ID: 1084673578

View in Genome Browser
Species Human (GRCh38)
Location 11:70621697-70621719
Sequence CCTTCTACACTCACTTGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 145}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084673578_1084673588 8 Left 1084673578 11:70621697-70621719 CCCAGGCAAGTGAGTGTAGAAGG 0: 1
1: 0
2: 0
3: 18
4: 145
Right 1084673588 11:70621728-70621750 TGCCTGAGGACGTGGGTATGGGG 0: 1
1: 0
2: 1
3: 12
4: 159
1084673578_1084673583 -6 Left 1084673578 11:70621697-70621719 CCCAGGCAAGTGAGTGTAGAAGG 0: 1
1: 0
2: 0
3: 18
4: 145
Right 1084673583 11:70621714-70621736 AGAAGGGGAGACTCTGCCTGAGG 0: 1
1: 0
2: 3
3: 44
4: 359
1084673578_1084673587 7 Left 1084673578 11:70621697-70621719 CCCAGGCAAGTGAGTGTAGAAGG 0: 1
1: 0
2: 0
3: 18
4: 145
Right 1084673587 11:70621727-70621749 CTGCCTGAGGACGTGGGTATGGG 0: 1
1: 0
2: 1
3: 7
4: 123
1084673578_1084673591 29 Left 1084673578 11:70621697-70621719 CCCAGGCAAGTGAGTGTAGAAGG 0: 1
1: 0
2: 0
3: 18
4: 145
Right 1084673591 11:70621749-70621771 GGAAGAATGATGGAGATACATGG 0: 1
1: 0
2: 1
3: 25
4: 348
1084673578_1084673584 0 Left 1084673578 11:70621697-70621719 CCCAGGCAAGTGAGTGTAGAAGG 0: 1
1: 0
2: 0
3: 18
4: 145
Right 1084673584 11:70621720-70621742 GGAGACTCTGCCTGAGGACGTGG 0: 1
1: 0
2: 0
3: 20
4: 220
1084673578_1084673586 6 Left 1084673578 11:70621697-70621719 CCCAGGCAAGTGAGTGTAGAAGG 0: 1
1: 0
2: 0
3: 18
4: 145
Right 1084673586 11:70621726-70621748 TCTGCCTGAGGACGTGGGTATGG 0: 1
1: 0
2: 1
3: 11
4: 149
1084673578_1084673585 1 Left 1084673578 11:70621697-70621719 CCCAGGCAAGTGAGTGTAGAAGG 0: 1
1: 0
2: 0
3: 18
4: 145
Right 1084673585 11:70621721-70621743 GAGACTCTGCCTGAGGACGTGGG 0: 1
1: 0
2: 0
3: 9
4: 124
1084673578_1084673590 19 Left 1084673578 11:70621697-70621719 CCCAGGCAAGTGAGTGTAGAAGG 0: 1
1: 0
2: 0
3: 18
4: 145
Right 1084673590 11:70621739-70621761 GTGGGTATGGGGAAGAATGATGG 0: 1
1: 0
2: 4
3: 42
4: 423
1084673578_1084673592 30 Left 1084673578 11:70621697-70621719 CCCAGGCAAGTGAGTGTAGAAGG 0: 1
1: 0
2: 0
3: 18
4: 145
Right 1084673592 11:70621750-70621772 GAAGAATGATGGAGATACATGGG 0: 1
1: 0
2: 2
3: 26
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084673578 Original CRISPR CCTTCTACACTCACTTGCCT GGG (reversed) Intronic