ID: 1084676866

View in Genome Browser
Species Human (GRCh38)
Location 11:70640422-70640444
Sequence TGCTCCCCATGGTGGCTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 329}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084676866_1084676872 -10 Left 1084676866 11:70640422-70640444 CCCTAGAGCCACCATGGGGAGCA 0: 1
1: 0
2: 2
3: 48
4: 329
Right 1084676872 11:70640435-70640457 ATGGGGAGCAGGGCCCTGCCAGG 0: 1
1: 0
2: 7
3: 44
4: 445
1084676866_1084676877 11 Left 1084676866 11:70640422-70640444 CCCTAGAGCCACCATGGGGAGCA 0: 1
1: 0
2: 2
3: 48
4: 329
Right 1084676877 11:70640456-70640478 GGCCCTGGATTTCAAACCTGTGG 0: 1
1: 0
2: 0
3: 13
4: 185
1084676866_1084676873 -4 Left 1084676866 11:70640422-70640444 CCCTAGAGCCACCATGGGGAGCA 0: 1
1: 0
2: 2
3: 48
4: 329
Right 1084676873 11:70640441-70640463 AGCAGGGCCCTGCCAGGCCCTGG 0: 1
1: 2
2: 7
3: 88
4: 773

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084676866 Original CRISPR TGCTCCCCATGGTGGCTCTA GGG (reversed) Intronic
900606689 1:3526784-3526806 TTCTCCCCATGGTGACTCTTTGG - Intronic
900607123 1:3528792-3528814 TGCTCCTTCTGGAGGCTCTAGGG - Intronic
900987640 1:6082485-6082507 TGGTCCCCCTGGTGGCTCCACGG - Intronic
901102375 1:6728725-6728747 TGCTTTCCCTGGTGGCTGTAAGG - Intergenic
901424290 1:9171590-9171612 TACTCCCACTGGAGGCTCTAGGG - Intergenic
902457476 1:16545578-16545600 TCCTCTCCATAGTGGCTCAACGG + Intergenic
902474916 1:16677921-16677943 TCCTCTCCATAGTGGCTCAACGG + Intergenic
902494689 1:16862330-16862352 TCCTCTCCATAGTGGCTCAACGG - Intronic
905703031 1:40033159-40033181 TGCTCCTTCTGGAGGCTCTAGGG + Intergenic
908382915 1:63613408-63613430 TGCTCCCTCTGAAGGCTCTAGGG + Intronic
911507008 1:98765921-98765943 TGCTCTCCCTGATGGTTCTAGGG + Intergenic
912194240 1:107378750-107378772 TGCTTCCAAGGGTGGCTCTAGGG - Intronic
912420451 1:109539139-109539161 TGGTTCCCATGGTGGCTCGGGGG + Intergenic
913210819 1:116580901-116580923 TGCTCCCCATGAAGGCTCTAGGG - Intronic
913239375 1:116816595-116816617 TGCACCCTACGGTGGCTCTGTGG + Intergenic
914995072 1:152536310-152536332 TGCTGCTGATGGTGGCCCTAAGG - Intronic
915491630 1:156253143-156253165 TGGTGCTCAAGGTGGCTCTATGG + Intronic
916374168 1:164133833-164133855 TGCTCCCTCTGGAGGCTCTAAGG - Intergenic
916801865 1:168223423-168223445 TGCTCCCTCTGGAGGCTCTAGGG + Intergenic
918707708 1:187688885-187688907 TGCTTCCTCTGGAGGCTCTAGGG + Intergenic
919508309 1:198428192-198428214 TGCTCCCTGTGAAGGCTCTAGGG - Intergenic
920195998 1:204227831-204227853 TACTCCCTAAGGTGGCTGTAAGG + Intronic
922548801 1:226478677-226478699 GTCTCCCTATGCTGGCTCTAAGG + Intergenic
922778119 1:228226796-228226818 TGCTCCCTCAGGAGGCTCTAGGG - Intronic
922946029 1:229514854-229514876 TCCTCCCCCTTGTGGCTGTAGGG + Intergenic
923084996 1:230696517-230696539 TGCTCCCCCTGAAGGCTCTAGGG + Intergenic
923970657 1:239199874-239199896 GGCTGGGCATGGTGGCTCTAAGG + Intergenic
1062844264 10:691638-691660 TGCTCCCCTTTCTGTCTCTAAGG - Intergenic
1063305248 10:4892717-4892739 TGCTCCCCATGAAAGCTCTCGGG - Intergenic
1065971331 10:30808301-30808323 TGGTCCCCAGGGTGGCTGTCAGG + Intergenic
1066206078 10:33190615-33190637 TTCTCCCCATCTTGGCTCTTTGG - Intronic
1066758804 10:38736370-38736392 TGTCCCCCATGGTGTCTCCAGGG - Intergenic
1067396618 10:45925777-45925799 CGCTCCCTATGAAGGCTCTAAGG + Intergenic
1067864933 10:49894880-49894902 CGCTCCCTATGAAGGCTCTAAGG + Intronic
1068345301 10:55770102-55770124 TACTTCCTCTGGTGGCTCTAGGG - Intergenic
1069620201 10:69832776-69832798 TGCTCCGCATGGTGGCTGGATGG - Intronic
1070904020 10:80055872-80055894 TGCTCCTCACTGTGGGTCTATGG - Intergenic
1071421698 10:85506487-85506509 TGCTCCTTCTGGAGGCTCTAGGG - Intergenic
1074733607 10:116403919-116403941 TGCTCCTCCTGGAGGCTCCAAGG + Intergenic
1074927780 10:118091434-118091456 CGCTCCCTCTGGAGGCTCTAGGG + Intergenic
1076444312 10:130501495-130501517 TGCTCCCTCTGGAGGCTCTAGGG + Intergenic
1077232738 11:1465361-1465383 TGCTCCTCCTGGAGGCTCCAGGG + Intergenic
1077586945 11:3461046-3461068 TGCTCCCTCTGAAGGCTCTAGGG + Intergenic
1080472381 11:32558902-32558924 TGCTCTCTCTGGGGGCTCTAAGG + Intergenic
1081027907 11:38038218-38038240 TGCTCCCTTTGTAGGCTCTAGGG - Intergenic
1081869027 11:46374953-46374975 TGCTCCCCAGGGTGGCCCCAGGG - Exonic
1083283045 11:61639221-61639243 TGCTCCCCATATTGGCCTTATGG + Intergenic
1083287810 11:61671742-61671764 TGCTCCCTCTGGAGGCTCTAGGG + Intergenic
1084101419 11:66952081-66952103 TGCTCTCCATGCTGACTCAAGGG + Intronic
1084242944 11:67835078-67835100 TGCTCCCTCTGAAGGCTCTAGGG + Intergenic
1084309122 11:68305976-68305998 TGCTCCGTCTGGAGGCTCTAGGG + Intergenic
1084434706 11:69132074-69132096 GGTTCCCCATGGGGGCTCTGGGG - Intergenic
1084676866 11:70640422-70640444 TGCTCCCCATGGTGGCTCTAGGG - Intronic
1084727729 11:70952940-70952962 TGTTCCCCAGGAAGGCTCTAGGG + Intronic
1084764792 11:71301336-71301358 TGCTTCCTCTGGAGGCTCTAGGG + Intergenic
1088323923 11:108582733-108582755 TGCTCCCTCTGGGGGCACTAAGG + Intronic
1089110784 11:116054268-116054290 AGCTCCCCAGAGTGGCTCAAGGG - Intergenic
1089270620 11:117299456-117299478 TGCTCTCCGTGGTGCCTCTGTGG + Intronic
1089315328 11:117587430-117587452 TGACCCCCATGGTGGGTCTGGGG + Intronic
1089966629 11:122658946-122658968 TGCTCCCTCTGGAGGCTCTAGGG + Intronic
1090450140 11:126798742-126798764 TGCTCCGTATGGTTTCTCTAAGG - Intronic
1091033216 11:132210187-132210209 TGCACAGCATGGTGGCTCTGAGG + Intronic
1091341526 11:134819221-134819243 TGCTCCCTCTGCAGGCTCTACGG - Intergenic
1092413184 12:8269791-8269813 TGCTCCCTCTGAAGGCTCTAGGG + Intergenic
1094241889 12:28237620-28237642 GGCTCCCTCTGGAGGCTCTAGGG - Intronic
1094642763 12:32292155-32292177 TGCTCCCTCTGGCAGCTCTAGGG + Intronic
1095922499 12:47544748-47544770 GGCTTCCCAAGGTGGCTCTGTGG - Intergenic
1096883271 12:54690214-54690236 TGCTCCCTCTGGAGGCTCTAGGG - Intergenic
1097589807 12:61560858-61560880 TGATCCCCCTGTAGGCTCTAGGG - Intergenic
1097993046 12:65856688-65856710 TGCTCTCCCTGAAGGCTCTAGGG + Exonic
1098084978 12:66832983-66833005 TGTTCCTCCTGGTGGCTCTTTGG + Intergenic
1100751127 12:97699185-97699207 TGTTCCCTTTGGAGGCTCTAGGG + Intergenic
1100771851 12:97932105-97932127 TGCTCCCACTGAAGGCTCTAGGG + Intergenic
1101287125 12:103326368-103326390 GGATCCCCCTGGTGGCTCTATGG - Intronic
1101319760 12:103663346-103663368 TGCTCCCTCTGAAGGCTCTAGGG + Intronic
1102687954 12:114738947-114738969 TCCTCCCCAAGGTCGCTCTGGGG + Intergenic
1103706768 12:122879092-122879114 TGTTCCCTCTGGAGGCTCTAGGG - Intronic
1103962866 12:124620327-124620349 TTCTCCTCATGGTGGCACCATGG - Intergenic
1103967249 12:124647647-124647669 TGCTCCCTCTGGAAGCTCTAGGG + Intergenic
1104056068 12:125231072-125231094 TGCTCCCTCCGGAGGCTCTAGGG + Intronic
1104493660 12:129216569-129216591 TGCTCCCTCTGGAGGCTCTAGGG - Intronic
1105236259 13:18556075-18556097 CTCTCCCCATGCTGGCTCTAGGG + Intergenic
1105418530 13:20232743-20232765 TGCTCCCCACGGGTGCACTAGGG - Intergenic
1106404659 13:29463209-29463231 TGCTCCCTTTGGTGGCTCCCAGG - Intronic
1106908650 13:34438791-34438813 TGCTCCCACTGAGGGCTCTATGG + Intergenic
1107040552 13:35943296-35943318 TGCTCCCTCTGAAGGCTCTAGGG - Intronic
1107787409 13:43970041-43970063 TGCTCCCCAGGGTGGCCGCAGGG - Intergenic
1110816215 13:79862694-79862716 TGCTTCCCAGGGTGGCTATAAGG + Intergenic
1111032960 13:82631892-82631914 CACTCCCCATGGAGGCTCTTGGG + Intergenic
1112086755 13:96040275-96040297 TGCTCCCTCTGAAGGCTCTAAGG + Intronic
1113502599 13:110788932-110788954 TGCTCCCTCTGAAGGCTCTAGGG + Intergenic
1115063881 14:29230181-29230203 TGCTACCTATGTTGGCTCTCTGG - Intergenic
1115480455 14:33856086-33856108 TGCTCCCACTTGAGGCTCTAAGG - Intergenic
1115882261 14:37932868-37932890 TGCTCCCCATGAAGGGTCTTGGG - Intronic
1116790053 14:49330253-49330275 TGCTCCCAATGCTCACTCTAGGG - Intergenic
1117291804 14:54341817-54341839 TGCTCCTTCTGGAGGCTCTAGGG - Intergenic
1118442819 14:65827586-65827608 TTCTTCCCAGGGTGGCTCTCTGG + Intergenic
1119914799 14:78387900-78387922 TGGACCACATGGTGGCTCTGTGG + Intronic
1121553008 14:94816290-94816312 GGCTCCCTCTGGAGGCTCTAGGG - Intergenic
1122215278 14:100199598-100199620 TGCTGCCCAGGTTGGGTCTAGGG + Intergenic
1122235265 14:100327654-100327676 AGCTCCCCATGGTGGCTTCTAGG - Intronic
1123630062 15:22255019-22255041 TGTTCCCCCTGGAGGCTCTAGGG + Intergenic
1126218596 15:46185973-46185995 TGTTCCACATGGTTCCTCTAAGG + Intergenic
1126329486 15:47516578-47516600 TCCTCCCCATTGTTGCCCTATGG + Intronic
1126817233 15:52466064-52466086 TGCTCCGCATGTTAGATCTAGGG - Intronic
1126910727 15:53414682-53414704 TGCTCCCTCCGGAGGCTCTAGGG + Intergenic
1127681664 15:61303803-61303825 TGCTCCCTCTGCAGGCTCTAGGG + Intergenic
1128132400 15:65237663-65237685 TACTCCCTCTGGAGGCTCTAGGG - Intronic
1128355154 15:66921181-66921203 TGCTCCCTCTGAAGGCTCTAGGG - Intergenic
1128633510 15:69288146-69288168 TGTTCCTCTTGGAGGCTCTAGGG + Intergenic
1128959071 15:71981388-71981410 TGCAAGCCATGGTGGCTCCACGG - Intronic
1132696306 16:1203636-1203658 TGCTTCCTCTGGAGGCTCTAGGG + Intronic
1132876822 16:2143631-2143653 TGCTCACCATGGTGGCCCTGAGG - Intronic
1133354388 16:5125288-5125310 TGCTCCCTCTGAAGGCTCTAGGG + Intergenic
1133816202 16:9199135-9199157 TGCTCCCCTTGGCAGCTCTGTGG + Intergenic
1134224979 16:12382714-12382736 TGTTCCCCCTGGAGGCTCTAGGG + Intronic
1137247160 16:46715066-46715088 TTCTGCCCATCGTGTCTCTATGG - Intronic
1137384858 16:48031890-48031912 TGCTGCCCCTGGTGCCTCTCTGG + Intergenic
1138193612 16:55036251-55036273 TGCTCCACTTGGTGACTCAAAGG - Intergenic
1138276190 16:55736669-55736691 TGCTCCCCAAAATGGCACTATGG + Intergenic
1139001639 16:62518129-62518151 TACTCCACATGGAGGCTGTAGGG - Intergenic
1140644811 16:77017960-77017982 TGCTCCCTCTGAAGGCTCTAGGG - Intergenic
1141086624 16:81100308-81100330 TGCTCCCTCTGAGGGCTCTAGGG - Intergenic
1141192660 16:81835775-81835797 TGCTCCCGCTGGAGGCTCTAGGG + Intronic
1141222095 16:82080518-82080540 TGCTCCTTCTGGAGGCTCTAGGG - Intronic
1141437635 16:84009453-84009475 TGCTCCCTCTGTGGGCTCTAGGG - Intergenic
1141518161 16:84560037-84560059 TGCTCCCTCTGGAAGCTCTAGGG + Intergenic
1141671464 16:85494213-85494235 TGCTCCCTGTGCAGGCTCTAGGG + Intergenic
1141674736 16:85511812-85511834 TGCTCCCTCTGGAGGCTCTAGGG - Intergenic
1141896463 16:86961815-86961837 TGCTTCCTGCGGTGGCTCTAAGG + Intergenic
1141973027 16:87495638-87495660 TGTTCCCTCTGGAGGCTCTAGGG - Intergenic
1142191149 16:88718534-88718556 TGCTCAGCATGGTGTCTCTGAGG - Intronic
1142280589 16:89145732-89145754 GGCTCCCCACGGTGGATCTGGGG - Intronic
1142331140 16:89454736-89454758 TGCTCCCCTGGGTGCTTCTAGGG + Intronic
1142331148 16:89454769-89454791 TGCTCCCCTGGGTGCTTCTAGGG + Intronic
1142331165 16:89454835-89454857 TGCTCCCCTGGGTGTTTCTAGGG + Intronic
1142331173 16:89454868-89454890 TGCTCCCCTGGGTGCTTCTAGGG + Intronic
1142331195 16:89454967-89454989 TGCTCCCCTGGGTGCTTCTAGGG + Intronic
1142331217 16:89455066-89455088 TGCTCCCCTGGGTGCTTCTAGGG + Intronic
1142331225 16:89455099-89455121 TGCTCCCCTGGGTGCTTCTAGGG + Intronic
1143889629 17:10092722-10092744 CGCCCCCCTTGGAGGCTCTAGGG + Intronic
1146537639 17:33666769-33666791 TGCTCCCCAGCATGGTTCTAGGG + Intronic
1146542149 17:33705687-33705709 TTCTCCCCATAGAGGTTCTAAGG - Intronic
1147458961 17:40556588-40556610 TGCTTCCCATGGTTGCTGTGAGG + Intronic
1147548404 17:41420880-41420902 ATCTCCCCATGCTGGCTCCATGG + Exonic
1148252005 17:46090239-46090261 TGGTCTCTATGGAGGCTCTAGGG - Intronic
1148368605 17:47076026-47076048 TGCTCTCTCTGGAGGCTCTAGGG - Intergenic
1148572294 17:48679813-48679835 TGCTCTCCCATGTGGCTCTAGGG + Intergenic
1149646167 17:58243191-58243213 TGCTCCCTCTGAAGGCTCTAGGG + Intronic
1150130378 17:62665936-62665958 GGCACCCCATAGTGGCTTTAAGG - Intronic
1150835271 17:68558141-68558163 AGCTCCTCATGGTGGCTTTCTGG - Intronic
1151235550 17:72717409-72717431 TGCTCCCCCTGAAGGCTCTAGGG + Intronic
1151241473 17:72761564-72761586 TCCACCCCATGGTGGCTAGAAGG - Intronic
1151271824 17:73002806-73002828 TGCTCCCTCTGGAGGCTCTAGGG + Intronic
1151811767 17:76447795-76447817 TGCTTCCCAAGGTGCCTCTTTGG + Intronic
1153139142 18:1952761-1952783 TGCTTCCCATGGTCACTCTGGGG + Intergenic
1153999549 18:10472120-10472142 GGCTTGCCATGGGGGCTCTAGGG + Intronic
1154513278 18:15133923-15133945 CTCTCCCCATGCTGGCTCTAGGG - Intergenic
1156157714 18:34322871-34322893 TGCACCACATGGTGGCGCTCTGG - Intergenic
1157427528 18:47596599-47596621 TGCTGTTCATGATGGCTCTAGGG - Intergenic
1157773801 18:50374763-50374785 AGCTGCCCCTGGTGACTCTAAGG + Intergenic
1158077966 18:53553224-53553246 TGCTCCCTCTGCAGGCTCTAGGG - Intergenic
1158589066 18:58764465-58764487 TGCTCCCCCTCCTGGCTCAAAGG + Intergenic
1159438206 18:68445340-68445362 TGCTCCCTCTGGAAGCTCTAGGG + Intergenic
1160113916 18:76059129-76059151 TGCTTCTCATGGGGGCTCTAGGG - Intergenic
1160151618 18:76399572-76399594 TGCTCTCCATGCTGGCTTCAAGG + Intronic
1161133376 19:2605050-2605072 TGCTCCCTCTGGAGGCTCCAGGG + Intronic
1161141879 19:2652980-2653002 TGCTGGGCATGGTGGCTCCAGGG + Intronic
1161155464 19:2730282-2730304 AGCTCCCCAGGGTGGCCCGAGGG - Intronic
1162722726 19:12672195-12672217 TGCTCCCTCTGGTGGCTGTGGGG + Intronic
1162723581 19:12676509-12676531 TGCTCCCCCTGGTGGCCATGTGG - Intronic
1162987988 19:14284074-14284096 CGCTCCCCACAGAGGCTCTAGGG + Intergenic
1163372735 19:16910929-16910951 TGCTCCCTCTGCAGGCTCTAAGG - Intronic
1163625477 19:18386973-18386995 TGCCCTCCATGGAGGCTCCAGGG + Intronic
1164632676 19:29771900-29771922 TGCTCCCCCTGGAGGCTCCAGGG - Intergenic
1166971917 19:46574597-46574619 TGCTCCTTCTGGAGGCTCTAGGG + Intronic
1167142257 19:47660163-47660185 TGCTCCCTCAGGAGGCTCTAGGG + Intronic
1168280065 19:55300886-55300908 TGCTTCCTCTGGAGGCTCTAGGG + Intronic
926942711 2:18155056-18155078 TGCTCCCTCTGGAGGCTCCAAGG - Intronic
930488040 2:52033202-52033224 TGATCCCTATGCTGGCTCTAAGG - Intergenic
930707565 2:54519845-54519867 CGCTCCACAGGGTGGCCCTAAGG - Intronic
932226925 2:70048764-70048786 TGCTCCCTCTGAAGGCTCTAGGG + Intergenic
932312035 2:70750643-70750665 TGCTCCCTCTGAAGGCTCTAGGG - Intronic
932860974 2:75290920-75290942 TGCTCCCTCTGGAGGCTCTAGGG + Intergenic
933254990 2:80070780-80070802 TACTCCCCCTGAAGGCTCTAGGG + Intronic
933798518 2:85941279-85941301 TGCTCCCTCTGGAGGCTCTGAGG + Intergenic
934578539 2:95419089-95419111 TGCTCCCTCTGAAGGCTCTAGGG - Intergenic
934600905 2:95657620-95657642 TGCTCCCTCTGAAGGCTCTAGGG + Intergenic
935492772 2:103740942-103740964 TCCTCCCCATGGTTCCTCCAGGG + Intergenic
936534279 2:113299771-113299793 TGCTCCCTCTGAAGGCTCTAGGG + Intergenic
937104713 2:119299576-119299598 TGCTCCCTCTGCAGGCTCTAGGG + Intergenic
937318059 2:120944532-120944554 TGATCCCCAAGGTGACTCTGGGG - Intronic
938513527 2:131978534-131978556 CTCTCCCCATGCTGGCTCTAGGG - Intergenic
940781652 2:157939782-157939804 TGCTCCCCCTAAAGGCTCTAGGG - Intronic
943787565 2:191895466-191895488 TGCACACCATGGTGGATCTGGGG + Intergenic
944126128 2:196294807-196294829 TGCTCCCCAGCCTGGCTCTCTGG + Intronic
945974393 2:216259217-216259239 TGCTCCCTCTGTTGGCTCTGGGG + Exonic
946246953 2:218393264-218393286 TGCCCCCCAGGGTGGCTGTGGGG - Intronic
948289431 2:236814173-236814195 TGCTCCCCACGGTACCTCGATGG + Intergenic
948871288 2:240799498-240799520 GGCTGCACCTGGTGGCTCTAAGG - Intronic
1169557702 20:6768012-6768034 TGCTCCGCATCGCGGCGCTAGGG - Exonic
1169886080 20:10399187-10399209 TGCTCCCTCCGGAGGCTCTAGGG - Intergenic
1170433133 20:16295225-16295247 TGCTCCCCATGGAGACACCATGG - Intronic
1171986525 20:31665066-31665088 TGCTCCTCATGGTGGGTTCAGGG - Exonic
1172820468 20:37728798-37728820 AGCTCCTCATGATGACTCTATGG - Intronic
1172867775 20:38113087-38113109 TGCTCCCCATGGTGGGGCCAAGG - Intronic
1173003957 20:39125457-39125479 TGCTCCACCTGGAGGCTCTAGGG + Intergenic
1173189290 20:40863781-40863803 TGCTCCCTCTGAAGGCTCTAGGG - Intergenic
1174384403 20:50178554-50178576 TGCTCCCTCTGGAGGCTCTGGGG - Intergenic
1174692733 20:52524429-52524451 TGCTGCCCCTGATGTCTCTAGGG - Intergenic
1175124438 20:56740886-56740908 CGCTCTCCCTGGAGGCTCTAGGG + Intergenic
1175132142 20:56797352-56797374 TGTTCCTCCTGGAGGCTCTAGGG + Intergenic
1175133537 20:56806931-56806953 TGTTCCCCATGGTGTCTCCCCGG + Intergenic
1175188958 20:57198583-57198605 TGCTCCGCATGGTGACTCACAGG + Intronic
1175575328 20:60056587-60056609 TGGGCTCCATGGTGGCTCTGTGG + Intronic
1175801136 20:61801622-61801644 TGCTCCCACTGGAGGCCCTAGGG + Intronic
1176427662 21:6558744-6558766 TGCTTCACAGGGTGGCTCTGAGG + Intergenic
1176780255 21:13184360-13184382 CTCTCTCCATGCTGGCTCTAGGG + Intergenic
1177977921 21:27873382-27873404 CTCTCCCCATGCTGGCTCTAGGG + Intergenic
1178719025 21:34991989-34992011 TGCTCCCTGTGCAGGCTCTAGGG - Intronic
1179231261 21:39505850-39505872 TGCCCCCCAGGCTAGCTCTACGG + Intronic
1179703154 21:43167061-43167083 TGCTTCACAGGGTGGCTCTGAGG + Intergenic
1180027287 21:45174155-45174177 TGCCCCATATGGTGGCTTTAGGG - Intronic
1180204532 21:46249959-46249981 TGCTCACAATGATGGCACTAAGG + Intronic
1181812399 22:25411710-25411732 TGCTCCCTCTGGAGGCTCTAGGG - Intergenic
1182060063 22:27390707-27390729 GGGTGCCCATGGTGGGTCTAGGG - Intergenic
1182768510 22:32776183-32776205 TGCTCCCTCTAGAGGCTCTAGGG - Intronic
1184519334 22:44983352-44983374 TGCTGCCGCTGGTGGCTCTTAGG + Intronic
1185176304 22:49328925-49328947 TGCTCCCTCTGGAGGCTCTGGGG - Intergenic
949663772 3:6313281-6313303 TGTTCCCTCTGGAGGCTCTAGGG + Intergenic
950885128 3:16356260-16356282 TGCTGCCCATGGTCTCTCCAGGG - Intronic
951274966 3:20673966-20673988 TGCTCCCTCTGGAGGCTCTAGGG + Intergenic
953418093 3:42734413-42734435 TGCTCCCCATCCTGGCTCACTGG - Intronic
953461771 3:43087129-43087151 TGCTCCCTCTGAAGGCTCTAGGG - Intronic
953716745 3:45322313-45322335 TGCTCCCTCTGAAGGCTCTAGGG + Intergenic
955798827 3:62665626-62665648 TGTCCCCAGTGGTGGCTCTATGG - Intronic
958637597 3:96764415-96764437 TTCTTCACATGGTGGCTGTAAGG - Intergenic
961295158 3:125878722-125878744 TGCTCCCTCTGAAGGCTCTAGGG - Intergenic
961556779 3:127701511-127701533 TGCTTCCCATGGGGGCTGCAGGG + Intronic
961760095 3:129160966-129160988 TACTCACCATGGTGTCGCTAAGG + Exonic
961890742 3:130128440-130128462 TGCTCCCTCTGAAGGCTCTAGGG + Intergenic
962324418 3:134421710-134421732 TGCTACACATGGTAGCACTATGG - Intergenic
964387030 3:156158724-156158746 AGCTCCACATGGTGGGTCTGTGG + Intronic
964792097 3:160462029-160462051 TGCTCCCCCTGAGGGCTCTAGGG + Intronic
964975022 3:162607433-162607455 TGCTCTCTATGAAGGCTCTAAGG + Intergenic
969002127 4:3990855-3990877 TGCTCCCTCTGAAGGCTCTAGGG + Intergenic
969108698 4:4827997-4828019 TGCTCCCTAGGAAGGCTCTAGGG - Intergenic
969619354 4:8271162-8271184 TGCTCCCCATGGTGCTCCTGAGG - Intronic
970300760 4:14679303-14679325 TGGTGATCATGGTGGCTCTAGGG - Intergenic
970858498 4:20675369-20675391 TGCTCCATCTGGAGGCTCTAGGG - Intergenic
973184678 4:47311601-47311623 TGTTCCTCCTGGAGGCTCTAAGG - Intronic
973703196 4:53556314-53556336 TGCTCCCTATGAAGGCTATAGGG - Intronic
974745916 4:66075462-66075484 TGCACCCCATTGTGGCTGCAGGG - Intergenic
975540849 4:75510254-75510276 TGCTCCACATGGTCACTCCAGGG - Intronic
975978862 4:80132249-80132271 TGCTCCTTATGGAGGCTCTGAGG - Intergenic
976432448 4:84978497-84978519 TGCTCCCCATGAAAGCTGTAGGG - Intergenic
979241017 4:118446981-118447003 TGCTCCTGATGGAGGCACTAGGG - Intergenic
979357911 4:119727555-119727577 TGCTCCCTCTGGAAGCTCTAGGG + Intergenic
986119896 5:4824917-4824939 TGCTCCCAATGAAGGGTCTAGGG - Intergenic
986397465 5:7344652-7344674 TGCTCTCCACCGAGGCTCTAGGG - Intergenic
986422907 5:7601942-7601964 TGTTCCCTCTGGAGGCTCTACGG + Intronic
986932254 5:12840560-12840582 TGCTCCCTCTGAAGGCTCTAGGG + Intergenic
987307859 5:16655006-16655028 TCTTCACCATGGTGGCTTTAGGG + Intergenic
987588910 5:19896555-19896577 TGCTCGCTTTGGAGGCTCTAGGG - Intronic
987762931 5:22188782-22188804 TGCCTCCCATGTTGCCTCTAAGG - Intronic
988110104 5:26808289-26808311 TGTTCCCTCTGGAGGCTCTAGGG - Intergenic
989242379 5:39216078-39216100 TGTTCCCTCTGGAGGCTCTAGGG - Intronic
990867864 5:60399768-60399790 GGCTCCCCAAGCTGGCTCTCTGG + Intronic
991897716 5:71422180-71422202 TGCCTCCCATGTTGCCTCTAAGG - Intergenic
991939611 5:71838091-71838113 TGCTCCCTCTGAAGGCTCTAGGG + Intergenic
991998186 5:72409182-72409204 TGCTCCCTCTGAGGGCTCTAAGG + Intergenic
992110891 5:73492363-73492385 TGCTCCACATGTTGGTTCTGGGG + Intergenic
994172385 5:96671589-96671611 TGCTACCCATAGCAGCTCTAGGG - Intronic
997160754 5:131606910-131606932 TGATCCCAATTGAGGCTCTACGG + Intronic
997229374 5:132231567-132231589 TGCTCCCTCTGAAGGCTCTAGGG + Intronic
999147279 5:149405010-149405032 TGCTCCCAATGGTGGGGCTGGGG - Intergenic
999848560 5:155512449-155512471 TGCTTCCCATGGCTGCTCCATGG - Intergenic
1001593447 5:172882138-172882160 TGCTGCCCAGCGTGGCTCTGTGG + Intronic
1003242001 6:4353188-4353210 TGCTGCCCACGGTGTCTCTCAGG - Intergenic
1003946887 6:11084212-11084234 TGCTCCCTCTGAGGGCTCTAAGG - Intergenic
1004697289 6:18045549-18045571 TGCTCCCTCTGAAGGCTCTAAGG - Intergenic
1005573984 6:27175111-27175133 TGTTCCTCATGGAGGCTCTAGGG + Intergenic
1005708116 6:28477276-28477298 TGCTCCCTCCGGAGGCTCTAGGG + Intergenic
1008315641 6:50036844-50036866 TGCTCCTTCTGGAGGCTCTAGGG - Intergenic
1008642174 6:53475261-53475283 TGCTCCCTCTGAAGGCTCTATGG + Intergenic
1010097381 6:72062741-72062763 TGCTCCCTGTGGAGGCACTAGGG + Intronic
1010154925 6:72781294-72781316 TGCTCCCTATGAAGACTCTAGGG - Intronic
1013812968 6:114065465-114065487 TACTCCCCTTAGTAGCTCTATGG + Intronic
1014246342 6:119073865-119073887 TGCTCCCTATGTGGCCTCTACGG + Intronic
1014342374 6:120226796-120226818 TGCTCCCCAATGTGGCTAAAGGG + Intergenic
1014760306 6:125348917-125348939 TGCTCCCTCTGAAGGCTCTAGGG - Intergenic
1015312935 6:131784617-131784639 TGCTCTCTCTGGAGGCTCTAGGG + Intergenic
1016175746 6:141075796-141075818 TTCTCCCCAGGTTAGCTCTAGGG + Intergenic
1016509645 6:144827206-144827228 ATTTCCCCATGGTGGCTCTCAGG + Intronic
1018703993 6:166450086-166450108 TGGTCCCCATGGTGGTTCCCCGG - Intronic
1019051214 6:169185274-169185296 TGCTCCCCATGGCCTCTCTCTGG - Intergenic
1019287344 7:230301-230323 AGCTCCCCGTGGAGACTCTAGGG - Intronic
1023535991 7:41211591-41211613 TGCTCCCTTTGAAGGCTCTAGGG - Intergenic
1023983346 7:45081975-45081997 AGCTCTCCATGGTGGCTGTGGGG + Intronic
1024026119 7:45411215-45411237 TGCTCCCTCTGGAGGCTCCAGGG + Intergenic
1026541631 7:71284547-71284569 TTCTTCACATGGTGGCACTAAGG - Intronic
1026638999 7:72108095-72108117 TGCTCCCCGTGAAGGCTCTAAGG + Intronic
1028949979 7:96623840-96623862 TGCTCCCTCTGATGGCTCTAGGG + Intronic
1031029090 7:116715294-116715316 TGCTCCCTCTGGAGGCTCTAGGG + Intronic
1031526379 7:122826024-122826046 AGCTCCCCATGTTGTCTCCATGG - Intronic
1033310054 7:140254739-140254761 TGCTCCCCCTGAAGGCTCTAAGG - Intergenic
1034240475 7:149606906-149606928 TGAGCCCCAAGGTGGCTCTGGGG - Intergenic
1034401268 7:150863180-150863202 TGTTCCTAATGGAGGCTCTAGGG - Intergenic
1036375084 8:8193085-8193107 TGCTCCCTCTGAAGGCTCTAGGG - Intergenic
1036765953 8:11549443-11549465 TCCTGCCCATGGAGGCTGTAGGG - Intronic
1036854457 8:12230063-12230085 TGCTCCCTCTGAAGGCTCTAGGG + Intergenic
1036875817 8:12472563-12472585 TGCTCCCTCTGAAGGCTCTAGGG + Intergenic
1037532599 8:19792179-19792201 AGCTCCCTCTGGAGGCTCTAGGG + Intergenic
1037835367 8:22212200-22212222 GGCTCCCCACGGTGGCTCCTGGG - Exonic
1038378603 8:27070028-27070050 TGCTGCTCCTGGTGGGTCTATGG + Intergenic
1038378689 8:27070856-27070878 TGCTGCTCCTGGTGGGTCTATGG - Intergenic
1039398710 8:37249140-37249162 TGATCCCTATGGAGGCTCCAGGG - Intergenic
1039800422 8:40949919-40949941 TGCTCCCTTTGAAGGCTCTAGGG - Intergenic
1039831200 8:41216490-41216512 TGCTCCCCATGAAGGCTCCAGGG + Intergenic
1043720467 8:83543170-83543192 TGCTCCCCAAGTTAGCTCCAGGG - Intergenic
1044121067 8:88396577-88396599 TTTTACCCATGGTGGATCTAGGG + Intergenic
1044726846 8:95201349-95201371 CGCTCCCTCTGGAGGCTCTAGGG + Intergenic
1045349914 8:101329336-101329358 TGCTACCCCTGAAGGCTCTAGGG + Intergenic
1045858964 8:106794342-106794364 TGCTCCCTCTGATGGCTCTAGGG + Intergenic
1046264827 8:111817133-111817155 TGCTCCCTCTGGAGGTTCTAGGG - Intergenic
1046951594 8:120024708-120024730 TGCTCCCTCTGATGGCTCTAGGG - Intronic
1047388018 8:124427388-124427410 TGCTCCCTCTGAAGGCTCTAGGG + Intergenic
1048018046 8:130514836-130514858 TGCTCCCTCTGAAGGCTCTAGGG + Intergenic
1048048358 8:130794147-130794169 TGCTCCCTCTGAAGGCTCTAGGG - Intronic
1048562683 8:135558885-135558907 TTCTCTCCCTGGAGGCTCTAGGG + Intronic
1049497418 8:142942809-142942831 GCCTCCCCATGGGGGCTCCATGG - Intergenic
1050202629 9:3161837-3161859 TGCTCCCTCTGGAGGCTCAAGGG + Intergenic
1051550298 9:18320150-18320172 TACTCCCTCTGGAGGCTCTAGGG - Intergenic
1051642624 9:19238023-19238045 TGCTCCCACTGTAGGCTCTAGGG + Intronic
1052647255 9:31253114-31253136 TGCTGCCCATGGTAGTTCAAGGG - Intergenic
1052708364 9:32021110-32021132 TGTTCCTTCTGGTGGCTCTAGGG - Intergenic
1053218015 9:36288884-36288906 TGCTCCCTCTGGAGGCTCTTGGG + Intronic
1055382518 9:75724480-75724502 TGCACCCCTTGGTGGCTATCCGG - Intergenic
1055503397 9:76924239-76924261 TGCTCCTTTTGGAGGCTCTAGGG - Intergenic
1056284217 9:85071555-85071577 GGCTCCCCCTGGAGACTCTAGGG - Intergenic
1056415377 9:86370391-86370413 TGTTCTCCATAGTGGCTGTAAGG + Intergenic
1056491659 9:87114073-87114095 CGCTCCCTCTGGAGGCTCTAGGG - Intergenic
1057055619 9:91958382-91958404 TGCTCCCTCTGAAGGCTCTAGGG - Intergenic
1059843652 9:118246670-118246692 TGCTCTCTCTGGAGGCTCTAAGG + Intergenic
1060220471 9:121761640-121761662 TGCTCCCCATCGCGGGTCCATGG - Intronic
1060235337 9:121858740-121858762 TGCTCTCCAGGGTGGCTCTGAGG - Intronic
1061167916 9:128934991-128935013 TGCCCCTTAGGGTGGCTCTAGGG - Intronic
1062173154 9:135146505-135146527 TGCTCACTCTGGAGGCTCTAGGG + Intergenic
1185511218 X:666464-666486 TGCTCCCTCTGGAGACTCTAAGG - Intergenic
1185517311 X:709935-709957 TGCTTCCTCTGGAGGCTCTAGGG + Intergenic
1185586753 X:1246734-1246756 TGCTCCCTCTGGAGGCTCTAGGG - Intergenic
1185599527 X:1329399-1329421 AGCTCCCTCTGGGGGCTCTAGGG - Intergenic
1185614793 X:1414222-1414244 TGCTCCCTCTGGAGGCTCTAGGG - Intronic
1185622704 X:1463352-1463374 AGTTCCCCCTGGAGGCTCTAGGG + Exonic
1185630512 X:1513399-1513421 TCCTCCCTGTGGAGGCTCTAGGG + Intronic
1185653508 X:1666383-1666405 TGCTCCCTCTGGAGGCTCTAGGG + Intergenic
1185677316 X:1859467-1859489 TGCTCCCTCCGGAGGCTCTAGGG + Intergenic
1185691007 X:2155276-2155298 TGCTCCCTCCGGAGGCTCTAGGG + Intergenic
1185758770 X:2673401-2673423 TGCTTCCTCTGGAGGCTCTAGGG - Intergenic
1185764602 X:2715360-2715382 TGCTCCCTCTAGGGGCTCTAGGG + Intronic
1185826765 X:3258750-3258772 TGCTCCCTTTGGAGGCTCTAGGG + Intergenic
1185873438 X:3683076-3683098 TGCTCCCTCTGCGGGCTCTAGGG - Intronic
1185875016 X:3694907-3694929 TGCTCCCTCTGGAGGCTCTGGGG - Intronic
1185890386 X:3816606-3816628 GACTCCCCCTGGAGGCTCTAGGG - Intergenic
1186138863 X:6549538-6549560 TGCTTCCTCTGGAGGCTCTAGGG - Intergenic
1186610077 X:11130427-11130449 TGCTCCCTCTGAAGGCTCTAGGG + Intergenic
1187578176 X:20580021-20580043 TGCTCCCTCTGAAGGCTCTAGGG + Intergenic
1189188598 X:39075474-39075496 CCCTCCCCCTGGAGGCTCTAGGG - Intergenic
1189577406 X:42369076-42369098 TGATCCCTTTGGAGGCTCTAGGG - Intergenic
1193671463 X:84391530-84391552 TGTTTTCCATAGTGGCTCTACGG + Intronic
1195014611 X:100766103-100766125 TACTCCCCATGGTGGCCATGAGG - Intergenic
1197867356 X:131033554-131033576 AGCTCCCTTTGGAGGCTCTAGGG + Intergenic
1198994414 X:142557900-142557922 GGCTCCCCATGGTAGCTGTCAGG - Intergenic
1199256780 X:145726474-145726496 TGCTCCCCACGGAGGCCCTGAGG + Intergenic
1199802409 X:151264829-151264851 TGTTCCCTTTGGAGGCTCTATGG + Intergenic
1200059817 X:153479276-153479298 TGCTCCCCATCCTGGCACTGTGG + Intronic
1200773793 Y:7151603-7151625 TGCTCCCTCTGGAGGTTCTAGGG + Intergenic
1200790866 Y:7298029-7298051 TGCTCCCTCTGCGGGCTCTAGGG + Intergenic
1201245311 Y:11997455-11997477 TGCTCCCTATGGAGGCTCTAGGG - Intergenic
1201894965 Y:18983376-18983398 AGCTCCCCCTGGAAGCTCTAGGG + Intergenic