ID: 1084676466

View in Genome Browser
Species Human (GRCh38)
Location 11:70638292-70638314
Sequence CAAGCTACTCCCAGTGACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084676460_1084676466 11 Left 1084676460 11:70638258-70638280 CCAGGATATGAAACCCAAAGCTG 0: 1
1: 0
2: 1
3: 15
4: 201
Right 1084676466 11:70638292-70638314 CAAGCTACTCCCAGTGACAGAGG 0: 1
1: 0
2: 1
3: 10
4: 149
1084676463_1084676466 -2 Left 1084676463 11:70638271-70638293 CCCAAAGCTGGCAATGGACCACA 0: 1
1: 0
2: 0
3: 7
4: 135
Right 1084676466 11:70638292-70638314 CAAGCTACTCCCAGTGACAGAGG 0: 1
1: 0
2: 1
3: 10
4: 149
1084676464_1084676466 -3 Left 1084676464 11:70638272-70638294 CCAAAGCTGGCAATGGACCACAA 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1084676466 11:70638292-70638314 CAAGCTACTCCCAGTGACAGAGG 0: 1
1: 0
2: 1
3: 10
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084676466 Original CRISPR CAAGCTACTCCCAGTGACAG AGG Intronic
900618281 1:3575326-3575348 CAAAGTCCTCCCAGGGACAGGGG + Intronic
901134697 1:6985295-6985317 CCAGCTCCTCCCATTCACAGTGG - Intronic
904807576 1:33142608-33142630 CAAGCTTCTCCCAGGGTCAGAGG - Intergenic
906127278 1:43434667-43434689 CAACCCACCCCCAGTAACAGTGG + Intronic
908434667 1:64093309-64093331 CGAGCTACCCCCAGAGCCAGAGG - Intronic
908622544 1:66000546-66000568 CAAATTACTACCAGTGACAGAGG - Intronic
908769426 1:67582837-67582859 CAAGGTTCTCCCAGTGAGAGGGG - Intergenic
909270542 1:73617975-73617997 CAAACTAGGCCCAGAGACAGTGG - Intergenic
912091032 1:106076702-106076724 CAAGCTACTCCGAGAGGCCGAGG + Intergenic
915153598 1:153855795-153855817 CCAGCTACTCCCAGTCCCAGAGG - Intronic
916871957 1:168925078-168925100 GAAGCTACTTCCATTGAGAGAGG - Intergenic
917289199 1:173454759-173454781 CAAGATACTCCCACTGGCAAGGG + Intergenic
918787849 1:188787972-188787994 CAAGCTAATCCCAAAGCCAGTGG - Intergenic
918863286 1:189860594-189860616 CCCACTACTCCCAGTGACTGGGG - Intergenic
920558988 1:206925551-206925573 CAAGCTCCACCCAGTGGCGGTGG - Intergenic
1065847899 10:29761332-29761354 GGAGCTTTTCCCAGTGACAGAGG + Intergenic
1066039288 10:31530020-31530042 GTAGCTGCTCTCAGTGACAGGGG - Intergenic
1066383867 10:34925283-34925305 AAAACTACTGCCAGTTACAGTGG + Intergenic
1069242043 10:66154584-66154606 AAAACTACTCACAATGACAGTGG + Intronic
1069765558 10:70855045-70855067 CAAGCAAATCTCAGAGACAGTGG + Intronic
1074048351 10:109860043-109860065 CAAACTGCTCCCAGTGTTAGTGG + Intergenic
1074640852 10:115378547-115378569 CAAGCTTCTCACAGTGGCAGAGG + Intronic
1074792872 10:116909480-116909502 AAAGCCACTCTAAGTGACAGTGG - Intronic
1075451227 10:122553119-122553141 CCAGCTACTCCCACTGACCCTGG - Intergenic
1079533690 11:21485630-21485652 TAAGCTGCTCCCACTGAGAGTGG + Intronic
1081930694 11:46868801-46868823 TACCCTACTCCCAGGGACAGGGG + Intronic
1084273558 11:68040972-68040994 CCAGCGTCTCCCAGTGACACCGG - Intronic
1084676466 11:70638292-70638314 CAAGCTACTCCCAGTGACAGAGG + Intronic
1086406721 11:86505044-86505066 CCAACTTCTCCCAGTGACTGTGG + Intronic
1087940967 11:104096542-104096564 CAAGGCACTCAGAGTGACAGAGG + Intronic
1088974045 11:114798980-114799002 AAAGCTACTTCTAGTGAGAGCGG - Intergenic
1089011654 11:115136562-115136584 CAAGCCACTCCCTGAGACACTGG + Intergenic
1090332042 11:125939946-125939968 GCAGCTACTCCCATTCACAGGGG - Intergenic
1094529662 12:31262136-31262158 CAAGCTACTGGCAGGGACATGGG + Intergenic
1100211485 12:92403012-92403034 CAAAGTCCTCTCAGTGACAGGGG + Intergenic
1101373989 12:104155035-104155057 CAAGCTAATCCCTGTGGCTGGGG - Intergenic
1105421706 13:20258257-20258279 GAAGCTTCTCCCAGTGGGAGTGG + Intergenic
1106504826 13:30361853-30361875 CAAGGTTCTCCCAGTGACCAAGG - Intergenic
1110769183 13:79317786-79317808 CAAAATGCTCCCAGTGACTGAGG + Intronic
1116604162 14:46968264-46968286 TAAGCTGCTCCCACTGACAGTGG + Intronic
1116855192 14:49945938-49945960 CAACCTTCTCCCAGTCACTGTGG + Intergenic
1118287336 14:64487764-64487786 GAAGCTCCTTCCAGTAACAGTGG - Exonic
1120465838 14:84856077-84856099 CCAGCTTCTGGCAGTGACAGGGG - Intergenic
1120562929 14:86018776-86018798 CTCCCTACTCCCAGTGGCAGTGG - Intergenic
1121658404 14:95615783-95615805 CATGCTATTCCCATTGACTGTGG + Intergenic
1128155870 15:65391690-65391712 CAAGCTTCTCTCCATGACAGAGG + Intronic
1133230798 16:4365631-4365653 CAAGCGGCTCCCAGTCACTGTGG - Intronic
1133661664 16:7924262-7924284 TAAGCTCCTCCCACTGCCAGGGG + Intergenic
1136031869 16:27509231-27509253 CAAGCTACACACAGCAACAGCGG - Intronic
1137692760 16:50440994-50441016 CAAGCTCCTCCCAGCACCAGGGG - Intergenic
1142271584 16:89092530-89092552 CAAGCCTGTCCCAGTGGCAGAGG + Intronic
1142856931 17:2736043-2736065 CAGGCTCCTCCAAGTGGCAGAGG + Intergenic
1143270713 17:5672693-5672715 CAAGCTCTTCCTGGTGACAGGGG + Intergenic
1144620134 17:16813376-16813398 CAAGCAACACTCAGTTACAGAGG - Intergenic
1144892551 17:18502323-18502345 CAAGCAACACTCAGTTACAGAGG + Intergenic
1145139663 17:20441964-20441986 CAAGCAACACTCAGTTACAGAGG - Intergenic
1147685304 17:42283547-42283569 CATGCTATTCCCAGAAACAGAGG + Intergenic
1148900644 17:50873516-50873538 CAAGTTAATCACAGGGACAGGGG + Intergenic
1157475174 18:48019514-48019536 CAAGCCCCTCCCTGTGACACTGG - Intergenic
1162512129 19:11125712-11125734 CTAGCTACTCCCAGAGGCTGAGG + Intronic
1164821284 19:31253171-31253193 CAAGGTGTTCCCAGGGACAGGGG + Intergenic
1166384162 19:42370888-42370910 AGAGCTACTCCCAGTGAGAAGGG - Intronic
1166538199 19:43589136-43589158 CAAGTAACACACAGTGACAGTGG + Exonic
1168426876 19:56246005-56246027 CATGCTCCTTCCAGTGTCAGGGG + Intronic
926144516 2:10388519-10388541 CAGTCTTCTCCCAGTGACAGGGG - Intronic
926746230 2:16160686-16160708 CAAGGAATTCCCAGTGCCAGGGG + Intergenic
927199140 2:20567759-20567781 TCAGCTACTCCCAGGGACTGGGG - Intronic
928895779 2:36261342-36261364 CAAGCTACTCCTGCTGACTGTGG + Intergenic
930801110 2:55443282-55443304 CAAACTACTCCGAGCTACAGGGG + Intergenic
931512435 2:63015279-63015301 CAAGTTACTCCCATTAACACAGG - Intronic
932659747 2:73641814-73641836 CTACCTTCTCCCAGTGGCAGAGG - Intronic
932666315 2:73701492-73701514 CTACCTTCTCCCAGTGGCAGAGG - Intergenic
932668586 2:73717892-73717914 CTACCTTCTCCCAGTGGCAGAGG - Intergenic
932748575 2:74356147-74356169 ATTGCTACTCCCAGGGACAGAGG - Intronic
938316194 2:130330576-130330598 CACTCTAGTCCAAGTGACAGAGG + Intergenic
939004184 2:136766310-136766332 CTAGCCACTCGCAGGGACAGGGG - Intronic
939932310 2:148250825-148250847 CAGGCTCCTCCGAGTGACATTGG - Intronic
942116211 2:172731570-172731592 CAAGCTATATCCAGTGGCAGGGG + Intergenic
942219638 2:173756619-173756641 CAAGCTGGTCACAGTGACATAGG + Intergenic
946210395 2:218143120-218143142 CAATCTCCTACCAGTGAAAGAGG + Intergenic
947164169 2:227244826-227244848 CGAGCTATTCCCAGTTATAGTGG + Intronic
1169717280 20:8634348-8634370 CAAGATACTCACAGCTACAGAGG - Intronic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1173984198 20:47248473-47248495 CAAGCTCCTCTGAGTGTCAGTGG - Intronic
1174026250 20:47578761-47578783 CTAGCTTTTCCCAGTGACAGTGG + Intronic
1175153061 20:56950375-56950397 CTAGCAACTCCCAGGAACAGAGG + Intergenic
1175459254 20:59138820-59138842 CAAGCCACTCCAAGTCCCAGTGG - Intergenic
1176428439 21:6562513-6562535 CCAGCCCCTCCCGGTGACAGAGG + Intergenic
1177749038 21:25256960-25256982 CATGCTACACTCAGGGACAGGGG - Intergenic
1179678661 21:43002329-43002351 GAAGCTGCTCCCATTGACTGTGG + Intronic
1179703929 21:43170829-43170851 CCAGCCCCTCCCGGTGACAGAGG + Intronic
1183459356 22:37940630-37940652 CAGGCTAGACCCAGTGACACAGG - Intronic
1184480426 22:44743499-44743521 CAAGCATCTCCCAATCACAGGGG - Intronic
1184709272 22:46238867-46238889 CAAGATGCTTCCAGTTACAGCGG + Exonic
949360740 3:3229592-3229614 CGACCTAGTCCCTGTGACAGTGG + Intergenic
950031451 3:9856634-9856656 CAAGCTGCTACCAGGGTCAGTGG + Intergenic
954626982 3:52027705-52027727 CCAGCCACTGCCAGTGACATTGG - Intergenic
955679151 3:61482069-61482091 CCAGCTACTCCCAGAGGCTGAGG + Intergenic
957265709 3:77962529-77962551 CCAGCTACTCCCAGCTACTGGGG - Intergenic
958729776 3:97949334-97949356 CAGGCTACTCACAGTGGAAGGGG - Intronic
958967931 3:100579711-100579733 CAAGCTGCTTCCACTCACAGCGG - Intergenic
960480274 3:118179503-118179525 CAAGCTACTCAATGTGACAAAGG + Intergenic
961447158 3:126986235-126986257 CAGGCTCCTCACAGTGGCAGTGG - Intergenic
964344146 3:155738899-155738921 CAAGATCGTGCCAGTGACAGAGG + Intronic
964476724 3:157104247-157104269 CAAGCCCCTCCCAGAGCCAGGGG + Intergenic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
968629511 4:1642741-1642763 AAGGCTGCTCCCAGTGGCAGTGG - Intronic
968632561 4:1659562-1659584 GCAGCTACTCCCAGTGGCACTGG + Intronic
970303062 4:14702107-14702129 CAAGCCCCTCCCAGGGCCAGTGG - Intergenic
971946131 4:33279814-33279836 AAAGCTACTTCTAATGACAGTGG + Intergenic
986125032 5:4876643-4876665 CAAGCCTGTCCCAGTCACAGAGG + Intergenic
986774236 5:10999250-10999272 CAAGCCATTCTGAGTGACAGTGG - Intronic
986885133 5:12225466-12225488 CAACATAGTCCCAGTGGCAGTGG - Intergenic
987424127 5:17754553-17754575 CAAACTACTCCGAGCTACAGGGG - Intergenic
988492657 5:31717874-31717896 CAGGCTCCTTCCAGAGACAGTGG - Intronic
990951898 5:61306641-61306663 CATGCTAATACCAGGGACAGGGG - Intergenic
991019298 5:61963403-61963425 CAAGCTACTTCCACTGATAAGGG - Intergenic
993499421 5:88648377-88648399 CCAGCTACTCCCAGCAACTGAGG + Intergenic
993544902 5:89200051-89200073 CAAGCTAAGCTCAGTGACACTGG - Intergenic
993740378 5:91531341-91531363 CAAGCTCCTTTCAGTTACAGGGG - Intergenic
994821160 5:104652733-104652755 TATGCTACTCCCACTGAAAGTGG + Intergenic
995699642 5:114919900-114919922 CAAACTACTCCGAGCTACAGGGG + Intergenic
996514713 5:124357062-124357084 CAAGTTAGGCCCAGTGCCAGAGG - Intergenic
996515787 5:124367849-124367871 CAAGATACTCTCAGAGGCAGTGG - Intergenic
996875670 5:128237967-128237989 CAACCTGCTCCCAATGAAAGAGG - Intergenic
1000743982 5:165007532-165007554 AAAGCTCGTCTCAGTGACAGTGG - Intergenic
1002716402 5:181230903-181230925 CAAGTCACTCCCTGTGAGAGTGG - Intronic
1008309594 6:49950237-49950259 CCAGCTACTCCCAGAGGCTGAGG + Intergenic
1010800091 6:80165281-80165303 CAAGCTACTCACAGTCAAATAGG + Intronic
1011937250 6:92795881-92795903 CAAGATACACCCAGTGCTAGCGG - Intergenic
1016294560 6:142561135-142561157 CAAGCTGCTCTCAGAGACATGGG + Intergenic
1016877593 6:148879240-148879262 CACAGAACTCCCAGTGACAGGGG - Intronic
1018320975 6:162608270-162608292 CAAAACAGTCCCAGTGACAGGGG + Intronic
1019502879 7:1373958-1373980 CAAGAAACTCACAGTCACAGTGG + Intergenic
1022902954 7:34828312-34828334 TGAGCTCCTCCCAGTGACTGGGG + Intronic
1023592003 7:41790573-41790595 CAAAATACTCCCAGATACAGGGG + Intergenic
1026253689 7:68692458-68692480 CAAGCTTCTCCCAGTGCCCAAGG + Intergenic
1028851582 7:95543696-95543718 CAAGTTACTCTAACTGACAGTGG - Intergenic
1031833961 7:126659266-126659288 CAAGCTATTACAAGTGGCAGGGG + Intronic
1032721070 7:134551268-134551290 CCCGCTCCTCCCACTGACAGAGG + Intronic
1033486403 7:141793151-141793173 CACACAACTCACAGTGACAGTGG - Intergenic
1035170497 7:157014880-157014902 TAAGCTACTTCCTGTGCCAGGGG - Intergenic
1035192053 7:157178607-157178629 CAAGTTACTCTCAGTGACAATGG - Intronic
1037987094 8:23296764-23296786 CCAGCAATTCCCAGTGGCAGTGG - Intergenic
1039838305 8:41275474-41275496 CAAGCTAGTCACAGTGAGACTGG + Intronic
1046493006 8:114977559-114977581 CCTGCTATTCCCAGGGACAGTGG + Intergenic
1048477647 8:134757543-134757565 CAATTCACTGCCAGTGACAGCGG - Intergenic
1049170614 8:141158544-141158566 CAAGCTAATCCCTGTGCCATGGG + Intronic
1050202096 9:3156684-3156706 CAAGCTACTCCCCGTGTCGCAGG - Intergenic
1053141902 9:35687849-35687871 CAAGCTCTTCCCAGTTACGGGGG + Intronic
1055931329 9:81562571-81562593 CAAGCCACTCCCAGGGACAGAGG - Intergenic
1056168329 9:83959335-83959357 CCAGCTACTCCCAGAGGCTGAGG + Intergenic
1056469017 9:86886953-86886975 CAAGCTACTCCAGCTGACCGGGG + Intergenic
1059152759 9:111964234-111964256 CAAGACACACCCAGTGGCAGAGG + Intergenic
1193872295 X:86814795-86814817 CAAGCCACCACTAGTGACAGTGG + Exonic
1195325343 X:103753679-103753701 GAAGCAACTCACAGTAACAGAGG + Intergenic
1198872403 X:141189316-141189338 CAAACTACTCCAAATGACAGAGG - Intergenic
1202270028 Y:23062449-23062471 CATGCTAAGCCCACTGACAGTGG + Intergenic
1202295999 Y:23358233-23358255 CATGCTAAGCCCACTGACAGTGG - Intergenic
1202423022 Y:24696194-24696216 CATGCTAAGCCCACTGACAGTGG + Intergenic
1202447767 Y:24973892-24973914 CATGCTAAGCCCACTGACAGTGG - Intergenic