ID: 1084671299

View in Genome Browser
Species Human (GRCh38)
Location 11:70608098-70608120
Sequence CAGCTGCTCTTGTGGGAAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 240}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084671289_1084671299 25 Left 1084671289 11:70608050-70608072 CCGCCATGTCCGATTCCTGCTGC 0: 1
1: 0
2: 2
3: 21
4: 154
Right 1084671299 11:70608098-70608120 CAGCTGCTCTTGTGGGAAATCGG 0: 1
1: 0
2: 0
3: 20
4: 240
1084671292_1084671299 10 Left 1084671292 11:70608065-70608087 CCTGCTGCCTTTGCCAGATAAAG 0: 1
1: 0
2: 1
3: 15
4: 265
Right 1084671299 11:70608098-70608120 CAGCTGCTCTTGTGGGAAATCGG 0: 1
1: 0
2: 0
3: 20
4: 240
1084671294_1084671299 3 Left 1084671294 11:70608072-70608094 CCTTTGCCAGATAAAGGTAAATG 0: 1
1: 0
2: 0
3: 16
4: 168
Right 1084671299 11:70608098-70608120 CAGCTGCTCTTGTGGGAAATCGG 0: 1
1: 0
2: 0
3: 20
4: 240
1084671290_1084671299 22 Left 1084671290 11:70608053-70608075 CCATGTCCGATTCCTGCTGCCTT 0: 1
1: 0
2: 0
3: 21
4: 225
Right 1084671299 11:70608098-70608120 CAGCTGCTCTTGTGGGAAATCGG 0: 1
1: 0
2: 0
3: 20
4: 240
1084671288_1084671299 26 Left 1084671288 11:70608049-70608071 CCCGCCATGTCCGATTCCTGCTG 0: 1
1: 0
2: 0
3: 12
4: 210
Right 1084671299 11:70608098-70608120 CAGCTGCTCTTGTGGGAAATCGG 0: 1
1: 0
2: 0
3: 20
4: 240
1084671291_1084671299 16 Left 1084671291 11:70608059-70608081 CCGATTCCTGCTGCCTTTGCCAG 0: 1
1: 0
2: 4
3: 33
4: 391
Right 1084671299 11:70608098-70608120 CAGCTGCTCTTGTGGGAAATCGG 0: 1
1: 0
2: 0
3: 20
4: 240
1084671295_1084671299 -3 Left 1084671295 11:70608078-70608100 CCAGATAAAGGTAAATGTGCCAG 0: 1
1: 0
2: 0
3: 16
4: 112
Right 1084671299 11:70608098-70608120 CAGCTGCTCTTGTGGGAAATCGG 0: 1
1: 0
2: 0
3: 20
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084671299 Original CRISPR CAGCTGCTCTTGTGGGAAAT CGG Intronic
901808365 1:11751650-11751672 CAGCTGCAGTTGTGAGAAACTGG + Intronic
902452584 1:16506759-16506781 CAGCTGCACTGAAGGGAAATCGG + Intergenic
902610050 1:17591907-17591929 CAGCTGCTCATCTGCAAAATGGG - Intronic
902624042 1:17666639-17666661 CAGCTGTTCTTGGGGGAGAAAGG - Intronic
902756078 1:18550101-18550123 CAGCTGCCTTTGTGAGAAACAGG - Intergenic
903438943 1:23372639-23372661 CAGCTGCTGAGCTGGGAAATAGG + Intergenic
903957634 1:27036117-27036139 CAGCTTCTATAGTGGGCAATAGG - Intergenic
904238786 1:29130884-29130906 TAGCTACTCTAGTGGGAACTTGG - Intergenic
905696793 1:39980614-39980636 CAGCTGCCCTGGAGGGAAAAAGG - Intergenic
907917108 1:58881472-58881494 TAGACGCTCTTGTGGGAGATGGG + Intergenic
908109040 1:60876388-60876410 CAGCTGCTACACTGGGAAATGGG - Intronic
908572701 1:65425937-65425959 CAGCTACTGTTATGGGAACTAGG + Intronic
910118362 1:83757430-83757452 CAGTTGCCCCTATGGGAAATCGG - Intergenic
911254939 1:95622291-95622313 CAGCTGATCTTATTTGAAATGGG - Intergenic
911467728 1:98276016-98276038 CCTCTGCTCTTTTGGGATATGGG - Intergenic
911818212 1:102382270-102382292 TAGATGCACTTGTGTGAAATTGG - Intergenic
912632362 1:111256695-111256717 CAGCTGCTCTTGCTGTAACTGGG + Intergenic
913470288 1:119179644-119179666 CAGCTACTCTGGTGGGGACTTGG + Intergenic
915311492 1:155007834-155007856 CAGCAGCTGTTGGGGGAAAGGGG + Intronic
916448040 1:164891931-164891953 CAGCTCCTCCTGGGGGAAAAAGG + Intronic
916909973 1:169336536-169336558 TAGCTGCTCTGGTGGGGACTTGG - Intronic
916909990 1:169336696-169336718 TAGCTGCTCTTGTGGGGCCTTGG - Intronic
918376184 1:183911491-183911513 CAGCTGCTCTGGTGGGGGAGTGG - Intronic
918379925 1:183943704-183943726 GAGCTCCTCTGTTGGGAAATGGG - Intronic
918720956 1:187850941-187850963 TAGCTGCTCTGGTGGGGACTTGG + Intergenic
919237124 1:194859620-194859642 TAGCTGCTCTGGTGGGGCATCGG + Intergenic
919822641 1:201482619-201482641 GAGCTGGTCATCTGGGAAATAGG + Intergenic
920092157 1:203462406-203462428 CAGCTTCTCTTGTGGGATCTTGG + Intergenic
920092714 1:203465666-203465688 CAGCTGATGGTGTGGGAAAGTGG - Intergenic
920290134 1:204916188-204916210 GAGCTGCTCTTCTTGCAAATTGG + Intronic
920650197 1:207831847-207831869 CTGCTGCTCTTGTGGGCAGGAGG + Intergenic
920943011 1:210501636-210501658 CAGCTGCTCCTGGGGAAAAATGG + Intronic
921189024 1:212693579-212693601 CAGCTGCCCTTTTCAGAAATGGG - Intronic
922654254 1:227367138-227367160 CAGCTGCTTTTGAGGGATTTGGG - Intergenic
922933281 1:229406516-229406538 AAGTTGCTCTGGTGGGACATAGG - Intergenic
924140786 1:241021186-241021208 CAGCTGCTGTTGTGTGACAGAGG - Intronic
924196900 1:241617441-241617463 CATTTGCTCTTCTGGGATATCGG - Intronic
1063109303 10:3020733-3020755 CAGCTGCTCCTCTGGGAACCAGG + Intergenic
1067434909 10:46270025-46270047 CAGCTCCTCTTTTGTAAAATGGG - Intergenic
1068032011 10:51716172-51716194 CTGCTGCTCTTGTGGGGAGTGGG + Intronic
1069753469 10:70759823-70759845 CAGCTGCTCTGGATGGAAGTGGG - Intronic
1070783467 10:79150286-79150308 CAGCAGCTCTCATGGGAAATAGG - Intronic
1072019778 10:91386918-91386940 AAGCTGCTCTTGAGGTAAAGTGG - Intergenic
1072730597 10:97843498-97843520 TAGCTCCTCTGGTGGGAAAGAGG - Intergenic
1072870166 10:99110517-99110539 CAACTTCTTTTGTGGAAAATGGG - Intronic
1075439162 10:122465819-122465841 CGGCTGGTCTTTTGGGACATGGG - Intronic
1075526843 10:123194149-123194171 CAGCTCTTCATCTGGGAAATGGG + Intergenic
1076610537 10:131723343-131723365 CAGCTGCTCTTGTGACCAAGAGG - Intergenic
1077673769 11:4180363-4180385 TAGCTGCTCTTCTAGGAAAGTGG + Intergenic
1078421929 11:11219554-11219576 AAGCTGCTGTTGTGAGAAACTGG - Intergenic
1079731646 11:23942016-23942038 CAGCTGCTCTGGTGGGGCCTTGG - Intergenic
1080839034 11:35967255-35967277 CAGCAGCTCTGGTCAGAAATTGG - Intronic
1081753961 11:45531559-45531581 CAGCTTCTCATCTGGCAAATGGG + Intergenic
1081984001 11:47288592-47288614 CAGATGCTGTTGTGGGGAGTGGG - Intronic
1082270327 11:50163627-50163649 TAGCTACTCTGGTGGGAACTTGG - Intergenic
1084186747 11:67476673-67476695 CAGCTGCTCTGGTGGGGACTTGG + Intergenic
1084671299 11:70608098-70608120 CAGCTGCTCTTGTGGGAAATCGG + Intronic
1086106828 11:83156585-83156607 CAGCTGCCCCTCTGGGAACTGGG - Intergenic
1086333769 11:85779433-85779455 CAGTTCCTCTTTTGTGAAATAGG - Intronic
1086808121 11:91269294-91269316 CAGCTGCTCTGGTGGGGCCTTGG + Intergenic
1088639062 11:111853443-111853465 CAGCTACTATTATGGGAAGTTGG - Exonic
1089045361 11:115497577-115497599 CAGCTGCTGTTGTGGTTAATGGG - Intronic
1090133456 11:124170461-124170483 TAGCTTCTCTCGTGGGAACTTGG - Intergenic
1090718205 11:129449269-129449291 CTGCTGCTCTTGAAGGAAAGAGG + Intronic
1094520744 12:31185641-31185663 CAGATGCTTTTGAGTGAAATCGG - Intergenic
1095178709 12:39122740-39122762 CAGCTGCTGTTGGGGGAAGGGGG + Intergenic
1096181163 12:49551151-49551173 CAGGTGCTCTGGGGGGAATTGGG + Intronic
1097982109 12:65744932-65744954 CAGCTACTCTGGTGGGGACTTGG + Intergenic
1098897500 12:76080899-76080921 CAGCTCCCCTGGTGGGAAACTGG - Intronic
1102029402 12:109731321-109731343 CGGCTGGTCCTGTGGGACATTGG + Intronic
1102309869 12:111836271-111836293 TAGCTGCTCTGGTGGGGACTTGG + Intergenic
1102784217 12:115591134-115591156 CAGCTGGACTTGTGGGGCATAGG - Intergenic
1103773925 12:123351265-123351287 CACTTGCTCTTGTGGGAAACAGG + Intronic
1104140846 12:125984333-125984355 CAGCTGCTCCTGTGAGGAAGCGG + Intergenic
1105519874 13:21122605-21122627 AAGCTCCTCTTGGTGGAAATGGG - Intergenic
1107273851 13:38654414-38654436 CAGCTGCTGTTCTGGGCATTGGG - Intergenic
1108377935 13:49830475-49830497 CAACTGCTCCTGTGGGAGAGAGG - Intergenic
1108643869 13:52407821-52407843 TAGCTACTCTTGTGGGGACTTGG - Intergenic
1109620552 13:64899897-64899919 CAGCTGCTCTGGAGTGAAGTAGG + Intergenic
1110248215 13:73352136-73352158 CACCTCCTCTTCTGGGAAAGGGG - Intergenic
1110664659 13:78102364-78102386 CAGCTGCTCTGAAGGGAAGTTGG - Intergenic
1115936821 14:38561506-38561528 CAGCTGCTGGTGTAGGAATTGGG + Intergenic
1117784585 14:59269451-59269473 CAGCTGCCCCTGTGGGACAGTGG + Intronic
1118743497 14:68758031-68758053 CAGCTGCTGTTGTTGGTTATGGG - Intergenic
1120025036 14:79573683-79573705 CAGCTGCTGTTGTGGTTACTTGG + Intronic
1120594735 14:86419640-86419662 AAGCTGCTATTGCTGGAAATGGG - Intergenic
1122018979 14:98820762-98820784 CTGATGCTCTTGGGGAAAATGGG - Intergenic
1122023106 14:98855683-98855705 CGTCTGCTCTTCTGTGAAATGGG - Intergenic
1122276680 14:100594303-100594325 ATGCTGCCCTTGTTGGAAATGGG + Intergenic
1125110882 15:36032410-36032432 ATGCTGCTCTTGGGGTAAATGGG + Intergenic
1129520378 15:76182240-76182262 CAGCTTCTCATTGGGGAAATTGG + Intronic
1130331391 15:82925039-82925061 CAGCTGATCTTGGGGTAAACAGG + Intronic
1131846003 15:96491572-96491594 TAGCTGCTCTGGTGGGGACTTGG - Intergenic
1132652518 16:1028038-1028060 CTGCTGCTCCTGTGGGAGGTGGG - Intergenic
1135280961 16:21153177-21153199 TAGCTGCTCTGGTGGGACCTTGG + Intronic
1136059674 16:27717937-27717959 CAGCTGCTCCTGTGGGCAACTGG - Intronic
1138228218 16:55317231-55317253 CAGCTGCTCATCTGTGAAAAGGG + Intergenic
1139715487 16:68809954-68809976 CTGGTCCTCGTGTGGGAAATGGG + Intronic
1140310638 16:73844953-73844975 CTGCTGCTCTAATGGGCAATAGG + Intergenic
1144414870 17:15036739-15036761 CAGCTACTCTTGTTGAAAATGGG - Intergenic
1145974788 17:28977776-28977798 CAGCTGCAGGTGTGGGAAAGGGG - Intronic
1146224434 17:31053275-31053297 CAGCAGCGCTAGTGGGGAATGGG + Intergenic
1148659953 17:49321839-49321861 TAGCAGCTCTAGTGGGAAAATGG + Intronic
1150450084 17:65259384-65259406 CAGCTACTCTGGAGGGAGATGGG - Intergenic
1151164702 17:72193568-72193590 CAGCTGCTCGTGTGGCAATTCGG + Intergenic
1151292092 17:73157592-73157614 CAGCTCCTCTTTTGGGGAAGAGG + Intergenic
1152664070 17:81557190-81557212 CACCTCCTCTTGTGGGAAGGAGG - Exonic
1153966452 18:10187186-10187208 CAGCAGCTTTTGTGTGCAATGGG - Intergenic
1155023228 18:21915522-21915544 CAGCTCCTCTTGTGGGCGACTGG + Intergenic
1155649766 18:28127283-28127305 TAACTGCTCCTGTGGGAACTAGG - Intronic
1156892156 18:42203344-42203366 CTGCTGATCTTGTGGGAAACTGG + Intergenic
1157175805 18:45450899-45450921 CAGCTGCTACTGTGGGCCATTGG + Intronic
1157406844 18:47428864-47428886 CGGCTGCTCTGGTGGGAGAAGGG + Intergenic
1158694401 18:59690783-59690805 CACCTGTTCTTGTGGGAAGGCGG + Intronic
1159103083 18:63976856-63976878 CAGCAACTCTTGGGGAAAATGGG + Intronic
1160064023 18:75558217-75558239 CAGATGCGCTGGTTGGAAATGGG - Intergenic
1160197930 18:76772305-76772327 CAGCTTCTCCTGAGGGAAAAGGG - Intergenic
1162235423 19:9305318-9305340 ACCCTGCTCTTGTGGGAAAGTGG + Intronic
1165303638 19:34989582-34989604 CAGCTGCTCTTCTAGAGAATGGG - Intergenic
1165369661 19:35396847-35396869 TAGCTTCTCTAGTGGGAGATGGG - Intergenic
1165415428 19:35690836-35690858 CAGCTACTCTGGTGGGGACTTGG - Intergenic
1165509846 19:36259484-36259506 CATCTGCTCTTGGGGGACGTCGG + Intergenic
1167600508 19:50451790-50451812 GAGATTCTCTTGTGGGAACTGGG + Intronic
925107717 2:1307516-1307538 ACGTTACTCTTGTGGGAAATGGG - Intronic
925188455 2:1865050-1865072 CAGGTGCTCTTGTGGGGAGGCGG + Intronic
925705548 2:6681531-6681553 CTGCGGCTGTTGTGGGAGATGGG - Intergenic
926765521 2:16319975-16319997 CAGCTGCACTTCTGAGACATCGG - Intergenic
927929793 2:27036776-27036798 CGGCTGCTCCTGTGAGTAATGGG + Exonic
928413965 2:31075910-31075932 CCTCTGCTCTTGTGGGACTTGGG - Intronic
929450671 2:42034964-42034986 AAGCTGCCCTTGAGGGAAAGTGG + Intergenic
932837116 2:75048178-75048200 CAGCTGCACTTCTGGGAAGAGGG - Exonic
933010764 2:77059864-77059886 CTGCTGCTCTTGAGAGAAGTTGG - Intronic
933171467 2:79130525-79130547 CAGCTGCTCTTGTAAGAACCTGG - Intergenic
934167691 2:89309834-89309856 CAGCAGCTCATGTGGGCAGTTGG + Intergenic
934199594 2:89872749-89872771 CAGCAGCTCATGTGGGCAGTTGG - Intergenic
934700827 2:96438842-96438864 CAGCTTCAGTTGTGGCAAATAGG + Intergenic
934893110 2:98087626-98087648 CAGCCGCTCTGGTGGAAAAGCGG + Intronic
937597088 2:123685586-123685608 TAGCTGCTCTGGTGGGGACTTGG + Intergenic
938075135 2:128327874-128327896 CAGGTGCTACAGTGGGAAATGGG - Intergenic
939003230 2:136759041-136759063 TAGCTACTCTGGTGGGAACTTGG + Intergenic
942293052 2:174490678-174490700 CAGCGGGACTTGAGGGAAATCGG - Intergenic
942423499 2:175834376-175834398 ATGCTGCTTTTGTGGGAAAAAGG - Intergenic
943590386 2:189789067-189789089 CAGCTGCTCTCCTGAGAACTGGG + Intronic
944983472 2:205148951-205148973 GAGCTGGGCTTCTGGGAAATTGG + Intronic
945241830 2:207683153-207683175 CAACTGCTGTTGTGAGAAAAGGG - Intergenic
945807451 2:214507816-214507838 CTGCTTCTCTTCTGGGGAATGGG + Intronic
945817662 2:214625556-214625578 AAGCTGCTATTGTGGCATATTGG + Intergenic
947026740 2:225744754-225744776 CAGCTACTCTGGTGGGGACTGGG + Intergenic
948044023 2:234928821-234928843 CAGCTTCTCTAGTGGGAGGTGGG + Intergenic
948606802 2:239141069-239141091 CATCTCCTCTTCTGGGAAACGGG - Intronic
949006139 2:241649556-241649578 CAGCTGCTCTTCAGGGAACTGGG - Intronic
1168936753 20:1672135-1672157 CAGCTCCTCTTCTGTAAAATAGG + Intergenic
1169274007 20:4221149-4221171 CCCCTCCTCTTCTGGGAAATAGG - Exonic
1170934769 20:20800167-20800189 CAGCTACTATTGTTGGAAATAGG + Intergenic
1171090449 20:22280607-22280629 CTGCTGTTGTTGTGGGAAAGTGG - Intergenic
1172535553 20:35670312-35670334 CAGCAGCTCTTGTGTGAGATGGG - Intronic
1172626618 20:36351064-36351086 CAGTTCCTCTTCTGTGAAATGGG + Intronic
1173841832 20:46162559-46162581 TAGCTCCTCTTTTGGGGAATGGG + Intergenic
1173919351 20:46732091-46732113 CAGATGTGCTTGTTGGAAATGGG + Intronic
1173994254 20:47325625-47325647 CCCCTGCTTTTGGGGGAAATGGG - Intronic
1174025944 20:47575021-47575043 CAGCAGCTATTGGGGGAAGTGGG - Intronic
1174861723 20:54097602-54097624 CGGCTGCTCAGGTGGGAAAGTGG + Intergenic
1177497030 21:21903004-21903026 TAGCTGCTCTGGTGGGACCTTGG + Intergenic
1178415873 21:32404731-32404753 CCGCTGCTCTAGTGGGATACTGG - Intergenic
1178775946 21:35550841-35550863 CAGCTGCAAAGGTGGGAAATGGG - Intronic
1181103277 22:20555632-20555654 CGGCTGCTGTGGTGGGAAACTGG + Intronic
1181869275 22:25885371-25885393 CATCTACTCAGGTGGGAAATGGG + Intronic
1182479476 22:30597486-30597508 TAGCTGATCTTGTGGGGACTTGG + Intronic
1184549815 22:45198455-45198477 GACCTGCTCTTGTGTGAACTTGG - Intronic
950632744 3:14293751-14293773 CAGCTACTCTGGTGGGGACTTGG + Intergenic
950826054 3:15822520-15822542 CAGATGTTTTTGTTGGAAATTGG - Intronic
954834407 3:53453135-53453157 CTGCTACTCCTGTGAGAAATAGG + Intergenic
956653519 3:71527183-71527205 TGGCTGCTCTGGTGTGAAATTGG - Intronic
956788886 3:72665256-72665278 CAGCTGCCCATCTGTGAAATGGG - Intergenic
958044533 3:88267366-88267388 CAGGTGCTCTTGAGAGAAAAGGG + Intergenic
958094245 3:88921668-88921690 CAGATGTTGTTCTGGGAAATCGG + Intergenic
961158057 3:124697616-124697638 CAGCTTCTCTCCTGGGCAATGGG - Intronic
961322827 3:126089511-126089533 AATCTGCTCTTTTGAGAAATTGG + Intronic
961568949 3:127784703-127784725 CAGCTTCTATTGTGGTAAGTGGG + Intronic
961696062 3:128705766-128705788 CAACTGCTCTTTTGGCAAAGTGG + Intergenic
962702501 3:138013030-138013052 CAGGCGCTTTTCTGGGAAATGGG - Intronic
964378619 3:156073698-156073720 CAGCTACTCTGGTGGGGACTTGG + Intronic
964393678 3:156223651-156223673 TAGCTGATCTGGTGGGAACTTGG - Intronic
966076184 3:175938153-175938175 TAGCTGCTCTGGTGGGGACTTGG + Intergenic
967975493 3:195032087-195032109 CAACTGCTCTTCTGGGAACTTGG + Intergenic
968607791 4:1543693-1543715 CAGCTCTTCTTGGGGGAAGTGGG - Intergenic
969344488 4:6562706-6562728 CAGTTTCTCTTCTGTGAAATGGG - Intronic
971554954 4:28002128-28002150 CTGCAGCTCCTGTGGGAGATGGG + Intergenic
971803880 4:31329102-31329124 CAGATGCTCTTCTGGGAACGAGG - Intergenic
972048815 4:34702599-34702621 CTGCGGCTGCTGTGGGAAATGGG - Intergenic
974590483 4:63942621-63942643 TAGCTACTCTGGTGGGAAATTGG - Intergenic
975810777 4:78166981-78167003 CAGATGCTCTTGTTTGAAAGAGG - Intronic
976458750 4:85282891-85282913 GAAATACTCTTGTGGGAAATTGG + Intergenic
976706001 4:88019802-88019824 CATCTGCAGTTTTGGGAAATGGG - Intronic
978230376 4:106390432-106390454 CAGCTTCTCTTGTTTGAAAATGG - Intergenic
978717531 4:111864107-111864129 CAGCTGCTGTAGGGGAAAATGGG + Intergenic
979889649 4:126075423-126075445 CAGCTGCTCTCTTTGGAAATGGG + Intergenic
981346635 4:143683975-143683997 CAGCAGCTGCTGTGGGGAATGGG - Intronic
981715084 4:147744715-147744737 CAGCAGCTTTTGTGGGAGAGAGG + Intronic
982081657 4:151796453-151796475 TAGCTGGTTTTGTGTGAAATGGG - Intergenic
985772218 5:1819577-1819599 CAGCTGCCTTTGAGGGAAATGGG + Intergenic
986245730 5:6005123-6005145 TAGCTACCCTGGTGGGAAATGGG - Intergenic
989655769 5:43745841-43745863 CAGCTGCCCCTCTGGGAAGTGGG - Intergenic
990499778 5:56384381-56384403 CAGCTGCTTTTGCTGGAAAGCGG + Intergenic
993529078 5:89003363-89003385 CAGCTACTCTGGTGGGGACTTGG - Intergenic
997853208 5:137351209-137351231 CATCTGCTCTGGTGGGAGGTGGG - Intronic
998171770 5:139876634-139876656 CAGCTGCACTTGTGGGCAGTCGG - Intronic
998291317 5:140917137-140917159 CAGCTGCTGCTGGGGGATATGGG + Intronic
998827696 5:146120856-146120878 CAGCTTCTCTTTTGTGAAAAAGG - Intronic
998940865 5:147280607-147280629 CTGCTGCTGCTGTGGGGAATGGG - Intronic
998974212 5:147626420-147626442 CTCCTCCTCCTGTGGGAAATAGG - Intronic
999699705 5:154217345-154217367 ACGCTCCTCTTGTGGAAAATGGG + Intronic
1000332350 5:160215798-160215820 CAGCTGCTGTTGTGAGGAATGGG + Intronic
1001215864 5:169855119-169855141 CATTTGCTCTTCTGGAAAATGGG + Intronic
1002763972 6:224000-224022 CAGCTGCTCTTGTGAGTCAGTGG + Intergenic
1003117447 6:3292775-3292797 CAGCTGCTCGTCTGTGAAGTAGG + Intronic
1003956776 6:11171603-11171625 TAGCTACTCTTGTGGGGACTTGG + Intergenic
1005019281 6:21402234-21402256 CAGCTGAGTCTGTGGGAAATTGG + Intergenic
1005132455 6:22524820-22524842 CACATACCCTTGTGGGAAATGGG - Intergenic
1008252518 6:49257757-49257779 CAGCTGCTACTGTGAGCAATTGG + Intergenic
1008639245 6:53444500-53444522 CACCTCCTCTTCTGGGATATAGG - Intergenic
1010769371 6:79811110-79811132 CAGCTACTCCTGTGGGAGAGGGG + Intergenic
1012937502 6:105383563-105383585 CATCTGCTCTTGGGTGAAAAGGG + Intronic
1013143452 6:107363864-107363886 TAGCTGCTCTGGTGGGGACTTGG - Intronic
1013960182 6:115889666-115889688 TAGCTGCTCTGGTGGGGACTTGG + Intergenic
1014280931 6:119441793-119441815 TAGCTACTCTGGTGGGAACTTGG + Intergenic
1015791828 6:136971185-136971207 GAGCTGCTCTTGTGGTAGCTGGG - Intergenic
1017672127 6:156778326-156778348 AAGCTGTTGTTGTTGGAAATGGG - Exonic
1021943591 7:25703886-25703908 GACCTGTTCTTGAGGGAAATTGG - Intergenic
1026335998 7:69394406-69394428 TAGCTGCTCTGGTGGGACCTTGG + Intergenic
1031409314 7:121422349-121422371 CAGCTACTCTGGTGGGGACTTGG + Intergenic
1033163398 7:139017053-139017075 CAGCTTCTGTAGTGGGAGATGGG - Intergenic
1035467418 7:159088855-159088877 CAGCTCCTCATCTGGGGAATGGG + Intronic
1041809380 8:61890433-61890455 CAGCTGCTCTCCTGCAAAATGGG - Intergenic
1043660184 8:82729514-82729536 TAGCTTTTCTTTTGGGAAATTGG - Intergenic
1044088588 8:87971721-87971743 TAGCTGCTCTGGTGGGGACTTGG + Intergenic
1044529119 8:93288332-93288354 CAACTGGGTTTGTGGGAAATTGG - Intergenic
1044620566 8:94187416-94187438 CAGCTGCTCTGCTGGGTACTGGG - Intronic
1045707097 8:104937073-104937095 CTGCTGCTCTTGTAGGACACAGG - Intronic
1047388258 8:124429446-124429468 CTGCTGCACTTGGAGGAAATAGG - Intergenic
1047532645 8:125691308-125691330 TCACTCCTCTTGTGGGAAATTGG + Intergenic
1048207417 8:132426393-132426415 CAGATCCTCTTGTGGGAACCAGG + Intronic
1051773466 9:20606570-20606592 CATCTTCTCTTGTCTGAAATTGG - Intronic
1052985219 9:34482105-34482127 TAGCTGCTCTGGTGGGGACTTGG - Intronic
1053563073 9:39216333-39216355 CAGCTGCCCCTGTGGAAAACTGG + Intronic
1053828863 9:42054277-42054299 CAGCTGCCCCTGTGGAAAACTGG + Intronic
1054134074 9:61402722-61402744 CAGCTGCCCCTGTGGAAAACTGG - Intergenic
1054601696 9:67133175-67133197 CAGCTGCCCCTGTGGAAAACTGG - Intergenic
1055323801 9:75107505-75107527 TATCTGCTTTTGGGGGAAATGGG + Intronic
1060446784 9:123696652-123696674 CAGCTGCTGCTGTGCGAATTAGG + Intronic
1186838647 X:13463285-13463307 CATCTGGTCTTCTGTGAAATGGG - Intergenic
1188242781 X:27809910-27809932 CAGCTACTCTGGTGGGGATTTGG + Intronic
1188578313 X:31680179-31680201 CAGCTGCTGTTGTGGGTCACTGG - Intronic
1192175427 X:68881951-68881973 TAGCTGCGCTGGTGGGCAATGGG + Intergenic
1192186863 X:68952817-68952839 CAGCTACTCTGGTGGGGACTTGG + Intergenic
1192855140 X:75000836-75000858 CAGCTGCTGCTGTGGGATGTGGG + Intergenic
1193014304 X:76715077-76715099 CAAGGGTTCTTGTGGGAAATAGG + Intergenic
1195896269 X:109749115-109749137 CAGCTACTCTGGTGGGGACTTGG - Intergenic
1197572157 X:128163152-128163174 CTGCAGCTGTTGTGGGAAATGGG + Intergenic
1199576013 X:149314693-149314715 CAGCTGTTCTTCTGAGAAAAAGG + Intergenic
1199628207 X:149759146-149759168 TAGCTGCTCTGGTGGGGACTTGG + Intergenic