGGACAGAGGGAGCGTGG + Intergenic
1129716736 15:77856637-77856659 GGGAGAAGGGAGAGGGACAGAGG + Intergenic
1129732505 15:77940190-77940212 GGGAGGAGGCAGAGGAACAGAGG - Intergenic
1129739345 15:77982557-77982579 GGGGGTAGACGGAGGGGCAGAGG - Intergenic
1129757171 15:78105481-78105503 GGGGGAAGACGGAGGAACAGCGG + Intronic
1129846612 15:78770694-78770716 GGGAGGAGACAGAGGGCCAGAGG + Intronic
1129846623 15:78770735-78770757 GGGAGGAGACAGAGAGAGAGGGG + Intronic
1130255299 15:82323259-82323281 GGGAGGAGACGGAGGGGCAGAGG - Intergenic
1130599674 15:85266747-85266769 GGGAGGAGACCGAGGGGCAGAGG + Intergenic
1131908690 15:97172258-97172280 GGGTGGCCACAGAGGGAAAGAGG - Intergenic
1132139803 15:99383113-99383135 TGATGGGGACAGAGGGACAGGGG - Intronic
1132397271 15:101483048-101483070 GGGTGTGAACTGAGGGACAGAGG - Intronic
1132601364 16:774562-774584 GGGTGTCCACAGAGGGGCAGGGG - Intronic
1132849672 16:2019413-2019435 AGGTGCAGGCAGAGCTACAGTGG - Intronic
1133327216 16:4949098-4949120 GGATGCAGACAGAGGAACCTGGG - Intronic
1134681790 16:16131558-16131580 GGGAGGGGACAGAGGGACACAGG + Intronic
1135537138 16:23302896-23302918 AGGTGCAAACTGAGGGTCAGAGG + Intronic
1135932231 16:26747800-26747822 GGGGACAGAAAGAGGGAGAGAGG - Intergenic
1136398946 16:30007454-30007476 GGCTGCAGAGGGAGGGACAGAGG - Intronic
1136617950 16:31410241-31410263 GGGGACAGGCAGAGGCACAGAGG + Intronic
1137492703 16:48946088-48946110 GGGGGCAGATAGAGGACCAGAGG + Intergenic
1137676780 16:50307593-50307615 GGGTGAAGTCAGAGGGAAGGGGG + Intronic
1138129461 16:54467226-54467248 GGCTGCTGTCTGAGGGACAGAGG + Intergenic
1138658972 16:58506857-58506879 AGGGGCAGACAGAGGGACGCAGG - Intronic
1138907924 16:61360483-61360505 GGGTTCAAACTGAGGGAGAGGGG + Intergenic
1139447906 16:67009515-67009537 GGGTGCAGTGACAGGGGCAGTGG - Exonic
1140097230 16:71884774-71884796 GGCTGCAGACCCAGGGGCAGGGG + Intronic
1140973700 16:80038813-80038835 GGCTGCATAAACAGGGACAGGGG + Intergenic
1141140170 16:81492401-81492423 GGCCACGGACAGAGGGACAGAGG - Intronic
1141703956 16:85654686-85654708 GGGTGCCGACTGAGCGCCAGGGG + Intronic
1141720556 16:85752976-85752998 GGGTGCAGAAGGAGTGACACTGG + Intergenic
1142026760 16:87818546-87818568 GAGTGCAGACAAGGGGAAAGCGG + Intergenic
1142058488 16:88015250-88015272 GGGCATGGACAGAGGGACAGAGG - Intronic
1142197713 16:88746402-88746424 GGCTGCAGGCAGAGCCACAGGGG - Intronic
1142298727 16:89243845-89243867 GTCTGCTGACAGAGGGGCAGCGG + Intergenic
1142405252 16:89884962-89884984 GGCGTCAGACAGAGGGAGAGGGG - Intronic
1142455159 16:90216530-90216552 TGGCAGAGACAGAGGGACAGAGG + Intergenic
1142455179 16:90216648-90216670 TGGCAGAGACAGAGGGACAGAGG + Intergenic
1142455199 16:90216766-90216788 TGGCAGAGACAGAGGGACAGAGG + Intergenic
1142455219 16:90216884-90216906 TGGTAGAGACAGAGGGACTGAGG + Intergenic
1142809599 17:2389139-2389161 TGTGGCAGACAGAAGGACAGTGG - Intronic
1142983377 17:3684107-3684129 GGGAGGAGACACAGGGACTGAGG - Intronic
1143111184 17:4553919-4553941 TGGTCCCCACAGAGGGACAGAGG + Intronic
1143247884 17:5501052-5501074 GGGCGGAGCCAGAGGGGCAGGGG + Intronic
1143389582 17:6552360-6552382 GGGTGCAGAGGGAGGGGCACAGG + Intronic
1143465348 17:7132765-7132787 CAGTGGAGACGGAGGGACAGTGG - Intergenic
1144022824 17:11252139-11252161 GGGTCTGGAGAGAGGGACAGGGG - Intronic
1144960495 17:19041714-19041736 GGCCCCAGACAGATGGACAGAGG + Intronic
1144974665 17:19132810-19132832 GGCCCCAGACAGATGGACAGAGG - Intronic
1145805104 17:27721120-27721142 GAGTGCTGACACAGGGATAGCGG - Intergenic
1146725405 17:35151715-35151737 GGGTGCAGACTCAAGGACTGAGG + Intronic
1146954956 17:36932070-36932092 GTGTTCAGACAGAGGAACACGGG + Intergenic
1146997614 17:37334709-37334731 GGGTGCAGTGAGAGTGAAAGGGG - Intronic
1147187889 17:38722502-38722524 GGGTGCAGCAAGAGGGATACAGG - Intronic
1148085844 17:44993422-44993444 GGGTCCAGGCAGAGGGAAGGGGG - Intergenic
1148636930 17:49156166-49156188 GGGGCCAGGGAGAGGGACAGTGG - Intronic
1148816297 17:50330374-50330396 GGCTGCAGACGGAGGGGCTGAGG - Intergenic
1149905891 17:60526085-60526107 GGGGGCAAACTGAGGGACGGCGG + Exonic
1150002863 17:61452301-61452323 GGGCGCAGACTGATTGACAGCGG + Intergenic
1150123399 17:62621391-62621413 GGGAGCTCAGAGAGGGACAGAGG - Intergenic
1150353112 17:64460978-64461000 GGATACAGACAGCAGGACAGAGG + Intronic
1151364934 17:73611220-73611242 GGGGGCAGAGAGAGAGAGAGTGG - Intronic
1151697280 17:75724073-75724095 TGGGGCAGGCAGAGGTACAGGGG + Intronic
1151890796 17:76949403-76949425 GGATGTGGACAGAGGGGCAGGGG + Exonic
1152008615 17:77697274-77697296 TGCTGCAGACGGGGGGACAGTGG + Intergenic
1152248746 17:79200509-79200531 AGGTGCCGCCGGAGGGACAGCGG + Intronic
1152426792 17:80222437-80222459 GGGTGCAGACAGCCAGGCAGAGG - Intronic
1152650791 17:81491726-81491748 GGGAACAGAAAGAGGGAGAGAGG - Intergenic
1152950889 17:83230285-83230307 TGGCAGAGACAGAGGGACAGAGG + Intergenic
1153228822 18:2918158-2918180 GCTAGCAGACACAGGGACAGAGG + Exonic
1153272265 18:3334256-3334278 AGGGGCAGACAGAGGGATGGAGG - Intergenic
1153634744 18:7103936-7103958 GAGACCAGACAGACGGACAGAGG - Intronic
1154449170 18:14460473-14460495 GGGTGCAGGCAAAGGAAGAGCGG + Intergenic
1156497319 18:37534393-37534415 CGGTGGGGACCGAGGGACAGCGG - Intronic
1157308774 18:46536397-46536419 AAGTGCAGAGAGAGGGACACAGG + Intronic
1157390164 18:47295157-47295179 GTGTGCAGAAAGAGGGAGATGGG - Intergenic
1157583839 18:48788629-48788651 GGGAACAGCCAGAGGCACAGTGG + Intronic
1157844674 18:50992217-50992239 GGGTGGGGACAGATGGTCAGGGG + Intronic
1157942269 18:51942307-51942329 GGCTGCAGACGGAGGGATATTGG + Intergenic
1159045546 18:63366555-63366577 GGGGGCAGACAGCGGGGAAGTGG - Intronic
1159127738 18:64244768-64244790 GAGTGTAGAGAGAGGGACACAGG + Intergenic
1159384321 18:67703790-67703812 GGGTGGTGACAGAGGGAGTGGGG - Intergenic
1160251257 18:77205157-77205179 GGGGAGAGACAGAGGGAGAGAGG - Intergenic
1161021948 19:2014942-2014964 AGGTGCAGAGGCAGGGACAGAGG + Intronic
1161029442 19:2050956-2050978 GGGAGCAGACAAAGGGAGGGCGG + Intronic
1161303947 19:3556840-3556862 GGGCACAGACAGACAGACAGGGG + Intronic
1162345176 19:10114544-10114566 GGGTGGACACAGAAGGCCAGGGG - Exonic
1162743600 19:12786829-12786851 GGGCACAGACAGAGGGGCACGGG - Intronic
1162793789 19:13076405-13076427 GGGTGCAGACAGACCTAGAGAGG + Intronic
1163365229 19:16872371-16872393 GGGTGGGGACACAGGGGCAGGGG - Intronic
1163820916 19:19496128-19496150 GTGTGCAGATTCAGGGACAGAGG + Exonic
1164433713 19:28209915-28209937 GTGGGGAGACAGAGAGACAGAGG - Intergenic
1164466144 19:28489217-28489239 AGGAGCAGACACAGAGACAGGGG + Intergenic
1164535623 19:29084713-29084735 GGGTGCAGAAGGAGGGGCTGGGG + Intergenic
1164768986 19:30793400-30793422 GGGTGCAGCCAGCAGGGCAGAGG - Intergenic
1165006100 19:32808461-32808483 AGGTGGAGAGAGAGTGACAGTGG - Intronic
1165226659 19:34359730-34359752 GAGTGAAGGCAGAGGGACTGGGG - Intronic
1165455281 19:35907286-35907308 GGGTGCAGAGACAGGCAGAGTGG + Intronic
1165843804 19:38805433-38805455 GGGCACAGGCAGAGGGGCAGGGG - Intronic
1165945257 19:39437897-39437919 GGGTGGAGACAGGGAGACACTGG + Intronic
1166106276 19:40599636-40599658 GGGGGGAGAGAGAGGGAGAGGGG - Intronic
1166125770 19:40714694-40714716 GGGTGGACACAGAGGAACATGGG - Intronic
1166137380 19:40785948-40785970 GGGGGCAGGCAGAGGGATCGGGG + Intronic
1166381437 19:42357240-42357262 GGGTCCTGGCAGAGGCACAGTGG - Intronic
1166749524 19:45158382-45158404 GGGTGTCGGCAGAGGGAAAGGGG + Intronic
1166880910 19:45929439-45929461 AGAGGGAGACAGAGGGACAGGGG + Intergenic
1167152506 19:47718484-47718506 GGGGGCAGAGGGAGGGTCAGGGG - Intronic
1167211259 19:48135600-48135622 GGGTGGAGCCAGAGGAGCAGTGG - Intronic
1167278206 19:48551667-48551689 GGAAACAGACACAGGGACAGAGG - Intergenic
1167576629 19:50320797-50320819 GGGGTCAGACAGAGAGACAAAGG + Intronic
1167636750 19:50659915-50659937 GGGTGGTGAGAGAGGGGCAGAGG - Intronic
1167687912 19:50968159-50968181 GGGAGCAGACAGAGGGATGGGGG - Intronic
925072071 2:977490-977512 GGGTGGAGGCAGCGGGTCAGGGG - Intronic
925146773 2:1587561-1587583 GGGCGGGGACAGAGGGACAGAGG - Intergenic
925146829 2:1587749-1587771 GGGCGGGGACAGAGGGACAGAGG - Intergenic
925153940 2:1636036-1636058 GGGGGCAGACAGGGTGACAGTGG + Intronic
925237963 2:2295819-2295841 GGATGTAGACAGAGAGAGAGGGG + Intronic
925932762 2:8723306-8723328 GGGTGCAGAAGGCGGGGCAGAGG + Intergenic
927075445 2:19572301-19572323 GGGTAGAGAGCGAGGGACAGAGG - Intergenic
928468039 2:31541718-31541740 GGCTGCTGCCAGAGGGATAGGGG - Intronic
929007812 2:37412483-37412505 GGGTGCAGAGGCAGGGACAGGGG - Intergenic
929616807 2:43316423-43316445 TGGATCAGTCAGAGGGACAGGGG + Intronic
929776564 2:44934208-44934230 GGGGGAAGACAGAGCGAGAGGGG + Intergenic
929811133 2:45190270-45190292 GGAAGCAGACATAGGGACTGAGG - Intergenic
929938876 2:46315342-46315364 GGGTGCATACTGTGGGACGGAGG + Intronic
931553217 2:63470164-63470186 GGGTGTAGACAGAGAAACAGAGG - Intronic
932084757 2:68748099-68748121 GGGTGGAGACAGAGGGGAAGGGG - Intronic
932125736 2:69144196-69144218 TGGTGCTCACAGAGGGACAGCGG + Intronic
932220535 2:69995681-69995703 GGGAGCAGGAAGAGGGACACAGG + Intergenic
932430518 2:71671404-71671426 TGCTGCAGACAGAGGGAGAGGGG + Intronic
932699122 2:73981503-73981525 TAGAGCAGACAGAGGGAGAGAGG - Intergenic
933132662 2:78691833-78691855 GTGTGAAGACAGAGAGAGAGAGG - Intergenic
933731338 2:85458509-85458531 GGCTGCAGGCAGAAGGGCAGTGG + Intergenic
934514471 2:94977577-94977599 GAGAGCTGACAGGGGGACAGAGG - Intergenic
934647822 2:96069384-96069406 GGGTGGGGGCAGAGGGGCAGGGG - Intergenic
935595391 2:104873699-104873721 GAGTGCAGAGAGTGGGAGAGAGG - Intergenic
935692165 2:105741920-105741942 GTGTGAAGACAGAGAGGCAGAGG + Intergenic
936738610 2:115476292-115476314 GGCTGCAGAATGAGGGAAAGTGG - Intronic
937380082 2:121368498-121368520 GGGCCCAGTCAGAGGGCCAGCGG - Intronic
937955498 2:127419862-127419884 GGGTGCAGGCAGAGCAGCAGCGG + Intronic
938980494 2:136521702-136521724 GGGTGCAGACAGTCGGCCTGAGG - Intergenic
939879562 2:147614500-147614522 TGGTGGAGACACAGGGGCAGAGG - Intergenic
941288723 2:163648146-163648168 GGGTGCAGGCAGTGGGGCTGGGG - Intronic
941833470 2:169989356-169989378 GGGTAAAGATAGAGGGAGAGTGG - Intronic
942240859 2:173963899-173963921 GGGTTCAGAGAGGGAGACAGGGG + Intronic
943266481 2:185738814-185738836 AGGTCCGGACAGAGGGACAACGG + Exonic
943751906 2:191517965-191517987 GGGTGAAGTCAGAGGCTCAGTGG + Intergenic
943801651 2:192067276-192067298 GGGTTTAGACAGAGGGGTAGTGG + Intronic
944183763 2:196926188-196926210 GGGAGGAGGCGGAGGGACAGCGG + Intronic
944889617 2:204103840-204103862 TGGTGGAGACAGAGCGACTGAGG - Intergenic
944990331 2:205228697-205228719 GGAGGCAGAGAGAGAGACAGGGG - Intronic
945039791 2:205733998-205734020 AGGAGGAGACAGAGGCACAGGGG - Intronic
945942993 2:215968427-215968449 GGGGCCAGGCAGAGGGAGAGAGG - Intronic
946024740 2:216665028-216665050 GTGTGCAGGCTGAGGGACTGTGG + Intergenic
947109714 2:226705983-226706005 AGATGCAGACAGAGACACAGGGG + Intergenic
947590845 2:231384261-231384283 GGGTGAGGGCAGAGGGGCAGGGG - Intergenic
947724291 2:232387741-232387763 GTGTGCAGGGAGGGGGACAGGGG - Intergenic
947743202 2:232494362-232494384 GGGAGGAGACAGAGGGTCTGGGG + Intergenic
948118221 2:235509678-235509700 GGGTGCAAGCAGACGGACAGAGG - Intronic
948370028 2:237483045-237483067 GGGTTTAGACAGAGAGACTGAGG + Intergenic
948533175 2:238626502-238626524 GGGTGGCAAGAGAGGGACAGAGG - Intergenic
948566004 2:238886667-238886689 GGGTGGAGACAGAGGGCAGGTGG + Intronic
948625701 2:239266669-239266691 ATGTGGAGACAGAGGGAGAGAGG - Intronic
948854149 2:240722286-240722308 GGGTGCAGTCAGTGGGCAAGGGG + Intronic
949004791 2:241639238-241639260 GCGTCCAGACAAAGGGACAGTGG + Intronic
949086629 2:242161197-242161219 TGGCAGAGACAGAGGGACAGAGG + Intergenic
949086639 2:242161256-242161278 TGGCAGAGACAGAGGGACAGAGG + Intergenic
949086660 2:242161374-242161396 TGGCAGAGACAGAGGGACAGAGG + Intergenic
949086680 2:242161492-242161514 TGGCAGAGACAGAGGGACAGAGG + Intergenic
1168771138 20:417704-417726 GGGGGCAAAGAGAGGGAGAGTGG - Intronic
1168955679 20:1832696-1832718 GAGCCCTGACAGAGGGACAGGGG + Intergenic
1168962077 20:1876802-1876824 TGGAGCAGACGGAGGGAGAGGGG - Intergenic
1169143122 20:3237214-3237236 GGGTGAGGACAGAGGGACAGGGG + Intronic
1170421967 20:16201875-16201897 CGGTGCACACAGTAGGACAGGGG - Intergenic
1170545978 20:17436233-17436255 GGGGACAGAGAGAGGGGCAGGGG - Intronic
1172323439 20:34015973-34015995 GGTAGAAGACAGTGGGACAGGGG - Intronic
1172759361 20:37311225-37311247 GGGTGCAGGTAGAGATACAGAGG + Intronic
1172839896 20:37896520-37896542 TTGTGCAGACAGAGGAACTGAGG - Intergenic
1173484540 20:43430771-43430793 GGGTGAAGACAAGGAGACAGAGG + Intergenic
1173530963 20:43769268-43769290 AGGTGCACACAGATGGCCAGAGG - Intergenic
1173594176 20:44247990-44248012 GCCCGCAGACAGAGGGGCAGAGG - Intronic
1173765166 20:45600693-45600715 GGGTAGAGAGAGAGGGAGAGGGG - Intergenic
1174013853 20:47472257-47472279 GAGTGCAGTCTGTGGGACAGAGG - Intergenic
1174295031 20:49539727-49539749 GGCGGCAGACAGAGGGTCAGGGG + Intronic
1174454244 20:50638381-50638403 GGCTGCAGACTGATAGACAGAGG - Intronic
1174472594 20:50771664-50771686 GGCTGCAGACTGATAGACAGAGG + Intergenic
1174554056 20:51381501-51381523 GGGTGCAGAGGGAGGGAGAAAGG - Intergenic
1174932753 20:54833436-54833458 GGGGGGAGACAGAGAGAGAGAGG - Intergenic
1175818013 20:61893600-61893622 TGGGGCAGATAGAGGGATAGTGG + Intronic
1176157212 20:63627732-63627754 GGGTGCCGGCCGTGGGACAGCGG - Intergenic
1176157246 20:63627829-63627851 GGGTGCCGGCTGTGGGACAGCGG - Intergenic
1176157325 20:63628083-63628105 GGGTGCCGACTGTGGGACATGGG - Intergenic
1176172861 20:63703974-63703996 TGGAGCAGTCAGAGGGACTGTGG + Intronic
1176346059 21:5748843-5748865 GGCTGCATACTAAGGGACAGTGG - Intergenic
1176352873 21:5869427-5869449 GGCTGCATACTAAGGGACAGTGG - Intergenic
1176498768 21:7575612-7575634 GGCTGCATACTAAGGGACAGTGG + Intergenic
1176540380 21:8146913-8146935 GGCTGCATACTAAGGGACAGTGG - Intergenic
1176559331 21:8329958-8329980 GGCTGCATACTAAGGGACAGTGG - Intergenic
1176719077 21:10378902-10378924 GGGGGGAGAGAGAGAGACAGAGG - Intergenic
1178114575 21:29404374-29404396 GGGAGCACACAGAGGGGCAGAGG + Intronic
1178696611 21:34798139-34798161 GGGGGCAGGCACAGGGGCAGTGG - Intronic
1178927076 21:36785156-36785178 GGGAGCCGAGAGAGGGAAAGAGG - Intronic
1178974360 21:37208853-37208875 GAGTGCAGCCTGAGGGACGGGGG + Intergenic
1179253819 21:39697908-39697930 ACTTGCAGACAGAGGGACTGAGG - Intergenic
1180149542 21:45940675-45940697 GGGTGCAGTCACAGGGACCCAGG - Intronic
1180198029 21:46208953-46208975 GGTTCCAGGCAGAGGGACACTGG + Intronic
1180569559 22:16702476-16702498 GGAGGCAGGCAGAGGGACAGAGG - Intergenic
1180798133 22:18617707-18617729 GGTTGTAGAGAGAGGGAAAGTGG - Intergenic
1180945241 22:19688942-19688964 GGCTGCAGGCACAGAGACAGGGG - Intergenic
1180965060 22:19783880-19783902 GGAAGCTGACAGAGTGACAGAGG + Exonic
1181147306 22:20858373-20858395 TGGTGAAGAGAGAGGGACCGTGG - Intronic
1181223585 22:21377559-21377581 GGTTGTAGAGAGAGGGAAAGTGG + Intergenic
1181255157 22:21558063-21558085 GGTTGTAGAGAGAGGGAAAGTGG - Intronic
1181622935 22:24103256-24103278 AGGTGCAGGCAGGGGGGCAGTGG - Intronic
1181692413 22:24571410-24571432 GGATGGAGACGGAGGGGCAGGGG - Intronic
1182122658 22:27797692-27797714 GGTCGCAGAAAAAGGGACAGTGG - Exonic
1182415868 22:30221166-30221188 GCCTGGAGACAGAGGGACCGAGG + Intergenic
1182714013 22:32340742-32340764 AGATGAGGACAGAGGGACAGTGG + Intergenic
1183544776 22:38449604-38449626 GGGTGCAGAGGGAGGGGCAGGGG + Intronic
1183741960 22:39673788-39673810 GGGTGCAGCCACAGGGTGAGTGG - Intronic
1183953823 22:41367654-41367676 GGGGGCAGCCACAGGCACAGTGG + Intronic
1183956319 22:41382361-41382383 GGCTGAGGACAGAGGGTCAGGGG + Intronic
1184177367 22:42795883-42795905 GGGGGGAGACTGAGGGGCAGGGG + Intergenic
1184265832 22:43345344-43345366 GTGTGCAGGCAGAGAGAAAGTGG + Intergenic
1184280101 22:43432570-43432592 GGGAGGAGAGAGAGGGAAAGAGG + Intronic
1184401332 22:44276328-44276350 AGATGAGGACAGAGGGACAGTGG + Intronic
1185344384 22:50304974-50304996 GGCTGCAGCCAGAGGGACGGAGG + Intronic
1185400346 22:50612356-50612378 GGGCTCAGACAGAGGGACCCCGG - Intronic
1185418399 22:50721870-50721892 GGCTGCAGACTCAGGGGCAGGGG - Intergenic
1203245325 22_KI270733v1_random:63339-63361 GGCTGCATACTAAGGGACAGTGG - Intergenic
949169257 3:979115-979137 GGATGCAGAGAGATGCACAGAGG + Intergenic
949525574 3:4900172-4900194 GAGTGTATACAGAGGGAGAGAGG - Intergenic
949947412 3:9201507-9201529 GGGAGCAGGCAGAGGCACACAGG - Intronic
950075044 3:10181092-10181114 GGGTGGAGACAGAAGTCCAGGGG - Intronic
950147703 3:10663699-10663721 GAGTGCAGACAGCGGCATAGAGG + Intronic
950467555 3:13164065-13164087 GGATTCAGACACACGGACAGAGG + Intergenic
950524982 3:13518300-13518322 GGAGGAAGACAGAGGCACAGAGG - Intergenic
951716110 3:25648316-25648338 GGGAGCAGACAGATGGACAGAGG + Intronic
951838215 3:27005075-27005097 GGGTGCAGTGAGAGTGAAAGGGG - Intergenic
953060885 3:39428051-39428073 GGGTCAAGACAGAGAGACAGAGG + Intergenic
953357774 3:42268838-42268860 GGGTTCATACAGAGAGACTGGGG - Intergenic
953373228 3:42407298-42407320 GGGTGGAGTCACAGGGACACTGG + Exonic
953799506 3:46011525-46011547 GTGTCCTGGCAGAGGGACAGTGG + Intergenic
953910381 3:46889801-46889823 GGGTGAGGACTGAGGGACTGGGG - Intronic
953982914 3:47421632-47421654 GAGTGCAGATAGTGGCACAGTGG + Intronic
954152642 3:48665241-48665263 GAGTGCAGATTGAGGGAGAGGGG - Intergenic
954699027 3:52442082-52442104 GGGTAGGGACAGAGGGGCAGGGG - Intronic
954845645 3:53553335-53553357 GGAGGCAGACAGACGGGCAGCGG - Intronic
955070714 3:55570496-55570518 GAGTGCAGAGGGAGGGCCAGGGG + Intronic
955488066 3:59454769-59454791 ATGTGCATACAGAGGGGCAGGGG - Intergenic
955614477 3:60792034-60792056 GGTTTCAGACAAAGGCACAGTGG + Intronic
956311698 3:67888054-67888076 GGATGAAGAAAGAAGGACAGAGG + Intergenic
956709024 3:72024042-72024064 GGGTGCAGAAATAAGGACTGGGG - Intergenic
958906831 3:99951037-99951059 AGGTGCAGAAAGAGTGACAAAGG - Intronic
959619735 3:108386899-108386921 GGGTGGAGAGTGAGGGGCAGAGG + Intronic
959651639 3:108756437-108756459 AGGTGCAGGGAGATGGACAGGGG + Intronic
961244905 3:125442417-125442439 GGGTGAAAACAGGGGGACTGAGG + Intergenic
961376036 3:126466579-126466601 GGGTGAAGAAACAGGCACAGAGG - Intronic
961382923 3:126507818-126507840 GGGGGCAGACAGAGGGGCTGAGG + Intronic
961447273 3:126986759-126986781 GAGTGGAGACAGGGGCACAGAGG + Intergenic
961662241 3:128475543-128475565 GGGTGCAAACAGAGGGAAGAAGG + Intergenic
962403884 3:135083821-135083843 GGATGGAGTGAGAGGGACAGAGG - Intronic
962647358 3:137453702-137453724 GGGTGAAGTCAGAAGGACAAAGG - Intergenic
964579804 3:158220353-158220375 GAGTACAGACAGATGGACTGAGG - Intronic
966213317 3:177475479-177475501 GGGAGCAGGCAGAGGAACAGAGG + Intergenic
966427739 3:179798427-179798449 AGGAGGAGACAGAGGGATAGGGG - Exonic
966740378 3:183227322-183227344 GGGTGGAGAAACAGGGAAAGAGG + Intronic
968447401 4:658610-658632 CCGTGCAGACAGAGGGACCTCGG - Intronic
968478184 4:822308-822330 GGGAGCAGAGGGAGAGACAGAGG - Intronic
968505068 4:967743-967765 GGGTCCAGGCAGAGAGACACAGG - Exonic
968794997 4:2697520-2697542 GGGTTCTGACAGTAGGACAGTGG + Intronic
969235859 4:5864752-5864774 AGGGGAAGGCAGAGGGACAGGGG + Intronic
969352260 4:6604528-6604550 GGGTGGAGAAAGCCGGACAGCGG + Intronic
969511087 4:7618370-7618392 GAGGGCAGACAGAGGGGCTGGGG - Intronic
969525062 4:7700116-7700138 GGCTGGAGACAGAGGGGCAAAGG - Intronic
969607881 4:8211424-8211446 GGGTGGAGAGGGAGGGAGAGGGG - Intronic
969724219 4:8909802-8909824 GGGGGCAGACAGAGGCACACAGG + Intergenic
970610337 4:17719546-17719568 AGGTGCAGAGAAAGGCACAGGGG + Intronic
970993804 4:22242420-22242442 GAGGGCAGACAGAGGGAGTGGGG - Intergenic
971527545 4:27639860-27639882 CTGTGGATACAGAGGGACAGAGG - Intergenic
972103707 4:35455560-35455582 GGGTGGAGAGAGAGGGGCATAGG - Intergenic
974005469 4:56552088-56552110 GGGAGCAGAGTGAGGCACAGAGG + Intronic
974906012 4:68058075-68058097 GGGTGGAGAGTGAGGGAAAGGGG + Intronic
976436067 4:85019566-85019588 GTGGCCAGATAGAGGGACAGGGG - Intergenic
977010125 4:91625146-91625168 GGGTGCAGAGAGAGGGGGTGCGG - Intergenic
978173586 4:105703591-105703613 GGGTGCAGGCAGAGAGAGAATGG - Intronic
978331535 4:107618516-107618538 GGATGAAGACACAGGGAGAGGGG + Intronic
978339781 4:107710055-107710077 GGGTGCAGAAGGAAGGAAAGGGG - Intronic
981052282 4:140320954-140320976 GGTGGCAGAGAGAGGGAGAGGGG - Intronic
984121824 4:175754942-175754964 GGGAGTAGACAGAGGGAGAGAGG - Intronic
984901492 4:184590587-184590609 GTGTGCAGCCAGAGGAACACGGG - Intergenic
985286784 4:188344359-188344381 GGGTCCAGCCAGAGAGACACTGG - Intergenic
985409713 4:189670368-189670390 TGTTGCAGACAGAGGCCCAGAGG - Intergenic
985897845 5:2759865-2759887 GGCTGCAGGCAGAGAGACAAGGG - Intergenic
986565724 5:9111826-9111848 GGGGGCAGGGAGAGGGTCAGAGG - Intronic
986713510 5:10505153-10505175 GTGTGAAGACAGAGGGGCCGAGG - Exonic
986733701 5:10653122-10653144 GAGTCCAGAGAGAGGGACTGGGG - Intergenic
988514892 5:31895760-31895782 GGGAGCAGACAGAGGGAGGAAGG - Intronic
988642679 5:33058665-33058687 GGGAGCAGACAGTGGGAATGGGG + Intergenic
988852965 5:35197376-35197398 GGGAGCAGCCAGAAGGAAAGGGG - Intronic
988949218 5:36241266-36241288 AGGGGGAGAGAGAGGGACAGTGG - Intronic
990699334 5:58459396-58459418 GGGAGCAGATAGAGGGAGAGAGG + Intronic
991449147 5:66733216-66733238 GGGAGGAGACAGGGAGACAGAGG - Intronic
995125856 5:108576503-108576525 GGGTGCAGTGAGAGTGAAAGGGG + Intergenic
995782394 5:115791975-115791997 GGGTGAAGACAGGGTGAAAGAGG + Intergenic
996389374 5:122943368-122943390 GGGTACAGAGAGAAGGGCAGTGG - Intronic
996847777 5:127919832-127919854 CAGAGCAGATAGAGGGACAGAGG - Intergenic
998145338 5:139724635-139724657 GGGGGCAGAGAGAAGGGCAGGGG + Intergenic
998838732 5:146230708-146230730 TGGTGCAGACACAGGCACATAGG - Exonic
999293940 5:150446265-150446287 AGGTGCAGTCAGAGGGGAAGAGG - Intronic
999300829 5:150489280-150489302 GGGTGCAGACTGCGGGAAATGGG + Intronic
999691502 5:154149904-154149926 CTGTGGATACAGAGGGACAGAGG + Intronic
1000302641 5:159970218-159970240 GGGTGGAGGCAGAGGGAAATGGG - Intronic
1001384654 5:171328879-171328901 GGGTGGAGAGATAGGGAAAGAGG + Intergenic
1002198711 5:177514836-177514858 CGCTGCAGGCAGAGGGACAAAGG + Exonic
1002417865 5:179130199-179130221 GGGGGCAGCCAGAGAGACAAGGG - Intronic
1002426048 5:179176573-179176595 GGATACAGACAGGAGGACAGAGG - Intronic
1002426550 5:179180202-179180224 CTGTGCAGACAGAGGAAGAGAGG - Intronic
1002745121 5:181464099-181464121 TGGCAGAGACAGAGGGACAGAGG + Intergenic
1003227230 6:4217384-4217406 GGGCACAGAGAGAGGGAGAGAGG + Intergenic
1003311158 6:4971003-4971025 GGGGGCAAGCAGAGGGAAAGGGG + Intergenic
1003406990 6:5833988-5834010 GGGGGCAGGGAGCGGGACAGAGG + Intergenic
1004017058 6:11741790-11741812 GGGTGGAGAGAGAGGGGAAGGGG - Intronic
1004319099 6:14618724-14618746 AGGGACAGACAGAGGGGCAGAGG - Intergenic
1005624715 6:27652875-27652897 GGGCAGAGGCAGAGGGACAGGGG - Intergenic
1006297573 6:33176799-33176821 GGGTGCAGAGAGGGTGACAGGGG - Intronic
1007091576 6:39187986-39188008 GGGAGCAGAAAGAGGGCAAGAGG + Intergenic
1007266414 6:40599669-40599691 GGGTGCAGGGGGAGGGGCAGGGG + Intergenic
1007269485 6:40625418-40625440 AGGTGAAGACAGAGGGTGAGAGG + Intergenic
1007308122 6:40923105-40923127 GTGTGCAGGCAGAGGTACCGGGG + Intergenic
1007625493 6:43243962-43243984 GGGTGAAGCCATGGGGACAGGGG - Intronic
1009718694 6:67435199-67435221 GGATGGAGACAGAGGCAAAGAGG - Intergenic
1012210366 6:96510851-96510873 GGGGGAAGAAAGAGGGAAAGGGG - Intergenic
1012979049 6:105810818-105810840 GGGAGCAGAAAGAGGGAGTGAGG + Intergenic
1013022540 6:106233811-106233833 GGGTGCAGTGAGAGTGAAAGGGG - Intronic
1013616758 6:111850698-111850720 GGCTGCAGGCAGAGAGCCAGGGG - Intronic
1016004758 6:139078309-139078331 GGGTTCAGAGAAAGGGACAATGG + Intergenic
1016342695 6:143080588-143080610 GGGTGCAGTGAGAGTGAAAGGGG + Intronic
1016953021 6:149599578-149599600 GGTTACAGAGAGAGGGAGAGGGG - Intronic
1017947830 6:159109967-159109989 GGGTAGAGAAAGAGGTACAGTGG + Intergenic
1018695848 6:166390894-166390916 GGGTGGAGACAGGGGCTCAGTGG - Intergenic
1018944476 6:168336930-168336952 GGGTCCAGGCAGAGGCACTGTGG + Intergenic
1019204299 6:170346245-170346267 GCGTGCAGGGAGATGGACAGTGG - Intronic
1019250020 6:170737586-170737608 TGGCAGAGACAGAGGGACAGAGG + Intergenic
1019250030 6:170737645-170737667 TGGCAGAGACAGAGGGACAGAGG + Intergenic
1019427455 7:984303-984325 GGGTGGGGACAGAGGGAAAATGG - Intronic
1019471848 7:1225216-1225238 GGGGGCAGAAGGAGGGGCAGGGG + Intergenic
1019505526 7:1388639-1388661 GTGAGCAGCCAGCGGGACAGGGG - Intergenic
1019587711 7:1814116-1814138 CTGTGAACACAGAGGGACAGGGG - Intergenic
1019704242 7:2489984-2490006 GGGTGGAGACCGAGGGAGACAGG - Intergenic
1019890320 7:3941160-3941182 GGGAGAGGAGAGAGGGACAGAGG - Intronic
1020011352 7:4807534-4807556 GAGGGGAGACAGAGGGAGAGAGG - Intronic
1020211316 7:6159902-6159924 GGGCGCAGACAGCAGCACAGGGG - Intronic
1022283763 7:28935622-28935644 TGGGGCAGGCAGAGGGAGAGAGG + Intergenic
1022569951 7:31442536-31442558 GAGAGGAGACGGAGGGACAGGGG + Intergenic
1022740967 7:33121333-33121355 AGAGGTAGACAGAGGGACAGGGG - Intergenic
1023014603 7:35954916-35954938 GCCTGGCGACAGAGGGACAGAGG + Intergenic
1023863390 7:44227959-44227981 GGAGGGAGACAGGGGGACAGAGG + Intronic
1025834898 7:65085368-65085390 AGGCGCACCCAGAGGGACAGAGG - Intergenic
1025904670 7:65774847-65774869 AGGTGCACCCAGAGGGACAGAGG - Intergenic
1026605111 7:71809169-71809191 GGTTGCAAACAGTGGGAGAGAGG - Intronic
1026634717 7:72071285-72071307 AGGTGCAGACAAAGAGGCAGGGG + Intronic
1027219736 7:76206325-76206347 GGGGGCAGAGTGAGGGAGAGTGG + Intronic
1027549094 7:79568332-79568354 GAGAGAAGACAGAGGCACAGGGG + Intergenic
1028134267 7:87209971-87209993 GGGGACAGAGAGAGAGACAGAGG + Intronic
1028369768 7:90077925-90077947 GTGTGCAGAAAGAGAGAGAGAGG - Intergenic
1028433735 7:90777832-90777854 GGGTGCAGTCTGAGGCATAGTGG - Intronic
1028588013 7:92470316-92470338 GGGTGCAGTGAGAGTGAAAGAGG + Exonic
1028729606 7:94130739-94130761 CAGAGAAGACAGAGGGACAGAGG - Intergenic
1029150529 7:98477321-98477343 GGGTGCAAAGGGAGGGACAGAGG - Intergenic
1029155152 7:98512073-98512095 GGGTTCAGACAGGGAAACAGAGG - Intergenic
1029620593 7:101688035-101688057 GGGTGCACTGGGAGGGACAGGGG - Intergenic
1030058509 7:105603813-105603835 AGGGGCAGAGAGATGGACAGAGG - Intergenic
1030654199 7:112148280-112148302 GAGTGCTGGCAGAGGGACAGGGG + Intronic
1031076526 7:117218837-117218859 GGGTGGGGACAGAGGTGCAGAGG - Intronic
1031688836 7:124764667-124764689 GGCTGCAGGCAGAGGGGCGGAGG - Exonic
1031840958 7:126738715-126738737 GGATGCAGAAAGAAGAACAGAGG + Intronic
1032587160 7:133157383-133157405 AGGTGAAGAGAGAGGGACAGAGG - Intergenic
1034054120 7:148016389-148016411 GAGTGGAGACAGAGTGACAGCGG - Intronic
1035042011 7:155935905-155935927 GGCTGCAGAGAGAGGGGCCGTGG + Intergenic
1035498029 8:69777-69799 TGGCAGAGACAGAGGGACAGAGG - Intergenic
1035498049 8:69895-69917 TGGCAGAGACAGAGGGACAGAGG - Intergenic
1035498069 8:70013-70035 TGGCAGAGACAGAGGGACAGAGG - Intergenic
1035498079 8:70072-70094 TGGCAGAGACAGAGGGACAGAGG - Intergenic
1035607435 8:939067-939089 AGGTGCAGACACAGGGGCTGGGG + Intergenic
1035607447 8:939104-939126 AGGTGCAGACACAGGGGCTGGGG + Intergenic
1035607459 8:939141-939163 AGGTGCAGACACAGGGGCTGGGG + Intergenic
1035607483 8:939217-939239 AGGTGCAGACACAGGGGCTGGGG + Intergenic
1035607506 8:939293-939315 AGGTGCAGACACAGGGGCTGGGG + Intergenic
1035607628 8:939671-939693 AGGTGCAGACACAGGGGCTGGGG + Intergenic
1035607654 8:939747-939769 AGGTGCAGACACAGGGGCTGGGG + Intergenic
1035607666 8:939784-939806 AGGTGCAGACACAGGGGCTGGGG + Intergenic
1035607678 8:939821-939843 AGGTGCAGACACAGGGGCTGGGG + Intergenic
1035607690 8:939858-939880 AGGTGCAGACACAGGGGCTGGGG + Intergenic
1035769532 8:2135999-2136021 GGTTGCAGACGCAGGGACAGCGG + Intronic
1035908440 8:3539090-3539112 GGGTGCAGGGAAAGGGACTGGGG - Intronic
1036470683 8:9049849-9049871 AGGTGAGGAGAGAGGGACAGTGG + Intronic
1037743533 8:21626000-21626022 GGAGGCAGCCAGACGGACAGAGG + Intergenic
1037753473 8:21697130-21697152 GGGAGGGGACAGAGGGAGAGGGG + Intronic
1038024962 8:23580102-23580124 AGCTGCAGAAAGAGGGACTGTGG + Intergenic
1038192084 8:25331861-25331883 GGGTGGATTCAGAGGGAAAGAGG - Intronic
1038217579 8:25576905-25576927 GGAAGCAGACAGAAAGACAGTGG - Intergenic
1038240064 8:25800203-25800225 TGGTGCAGAGAGAGGGAGATGGG - Intergenic
1039348213 8:36731692-36731714 GGGTGCAAACACATGGACACAGG + Intergenic
1039434050 8:37547476-37547498 GGAGGCAGGCAGAGGGGCAGGGG - Intergenic
1040582534 8:48708992-48709014 GGCTTCAGAGAGAGGGGCAGTGG - Intergenic
1040741024 8:50575907-50575929 GAATACAGACAGAGGGAAAGAGG - Intronic
1041845573 8:62323949-62323971 GGGTACAGAGGGAGGGAGAGAGG + Intronic
1042048699 8:64683960-64683982 GTGTGCAGACAGGGAGTCAGGGG - Intronic
1042613447 8:70623080-70623102 GGCTGAAGACTGAGGGATAGAGG + Intronic
1043502315 8:80870384-80870406 AGGTGTGGACAGAGGGACACAGG - Intronic
1043510939 8:80949589-80949611 TTGTGCAGGCAGATGGACAGGGG + Intergenic
1045065203 8:98437986-98438008 GGGAGCTGACAGAGGCCCAGAGG + Intronic
1045492199 8:102678648-102678670 GGGAGAAGACAGGGGAACAGGGG + Intergenic
1046449660 8:114371738-114371760 GGGTGCTGACGGAGGGAGTGGGG - Intergenic
1047336815 8:123943809-123943831 GGATGCAGACAGAGGGCAAAGGG + Intronic
1047346873 8:124037475-124037497 CAGTGGGGACAGAGGGACAGTGG + Intronic
1048001705 8:130384431-130384453 GGGGGCAGAAAGTGGGACATTGG + Intronic
1049173125 8:141174388-141174410 GGGGACAGAGAGAGGGACACTGG + Intronic
1049227871 8:141466326-141466348 GGGGGCAGACAGGAGGGCAGAGG + Intergenic
1049542316 8:143214232-143214254 GGGTGGAGACACAAGCACAGAGG + Intergenic
1049605946 8:143529249-143529271 CGCTGGGGACAGAGGGACAGAGG + Intronic
1050579737 9:7040342-7040364 GGGTAGAGAGAGAGGGAAAGAGG - Intronic
1051535492 9:18152675-18152697 GGGTGATGACTGAGGGCCAGTGG + Intergenic
1052044583 9:23779307-23779329 GTGGGCAGACAGAGGAACAAAGG + Intronic
1053196444 9:36122894-36122916 GAGGGCAGAGAGAGGGACATGGG - Exonic
1053288513 9:36864971-36864993 GTGTGCAGAGAGAGGCACCGCGG + Intronic
1053754731 9:41293928-41293950 GGGTGCTGAGAGAGGCACACAGG - Intergenic
1054260253 9:62858231-62858253 GGGTGCTGAGAGAGGCACACAGG - Intergenic
1054331515 9:63761774-63761796 GGGTGCTGAGAGAGGCACACAGG + Intergenic
1055593582 9:77843325-77843347 GGCTGCAGAGGCAGGGACAGAGG + Intronic
1055656305 9:78453219-78453241 GGATGCAGAGACATGGACAGAGG + Intergenic
1056207662 9:84335931-84335953 GGATGCAGACACTGGGACGGAGG - Intronic
1056723444 9:89090680-89090702 GGGTGCAGCCACAGAGAAAGGGG + Intronic
1056914331 9:90731724-90731746 GGGTGGAGAAAGAAGGAAAGGGG - Intergenic
1057083992 9:92192079-92192101 GGGTGGGGACAGAGGGCCAGGGG - Intergenic
1057091932 9:92266077-92266099 GGGTGGAAACAGAGGAGCAGTGG - Intronic
1057195638 9:93114561-93114583 GGGTGCACACAGATGGACAGGGG - Intergenic
1057217399 9:93236685-93236707 GGTGGCAGCCTGAGGGACAGTGG - Intronic
1057263169 9:93597552-93597574 GGGGGCAGGCAGTGGGACATTGG + Intronic
1058078403 9:100674225-100674247 GGGTGAAAACAGATGGAAAGGGG + Intergenic
1059061488 9:111038501-111038523 GGGCGCAGAGGGAGGGCCAGAGG + Intergenic
1059339073 9:113587239-113587261 GGGGACTGGCAGAGGGACAGTGG + Intronic
1059670142 9:116483468-116483490 GGGGTCAGAGAGAGGGAGAGAGG + Intronic
1060062909 9:120476736-120476758 GTGTACAGACACATGGACAGAGG + Intronic
1060104599 9:120865900-120865922 GGGTCCAGGCTGAGAGACAGGGG + Intronic
1060397353 9:123325482-123325504 GGAGACACACAGAGGGACAGAGG + Intergenic
1060908727 9:127331581-127331603 GGAGGAAGACAGAGGAACAGGGG - Intronic
1061597078 9:131637960-131637982 GGCTGCAGGCAGCAGGACAGTGG - Intronic
1061623148 9:131824619-131824641 GGCAGCAGACACCGGGACAGAGG - Intergenic
1061872141 9:133526828-133526850 GGCTGCAGGCAGAGGGAGCGAGG - Intronic
1061942745 9:133891974-133891996 AGGTGGAGAGAGAGGGAGAGAGG + Intronic
1062185555 9:135216358-135216380 GGGTGTGGACAGGTGGACAGTGG - Intergenic
1062380253 9:136283674-136283696 GGGTGCAGCCAGAGGGGCAGAGG - Intronic
1062460573 9:136661020-136661042 GGATGCAGGCAGAGGGCAAGAGG + Intronic
1062478416 9:136740776-136740798 GGGTGCAGAGGGAGGCATAGAGG - Intronic
1062686104 9:137814205-137814227 GGACCCTGACAGAGGGACAGGGG - Intronic
1202798886 9_KI270719v1_random:154688-154710 GGGTGCTGAGAGAGGCACACAGG + Intergenic
1203461660 Un_GL000220v1:46411-46433 GGCTGCATACTAAGGGACAGTGG - Intergenic
1203579591 Un_KI270745v1:30230-30252 TGGCAGAGACAGAGGGACAGAGG + Intergenic
1203673043 Un_KI270755v1:35112-35134 TGTTGCAGACAGAGGCCCAGAGG + Intergenic
1185683159 X:1905858-1905880 GGGTGAGGACAGAGGTGCAGTGG - Intergenic
1185970581 X:4658171-4658193 GAGTGCAGAGAGAGGGAGAGGGG - Intergenic
1186254118 X:7701112-7701134 GGGTGCAGTGAGAGTGAAAGGGG + Intergenic
1187115697 X:16348106-16348128 GTGTGCACAGAGAGAGACAGAGG + Intergenic
1187231031 X:17423501-17423523 CCGAGCAGACAGAGGGCCAGAGG - Intronic
1187291206 X:17955139-17955161 GGGGGCAGACAGGGGGACAAAGG + Intergenic
1187401810 X:18966956-18966978 TGGTGGTGACAGAGGAACAGAGG + Intronic
1187492098 X:19761374-19761396 GGGGGGAGAGAGAGGGAGAGAGG + Intronic
1187500952 X:19838294-19838316 GGAAGCAGCCAGAGGGACAGTGG + Intronic
1189284452 X:39841439-39841461 GGGAGGAGAGAGAGGGAGAGTGG + Intergenic
1189487052 X:41442295-41442317 GGGAGCAGACAGAGGTCCCGGGG + Intergenic
1189748382 X:44193704-44193726 GTGTGTAGACAGAGGGAGAGTGG + Intronic
1190793363 X:53720361-53720383 GGATGGGGACAGAGGGACAAAGG - Intergenic
1190873576 X:54444667-54444689 GGAGCCAGACAGAGGAACAGGGG - Exonic
1190983953 X:55483926-55483948 GGGTACTGGTAGAGGGACAGGGG + Intergenic
1191662567 X:63666132-63666154 TGGTAGAGACAGAGGGAGAGAGG + Intronic
1194620570 X:96165851-96165873 GGGTGGGGACAGAGGGTGAGAGG - Intergenic
1195630889 X:107054069-107054091 GGGTGCAGTGAGAGCGAAAGGGG + Intergenic
1197758768 X:130013818-130013840 GGGCACAGACGGAGGGGCAGGGG - Exonic
1198256734 X:134930752-134930774 AGGTGCAGACGGAAGGAAAGAGG - Intergenic
1198293894 X:135265254-135265276 GGATGTAGAAAGAGAGACAGGGG + Intronic
1198932811 X:141879150-141879172 GGCAGCAGGCACAGGGACAGGGG - Intronic
1198962387 X:142195983-142196005 GGCTGCAGGCACAGGGACAGGGG + Intergenic
1199318452 X:146409558-146409580 GGGAGAAGATGGAGGGACAGTGG + Intergenic