ID: 1084674852

View in Genome Browser
Species Human (GRCh38)
Location 11:70628369-70628391
Sequence CACCAAAGTCGGGGGCGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084674840_1084674852 16 Left 1084674840 11:70628330-70628352 CCAAATTCTGACGGGCGCAGCAG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1084674852 11:70628369-70628391 CACCAAAGTCGGGGGCGGAGAGG 0: 1
1: 0
2: 1
3: 9
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084674852 Original CRISPR CACCAAAGTCGGGGGCGGAG AGG Intronic
900405812 1:2492544-2492566 CACGAAGGTTGGGGGAGGAGCGG + Intronic
902621935 1:17655872-17655894 CTCCCAGGTCGGGGGCGGACAGG + Exonic
905046632 1:35008892-35008914 CTCCAAAGTCACGGGCAGAGAGG + Exonic
907094520 1:51765270-51765292 CACCTAAGTCAGGGGCTCAGAGG - Intronic
912003311 1:104860853-104860875 CACCTAAGTCAAGGGAGGAGAGG - Intergenic
917564291 1:176195878-176195900 TTCCAAAATCGGGGACGGAGGGG + Intronic
918544927 1:185671786-185671808 CAGCAAAGTGGGGGGAGGTGGGG - Intergenic
921199531 1:212791963-212791985 GGTCAAAGTCCGGGGCGGAGAGG - Exonic
1062974923 10:1675987-1676009 TACCAAAGTCGGGGGTGGGTGGG - Intronic
1063134655 10:3206177-3206199 GACCAAAGGCACGGGCGGAGAGG + Intergenic
1063134677 10:3206305-3206327 GACCAAAGGCATGGGCGGAGAGG + Intergenic
1065936100 10:30521743-30521765 CACCAAGGGCTGGGGAGGAGGGG + Intergenic
1068689206 10:59898802-59898824 AAACAAAGGCGGGGGCAGAGAGG + Intronic
1070117367 10:73541934-73541956 CAGCAAAGTGGGAGGAGGAGTGG - Intronic
1075421227 10:122302020-122302042 CTCCAAGGTCAGGGGTGGAGTGG + Intronic
1076991725 11:279256-279278 CGCCAGAGTCGGGGGCGGGCGGG + Intronic
1079390842 11:20020866-20020888 AACCAAAGTGGGGTGAGGAGGGG - Intronic
1084674852 11:70628369-70628391 CACCAAAGTCGGGGGCGGAGAGG + Intronic
1084810583 11:71608764-71608786 CGCCAAAGTCAGGGGTAGAGAGG - Intergenic
1085050167 11:73376320-73376342 CTCTGACGTCGGGGGCGGAGCGG + Exonic
1088474989 11:110226458-110226480 CACCAAGGACTGGGGAGGAGGGG + Intronic
1093372903 12:18386089-18386111 CACCAAAGCCAGAGGAGGAGGGG - Intronic
1093841296 12:23904913-23904935 CACCAAAGTCAGAGATGGAGGGG + Intronic
1094682885 12:32681597-32681619 CAAAAAAGGCGGGGGCGGGGGGG - Intronic
1104844962 12:131842000-131842022 CACCAGTGTCTGGGGCGCAGAGG - Intronic
1105920505 13:24958940-24958962 CAAAAAAGCCGGGGGCAGAGTGG + Intergenic
1106269319 13:28138582-28138604 CACCATAGACGGGGGAGGAAAGG - Exonic
1112630648 13:101158090-101158112 CTCCAAAGTTGGGGTCAGAGTGG + Intronic
1119865206 14:77967380-77967402 CACAAAAGTGGGGTGGGGAGTGG - Intergenic
1123909733 15:24955280-24955302 CACCACAGTTGGGGGCGGATGGG - Intronic
1125874643 15:43133505-43133527 CACCAATGACGGTGGCCGAGTGG - Exonic
1130108054 15:80943748-80943770 CAGCAAAGGCCGGGGCAGAGTGG - Intronic
1131138684 15:89959500-89959522 CACCTGAGTCTGGGGCGCAGCGG - Intergenic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1132941251 16:2509392-2509414 CCCCAAAGTCGAGGGCGGCAGGG - Intronic
1136470746 16:30478359-30478381 AAAGAAAGTGGGGGGCGGAGGGG + Intronic
1136553149 16:30992489-30992511 CACCCAAGGTGGGGGTGGAGGGG + Exonic
1141937938 16:87254487-87254509 CAAGAAAGTGGGAGGCGGAGAGG + Intronic
1151005131 17:70426853-70426875 AACCAAGGTCGGTGGGGGAGGGG - Intergenic
1152005892 17:77680950-77680972 CATTAAAGTCAGGGGCAGAGTGG - Intergenic
1153465414 18:5382571-5382593 CACCAAAGGAGGTGGCGGGGTGG - Intergenic
1155251759 18:23959495-23959517 CTCCAAAGTGGGGGGGGGGGTGG - Intergenic
1157133856 18:45034998-45035020 AAGCAAAGTTGGGGGCGGGGGGG - Intronic
1157410052 18:47455882-47455904 CAACTAAGTTGGGGGCAGAGTGG - Intergenic
1161591578 19:5131518-5131540 GACCAAAGCCCGGGCCGGAGAGG + Exonic
1163302706 19:16457854-16457876 CACCCAAGACTGGGGGGGAGGGG + Intronic
1165049865 19:33134578-33134600 CGCCAGAGGCGGGGGCGGTGCGG + Intronic
1166753772 19:45178353-45178375 CACCTGAGTCCGGGGCGGGGAGG - Intronic
926030858 2:9586728-9586750 CACCAAACTAGGGGGCTGGGAGG + Intronic
927945002 2:27130397-27130419 CACCACAGACGGGGGAGAAGGGG - Exonic
932419879 2:71595470-71595492 CACCAGGGTCGGGGACAGAGTGG - Intronic
932567157 2:72917451-72917473 CCCCAAGGTGGGGGGCGGGGCGG - Intronic
934723440 2:96598332-96598354 CACAGAAGTAGGGGGTGGAGGGG + Intronic
935883883 2:107594764-107594786 CCCCAAAATCGGGGGCGGAGGGG + Intergenic
937986047 2:127638595-127638617 CCCCAAGGTCGGGGGGAGAGGGG + Exonic
943649239 2:190438975-190438997 CACCAAAGTCAGGGACTGTGTGG + Intronic
1171385024 20:24764157-24764179 GACCAAAGTCAGGTGCGGGGTGG + Intergenic
1176963911 21:15190450-15190472 CAGCATAGTGTGGGGCGGAGGGG - Intergenic
1180131732 21:45830994-45831016 CTCCAGAGTGGGGGGCAGAGGGG - Intronic
1180335671 22:11574878-11574900 AAAGAAAGTCGGGGGCAGAGAGG - Intergenic
1180948427 22:19709391-19709413 CCCCACGGTAGGGGGCGGAGGGG - Intergenic
1182428172 22:30285804-30285826 CACCAAGGGCTGGGGCAGAGGGG - Intronic
1185039498 22:48497176-48497198 CACCGCAGGCGGGGGCGGAACGG - Intronic
952971196 3:38651279-38651301 CACTCAACTCGGGGCCGGAGAGG - Intergenic
957078244 3:75618283-75618305 CTCCAAAGTCAGGGGTAGAGAGG + Intergenic
966830586 3:184004673-184004695 CACAAAGGTCAGGGGCTGAGTGG + Intronic
968046226 3:195625065-195625087 CACCAAAGGCAGGGGCGGGGCGG + Intergenic
968308427 3:197665022-197665044 CACCAAAGGCAGGGGCGGGGCGG - Intergenic
969732548 4:8965160-8965182 CGCCAAAATCAGGGGTGGAGAGG - Intergenic
969792127 4:9499243-9499265 CGCCAAAGTCAGGGGAAGAGAGG - Intergenic
971029388 4:22620633-22620655 CGCCCAACTCGGGGGCGGGGGGG + Intergenic
971045733 4:22803105-22803127 CAGGAATGTCAGGGGCGGAGGGG - Intergenic
978833447 4:113117128-113117150 GACCTAGCTCGGGGGCGGAGTGG + Intronic
985747085 5:1653810-1653832 CACCAAAGGCAGGGGCGGGGCGG - Intergenic
986146027 5:5078767-5078789 CTCCCCAGTTGGGGGCGGAGTGG + Intergenic
988421861 5:31015550-31015572 CACCAAAGTAGTGGGGGGTGGGG + Intergenic
988641139 5:33041782-33041804 CACCAAAGTGGGGTGGAGAGAGG - Intergenic
990689644 5:58349163-58349185 CAAGAAAGTGGGGGGCGGGGGGG - Intergenic
995766659 5:115626185-115626207 GGCCAGAGTCGTGGGCGGAGAGG + Intronic
996403863 5:123088656-123088678 GAGAAAAGTTGGGGGCGGAGCGG - Intergenic
1005040330 6:21595134-21595156 CTCCAAAGTGGCGGGCGGCGCGG + Exonic
1006634531 6:35452508-35452530 CACCAGAGTAGGGGGCGGCGCGG + Exonic
1006742186 6:36317035-36317057 CTCCAAAGTCTGGAGAGGAGGGG + Exonic
1007431586 6:41780147-41780169 CACCAAAGTTGGGGGTGGTCCGG + Intronic
1010012809 6:71068954-71068976 CACCAAAGTCAGGAGGGAAGGGG - Intergenic
1013637526 6:112043423-112043445 CAAAATAGTCGGGGGCGGTGGGG - Intergenic
1018808815 6:167282380-167282402 CACCAAGGTCTGTGGGGGAGGGG + Intronic
1020308736 7:6854285-6854307 CACCAAAGTCAGGGGTAGAGAGG + Intergenic
1029650865 7:101890423-101890445 GACCCAAGGCGGGGGTGGAGGGG - Intronic
1037492062 8:19406031-19406053 CATCAAAGGCTGGGGCGGAGAGG - Exonic
1039212818 8:35235802-35235824 CACCGCAGGCGGCGGCGGAGGGG + Exonic
1048227608 8:132603849-132603871 TGCCAAAGGCGGGGGCGGAGTGG + Intronic
1048522371 8:135168788-135168810 CAGCAAAGTCAGGAGCAGAGTGG + Intergenic
1048553626 8:135456077-135456099 CACCTTAGCCGGGGGAGGAGTGG + Intergenic
1049084136 8:140464679-140464701 GACCAACGTCGGGGTGGGAGTGG - Intergenic
1049789079 8:144464875-144464897 CCCCCAAGCCGGGGGCCGAGTGG - Exonic
1050500521 9:6293528-6293550 CACCAAATATGGGGGCGGGGGGG + Intergenic
1052337983 9:27338862-27338884 CACCGGAGTCGGGGTGGGAGGGG - Intronic
1052829377 9:33202612-33202634 CACCAGAGGCGGGGAGGGAGGGG - Intergenic
1059198948 9:112396783-112396805 CTCCACAGTAGGGGGCGGGGTGG - Intronic
1060355824 9:122905872-122905894 GTCCAAAGTGGGGGGGGGAGGGG + Intergenic
1060428787 9:123529318-123529340 CACTACAGTCGGGGGAGAAGGGG - Intronic
1185750825 X:2608903-2608925 CAGCAAGGGCGGGCGCGGAGAGG + Intergenic
1186392326 X:9173414-9173436 CAACAGTGTCGGGGGCGGGGGGG + Intergenic
1194383607 X:93225036-93225058 CACCGCAGGCGGAGGCGGAGGGG + Intergenic
1194704602 X:97160085-97160107 CATAAAAGACGGGGGCGGGGCGG + Intronic
1194865122 X:99055505-99055527 CAACAAAGTGGGGGGTGGATGGG + Intergenic
1199862498 X:151814439-151814461 CACCAAAGGCGGGGGCAGGGGGG + Intergenic