ID: 1084673738

View in Genome Browser
Species Human (GRCh38)
Location 11:70622417-70622439
Sequence AGCCCAGGACACTCGCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 145}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084673738_1084673742 4 Left 1084673738 11:70622417-70622439 CCTCTGTGCGAGTGTCCTGGGCT 0: 1
1: 0
2: 1
3: 17
4: 145
Right 1084673742 11:70622444-70622466 TTACAAAGCAACACAAACTGGGG 0: 1
1: 0
2: 5
3: 54
4: 449
1084673738_1084673743 5 Left 1084673738 11:70622417-70622439 CCTCTGTGCGAGTGTCCTGGGCT 0: 1
1: 0
2: 1
3: 17
4: 145
Right 1084673743 11:70622445-70622467 TACAAAGCAACACAAACTGGGGG 0: 1
1: 0
2: 9
3: 65
4: 392
1084673738_1084673741 3 Left 1084673738 11:70622417-70622439 CCTCTGTGCGAGTGTCCTGGGCT 0: 1
1: 0
2: 1
3: 17
4: 145
Right 1084673741 11:70622443-70622465 GTTACAAAGCAACACAAACTGGG 0: 1
1: 1
2: 37
3: 251
4: 1305
1084673738_1084673740 2 Left 1084673738 11:70622417-70622439 CCTCTGTGCGAGTGTCCTGGGCT 0: 1
1: 0
2: 1
3: 17
4: 145
Right 1084673740 11:70622442-70622464 TGTTACAAAGCAACACAAACTGG 0: 1
1: 1
2: 35
3: 172
4: 876
1084673738_1084673744 6 Left 1084673738 11:70622417-70622439 CCTCTGTGCGAGTGTCCTGGGCT 0: 1
1: 0
2: 1
3: 17
4: 145
Right 1084673744 11:70622446-70622468 ACAAAGCAACACAAACTGGGGGG 0: 1
1: 31
2: 283
3: 1164
4: 3062

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084673738 Original CRISPR AGCCCAGGACACTCGCACAG AGG (reversed) Intronic
900684010 1:3935661-3935683 AGACAAGGACACACTCACAGAGG - Intergenic
901880613 1:12191684-12191706 AGCCCAGCACTCTCAGACAGCGG - Intronic
901926584 1:12570204-12570226 AGCCCAGGACGCTTCCCCAGAGG - Intronic
902268599 1:15287102-15287124 AGCCCAGGGCAGGGGCACAGTGG + Intronic
902865333 1:19274100-19274122 AGCCCAGGAGCCGCGCGCAGCGG + Intergenic
902867450 1:19288735-19288757 AGCCCAGGAGCCGCGCGCAGCGG + Exonic
903037068 1:20499841-20499863 AGGCCAGGACACTAGGCCAGTGG + Exonic
903226306 1:21895849-21895871 AGCCCAGGAGACTGGCTCTGGGG + Intronic
904037425 1:27566432-27566454 AGACAAAGACACACGCACAGGGG + Intronic
904588583 1:31594307-31594329 AGGCCTGGAGACTGGCACAGGGG + Intergenic
905390863 1:37634631-37634653 CGCCCAGGACAGTCCCGCAGCGG - Exonic
911736057 1:101337744-101337766 AGCTCAGGTCAGTCTCACAGTGG + Intergenic
916677152 1:167073613-167073635 AGCCCTGGACATTCCCTCAGTGG - Intronic
917132554 1:171757384-171757406 AGCCCAGGACAATGGCTCACAGG - Intergenic
918104487 1:181404835-181404857 AGCTCAGGCCACCAGCACAGAGG + Intergenic
918128613 1:181605703-181605725 AGCCCAGGACACTGGAACCCAGG - Intronic
1063448308 10:6134219-6134241 AGCCCAGGACAGTGTCACAGGGG - Intergenic
1070533933 10:77361430-77361452 ACCCCAGGCCAGTGGCACAGAGG - Intronic
1072042103 10:91617322-91617344 TGCCCAGCTCACTCACACAGTGG + Intergenic
1075850803 10:125585327-125585349 AGCCCAAGACACTCCCTCTGGGG - Intronic
1076644855 10:131946070-131946092 AGCCCAGGTCTCACGCACAGAGG - Intronic
1076843140 10:133056395-133056417 AGCCCAGGACACAGGAAAAGAGG + Intergenic
1077412238 11:2409041-2409063 AGCTCAGGACCCAGGCACAGAGG - Intronic
1079097181 11:17518528-17518550 AGGCCAGGACACCACCACAGAGG - Intronic
1079139383 11:17797917-17797939 CCCCCAGGACAGTCCCACAGTGG + Intronic
1081605215 11:44523090-44523112 AGGCCAGGACACTAGAAAAGAGG + Intergenic
1083616979 11:64031138-64031160 AGACCAGGCCACTGGCACCGGGG - Intronic
1083713208 11:64561157-64561179 AGCCCAGGGCACTCGGGCAGGGG + Intronic
1083878252 11:65536015-65536037 AGCCCAGGACACCCGCAACCCGG - Exonic
1084548042 11:69824141-69824163 TGGCCAGGACACTTGGACAGTGG + Intergenic
1084673738 11:70622417-70622439 AGCCCAGGACACTCGCACAGAGG - Intronic
1084705448 11:70813632-70813654 AGCTCAGGTCTCTGGCACAGAGG + Intronic
1085278385 11:75314397-75314419 ACCCCAGGACACTGGAGCAGAGG + Intronic
1087664994 11:101034344-101034366 AGCTCAGGTCACAGGCACAGGGG - Exonic
1089333354 11:117705543-117705565 ATTCCAGGCCACTCCCACAGTGG - Intronic
1091400788 12:179443-179465 GCCCCAGGACACTCGCAGAGAGG + Intergenic
1092881672 12:12891857-12891879 AGCCTAGGAAACCCGCAAAGGGG - Intronic
1096021635 12:48330025-48330047 AGCCCAAGAAGCCCGCACAGCGG + Exonic
1101899772 12:108783001-108783023 AGCTCAGGACACTAACAGAGAGG + Exonic
1102063359 12:109952256-109952278 CCCCCAGGACACACCCACAGAGG - Intronic
1104859114 12:131915600-131915622 AGCACAGAAGACTGGCACAGAGG - Intronic
1104917974 12:132275909-132275931 ATCCCAGGCCACCCGCACAGTGG + Intronic
1105435649 13:20375881-20375903 AGCCCTGGACATTGGCACACAGG + Intergenic
1108777681 13:53785852-53785874 AGCCAAGGACACACACACAATGG + Intergenic
1110403080 13:75116525-75116547 AGCCCAGGACCCTGGTACACTGG + Intergenic
1112840638 13:103573342-103573364 AGCCCAGGACTCCCCCACACTGG + Intergenic
1119443504 14:74645704-74645726 GGCTCAGGACACAGGCACAGTGG - Intergenic
1123907089 15:24932026-24932048 AGACTATGACCCTCGCACAGAGG + Intronic
1126327803 15:47500622-47500644 AGCCCAGGTCCCTCTTACAGAGG + Intronic
1129312091 15:74720012-74720034 AGCCCAGGATACTGGCACAGAGG - Exonic
1130213222 15:81945310-81945332 AGCCCAGGAAACTAACACAATGG - Intergenic
1130386587 15:83417352-83417374 AGCCCAGGACAAAGGCCCAGCGG + Intergenic
1132425098 15:101709458-101709480 ACACCAGGACAGTCCCACAGAGG + Intronic
1133119044 16:3595188-3595210 AGCCCAGGACCCGCACAGAGGGG + Intronic
1133334962 16:5000988-5001010 AGCCCAGCACATATGCACAGTGG - Intronic
1133856524 16:9554633-9554655 AGCCCTAGAAACTAGCACAGTGG - Intergenic
1140188016 16:72791666-72791688 AGCCCAGGACCCTGGCAGAGGGG - Intronic
1141632610 16:85296684-85296706 AGCCCAGGTCGTTTGCACAGAGG - Intergenic
1142127799 16:88418939-88418961 AGCCCAGGAGAAAAGCACAGGGG - Intergenic
1142257427 16:89021074-89021096 AGCTCAGGGAACTCGCACAATGG + Intergenic
1143966733 17:10760943-10760965 AGCCCAGTTCCCTGGCACAGGGG + Intergenic
1144836392 17:18158664-18158686 AGCCCAGCACCCTCCCACTGTGG - Intronic
1145997571 17:29113423-29113445 TGCCCAGGACACTAGCACAAAGG + Intronic
1146885261 17:36466046-36466068 AGTCCAGGACACAGGCTCAGGGG - Intergenic
1147441522 17:40450377-40450399 AGCCCAGGACACTAACACCAGGG - Intronic
1151064416 17:71134010-71134032 AGTCCATGACACAGGCACAGTGG + Intergenic
1152418768 17:80180508-80180530 GGCCCAGGACAGTGACACAGAGG - Intronic
1152702086 17:81824204-81824226 AGCCCAGGACCCACGCTCCGAGG - Intronic
1152893956 17:82899161-82899183 AGCCGAGGACGCGCGCACTGCGG - Intronic
1152893965 17:82899284-82899306 AGCGGAGGACACACGCACTGAGG - Intronic
1153134524 18:1899430-1899452 AGCCCAGGAGACTGAAACAGAGG + Intergenic
1156356722 18:36348624-36348646 AGCCAAGGACCCTCCCACACAGG - Intronic
1158191246 18:54831327-54831349 AGCCCATGAACCTGGCACAGAGG + Intronic
1158390820 18:57043571-57043593 AGCCCAGGCCTCTTGCACAGGGG + Intergenic
1158750055 18:60248212-60248234 AACCCAGGGCACTCCCATAGGGG - Intergenic
1163186731 19:15644243-15644265 AGCCCAGAACACCAGGACAGGGG - Intronic
1163218074 19:15895300-15895322 AGCCCAGAACACCAGAACAGGGG + Intronic
1163302471 19:16456731-16456753 AGCCCAGGACTATGGCACAGGGG + Intronic
1163398317 19:17076663-17076685 AGACGAGGACACTGGCACAGAGG - Intronic
1163617442 19:18337970-18337992 ACCCCAGGTCACACGCTCAGTGG - Intergenic
1166799425 19:45447045-45447067 GGCCCAGGACACTTGCTTAGAGG + Intronic
925229686 2:2221946-2221968 AGGCCAGGACAATGGGACAGTGG + Intronic
927570892 2:24158815-24158837 AGCCCAGGAAACTAATACAGAGG - Intronic
943717718 2:191170484-191170506 ATTCCAGGACACTTACACAGTGG + Intergenic
946022680 2:216652094-216652116 AGCCCAAGAAACTCTCACTGTGG - Intronic
947228539 2:227863038-227863060 AGCCCTGGACACGTGCCCAGGGG - Intergenic
1168976337 20:1968824-1968846 AGCCCAGGAGAAACCCACAGGGG + Intergenic
1170316365 20:15045341-15045363 AGGTCAGAACACTCTCACAGAGG - Intronic
1171424288 20:25039946-25039968 AGCCCAGGACAAGAGCACACTGG + Intronic
1172300487 20:33846200-33846222 AGCCCAGGTAACTGGCAGAGAGG - Intronic
1172314192 20:33940842-33940864 TGCCCAGGACACCTGCAGAGAGG - Intergenic
1172361658 20:34316935-34316957 AGCCCTGCCCACTCACACAGAGG - Intergenic
1172715545 20:36960588-36960610 TGCCCAGGCCACTCTCACACTGG + Intergenic
1175845526 20:62056537-62056559 AGCACAGCACCCTGGCACAGGGG + Intronic
1179131699 21:38643383-38643405 ACCCCATGACACTCGCTCATAGG + Intronic
1179508676 21:41858299-41858321 AGCACAGGCCCCTCGGACAGAGG + Intronic
1181323483 22:22026238-22026260 TGCCCAGGACCCTGGAACAGAGG - Intergenic
1181436674 22:22915112-22915134 AGCCCAGGACAGACAGACAGTGG + Intergenic
1181850734 22:25748224-25748246 TCCCCAGGACAGTCACACAGTGG - Intronic
1183899844 22:40996775-40996797 AGGCCAGGAGGCTCCCACAGTGG + Intergenic
1184031713 22:41898962-41898984 AGAGCAGGACACTTGCACAGAGG - Intronic
1184972702 22:48037839-48037861 AGCCCAGGACACAGGTACAGAGG + Intergenic
1185275685 22:49949412-49949434 AGGCCAGGGCACGCGCCCAGGGG - Intergenic
950113798 3:10437675-10437697 AGCCCAGAACACTCTGACATGGG - Intronic
951635150 3:24766231-24766253 AGAGCAGAACACTCACACAGTGG - Intergenic
951656806 3:25018105-25018127 AGACTAAGACACTTGCACAGAGG + Intergenic
952342923 3:32460197-32460219 AGCACAGGGCAGTGGCACAGGGG - Intronic
953436286 3:42880622-42880644 AGCCCAGGGCACTCGGAGAAGGG + Intronic
955373946 3:58378342-58378364 ATCCCAGGGCACTCACCCAGAGG + Intronic
960022735 3:112973863-112973885 AAACCAGGACACCCCCACAGTGG + Intronic
961785513 3:129344532-129344554 AGCCCAGGACCCTCGCAGCTGGG + Intergenic
968655484 4:1776748-1776770 GGCCCAGGCCACCTGCACAGTGG - Intergenic
968884243 4:3318759-3318781 AGCCCCGCACACTCCCACACTGG - Intronic
969556943 4:7918317-7918339 AGCCCAGGTCACCCGCAAACAGG + Intronic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
972395799 4:38658647-38658669 ATCCAAGGACAGTGGCACAGTGG - Intergenic
976363013 4:84202617-84202639 AGACCAGGAGACTCCCTCAGGGG + Intergenic
979575969 4:122293260-122293282 AGTCCAGGACTCTCACACAGAGG + Intronic
985683874 5:1271563-1271585 AGCCAAGGAAATTCGCCCAGAGG + Intronic
986794340 5:11194159-11194181 AGCCCAGGATACACACAGAGGGG + Intronic
991958794 5:72021387-72021409 AGCCCAGGACCCTGACAAAGAGG - Intergenic
992410909 5:76504452-76504474 AGCCCAGGACTTTCGCACTTAGG - Intronic
996770729 5:127082660-127082682 AGACCAGGACACACGAACAGTGG - Intergenic
997198599 5:131995946-131995968 AGCCCAGGACACATGAAAAGGGG + Intronic
999302585 5:150500425-150500447 AGCCCAGAACATTGGCACAGGGG - Intronic
1000659175 5:163917439-163917461 AGACCGGGACAATGGCACAGAGG - Intergenic
1001458638 5:171888429-171888451 AGCCCATGACAGACGCAAAGTGG + Intronic
1001695492 5:173667022-173667044 AGCCCTGGACACTGGCAAGGAGG - Intergenic
1003577079 6:7307060-7307082 ACTCCAGGACACTGGCCCAGTGG + Intronic
1006451994 6:34110706-34110728 AGCCCAGCACCCCGGCACAGCGG - Intronic
1007936995 6:45741298-45741320 AGCCCAGGCCTCTAGAACAGGGG + Intergenic
1008855173 6:56075985-56076007 AGACCAGCACTCTCTCACAGAGG - Intronic
1011880859 6:92024323-92024345 AGACTAGGACACTGGAACAGGGG - Intergenic
1015772926 6:136787292-136787314 AGCCCAGCATCCTGGCACAGAGG + Intronic
1017952848 6:159151059-159151081 AGCCCAGGACAGGTGCAGAGGGG + Intergenic
1019791189 7:3014917-3014939 ATCCCAGGAAACTCATACAGAGG - Intronic
1020017207 7:4838098-4838120 AGCCCAGCAGCCTCGCACTGCGG - Intronic
1020746988 7:12090945-12090967 AGCCCAGGGCCCCCCCACAGTGG + Intergenic
1021482001 7:21128443-21128465 TCCCCAGCACACTTGCACAGGGG + Intergenic
1023833935 7:44057573-44057595 AGCCCAGGACACTGCCCCAAGGG - Intronic
1024030599 7:45456691-45456713 ATCCCAGGACCCTCGCAGCGGGG + Intergenic
1029648558 7:101874459-101874481 GGAGCAGGACACACGCACAGAGG + Intronic
1035105306 7:156437045-156437067 ACCCAATGACACTCGCCCAGTGG - Intergenic
1036191752 8:6677368-6677390 AACTCAGCACACACGCACAGGGG - Intergenic
1037387244 8:18356592-18356614 AGCCCAGGACACAGGCTCAGTGG - Intergenic
1038438963 8:27558559-27558581 AGCTCAGGACACACACACGGAGG - Intergenic
1040565612 8:48564448-48564470 TGCCCAGGACACAGGCACATGGG - Intergenic
1042190944 8:66186446-66186468 AGCCCAGGACTCTCTACCAGTGG + Intergenic
1049521736 8:143094930-143094952 AGCACAAGACGCTGGCACAGAGG - Intergenic
1049767363 8:144361090-144361112 AGCCCAGGAGGCCCGCACACCGG + Exonic
1056329565 9:85510497-85510519 AGCCCAGGAGACTCCAGCAGCGG - Intergenic
1057317113 9:93976665-93976687 AGATGAGGACACTTGCACAGAGG + Intergenic
1059386597 9:113969525-113969547 AGCACATGACACTAGCACATAGG - Intronic
1060115301 9:120935592-120935614 AGCCCTGGACACTGGCCAAGGGG + Intergenic
1061222082 9:129258178-129258200 AGCCCAGGACTCGCACCCAGAGG - Intergenic
1061715042 9:132513739-132513761 CCCCGAGGACCCTCGCACAGGGG - Intronic
1062094215 9:134694731-134694753 AGCCCAGGACTGTGACACAGGGG + Intronic
1187305758 X:18093888-18093910 AGCCCAGGACACTTGGTCAGTGG + Intergenic
1189921104 X:45904019-45904041 AGCCCATGACACAGGCACTGAGG + Intergenic
1190044394 X:47100663-47100685 AGCCCTGGAGACTTCCACAGAGG + Intergenic
1191673851 X:63774409-63774431 AACACAGGACACTGGCAGAGTGG - Intronic
1194163088 X:90479722-90479744 AGCCCAGGTCCATCTCACAGTGG - Intergenic
1199978665 X:152909010-152909032 AGCCCAGGCCACTGTCCCAGTGG + Intergenic
1200509361 Y:4057454-4057476 AGCCCAGGTCCATCTCACAGTGG - Intergenic