ID: 1084676895

View in Genome Browser
Species Human (GRCh38)
Location 11:70640605-70640627
Sequence GAGCCCTGACCTGGGATCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 239}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084676895 Original CRISPR GAGCCCTGACCTGGGATCAC AGG Intronic
900126877 1:1072656-1072678 GAGTCCTTCCCTGGGATCTCTGG - Intronic
900184340 1:1325858-1325880 GAGCCCTGTCCTGGCCTCCCTGG - Intronic
901012745 1:6210535-6210557 GAGCCTGGACCAGGGATCTCGGG + Intronic
901165790 1:7220784-7220806 GTCCCCTGACCTGGCACCACGGG + Intronic
901440646 1:9275992-9276014 GAGTCCTGACCTGGGGGCCCTGG - Intergenic
901753599 1:11427399-11427421 GAACCAGGACCTGGGAACACAGG + Intergenic
901803034 1:11720233-11720255 GAGCACTGACCTGGGACCCTGGG - Exonic
901956842 1:12792447-12792469 GGGCCCTGAGCTGGGCTCCCTGG + Intronic
901964830 1:12858127-12858149 GGGCCCTGAGCTGGGCTCCCTGG + Intronic
901980232 1:13028582-13028604 GGGCCCTGAGCTGGGCTCCCTGG + Intronic
902001853 1:13200349-13200371 GGGCCCTGAGCTGGGCTCCCTGG - Intergenic
902021081 1:13346074-13346096 GGGCCCTGAGCTGGGCTCCCTGG - Intronic
902394605 1:16125790-16125812 GAGGCCTGAGCTGGGGGCACTGG - Intronic
902799179 1:18818923-18818945 GAGCCCTGAGCTGGGATAGAGGG + Intergenic
903070461 1:20724532-20724554 GAGCCCTGCCCAGGGCCCACAGG - Exonic
904694331 1:32319827-32319849 CAGCCCTGAACTGGGCTCAAGGG - Intronic
904899258 1:33843660-33843682 GCTCCCTGCCCTGGGATCTCTGG - Intronic
905766319 1:40604572-40604594 CTGCCTTGACCTGGGATTACAGG + Intergenic
906278676 1:44537691-44537713 GAACCCTGACTTGTGATCATTGG - Intronic
907630874 1:56080604-56080626 GAGCCCTGGCTGGGGATCAGTGG + Intergenic
908009770 1:59764269-59764291 GAGCCCTGGCCTGGGATCCTAGG + Intronic
908297960 1:62731882-62731904 GAGTGCTGGCCTGGGATTACAGG + Intergenic
908824478 1:68120057-68120079 GAGCCATGTGCTGGCATCACAGG - Intronic
912062294 1:105687539-105687561 GATCCCGGACCTGGGAACAGGGG - Intergenic
916666273 1:166970575-166970597 GAGCCCTGACCTGGGAGCTGAGG - Intronic
919860175 1:201734738-201734760 GGACCCTCACCTGGGGTCACTGG - Intronic
920307272 1:205026898-205026920 CAGCCCTGGCCGGGGCTCACTGG + Intergenic
920414679 1:205790978-205791000 GAGAACAGAACTGGGATCACAGG + Exonic
921362489 1:214342847-214342869 GAAACCTGACCTGGAATCACAGG - Intergenic
922122891 1:222691138-222691160 GAGCCATGACCTAGGATGAGAGG + Intronic
922422759 1:225470743-225470765 GAGGCCTGTCCTGAGAGCACAGG - Intergenic
922645409 1:227281441-227281463 GAGCCCTTGCCTGAAATCACAGG - Intronic
923925510 1:238622415-238622437 GAGCCCTCAACTGTGATTACGGG + Intergenic
1062902432 10:1156324-1156346 GAGCCCAGCCCTGGGGACACGGG - Intergenic
1062902451 10:1156372-1156394 GAGCCCAGCCCTGGGGACACGGG - Intergenic
1064554832 10:16537914-16537936 GGGCCCTGATCTGGTATGACTGG + Intergenic
1065382209 10:25101889-25101911 CAGCCCTGACCTGAAATGACTGG - Intergenic
1066216694 10:33295252-33295274 GAGCCATCACTTGGGAACACAGG + Intronic
1068471391 10:57468883-57468905 GAAGTCTGACCTGGGCTCACTGG + Intergenic
1069535510 10:69249998-69250020 GAGCCCTGGCCTGGAGTCAAGGG - Intronic
1070144604 10:73764652-73764674 CAGCACTAACCTGGGATGACAGG - Intronic
1070829874 10:79411717-79411739 TAGCACTGGCCTGGGATCCCAGG - Intronic
1071511759 10:86266577-86266599 CATCACTGACCTGGGATCATGGG - Intronic
1071530858 10:86389659-86389681 ACGCCCAGACCTGGGAGCACAGG - Intergenic
1072536825 10:96370471-96370493 GAGCCCTGACCTGGGAGCCAGGG - Intronic
1073072052 10:100800739-100800761 GGGCCCTGACCTGGGGTGAGAGG + Intronic
1073447487 10:103590172-103590194 TGGCCCAGACCTGGGGTCACTGG - Exonic
1076003538 10:126930653-126930675 AAGGCCTGGCCTGGGGTCACTGG + Intronic
1076353871 10:129838434-129838456 GAGCCCAGACCTGGAAGCAGAGG - Intronic
1076658822 10:132041783-132041805 GAGGCCTGAGGTGGGATCCCAGG - Intergenic
1077088184 11:765157-765179 CAACCCTGACCTGGGTTCCCAGG - Intergenic
1077159041 11:1104307-1104329 GAGCTCTGTCCTGGGTTGACTGG - Intergenic
1077412759 11:2411116-2411138 GAGCCCCGACCTGGGACCTGGGG - Intronic
1077560689 11:3258404-3258426 GAGCCCTGCCCAGGTACCACTGG + Intergenic
1077566585 11:3304232-3304254 GAGCCCTGCCCAGGTACCACTGG + Intergenic
1077723326 11:4648745-4648767 GATCCCTCACCTGGAAACACTGG - Intronic
1078541872 11:12219347-12219369 GAGCCCTGAGCTGCGAGGACTGG - Intronic
1080890429 11:36404389-36404411 GTCTCCTGAGCTGGGATCACAGG + Intronic
1083404334 11:62446287-62446309 GAGCCCTGAGCTGGGAAGAGAGG - Intronic
1083800201 11:65041998-65042020 GAGCCCCGACGTGGGACCTCGGG + Intronic
1084676895 11:70640605-70640627 GAGCCCTGACCTGGGATCACAGG + Intronic
1084881729 11:72176626-72176648 GAGTCCCCACCTGGGAACACAGG - Intergenic
1084938059 11:72597671-72597693 GAGGCCTGGCCTGGGAACACAGG + Intronic
1089519831 11:119056521-119056543 GAGCCCTGGGCGGGGATCCCTGG - Intronic
1090094455 11:123729666-123729688 GAGCCCAGATCTGGGGGCACCGG - Exonic
1092740132 12:11620244-11620266 GAGCAAAGAGCTGGGATCACAGG + Intergenic
1095959689 12:47826481-47826503 GAGCGCTGACCTGGAAACCCTGG - Intronic
1097307747 12:58087894-58087916 GAGCCCTGCCCTGGGCTCCCGGG - Intergenic
1097750510 12:63347493-63347515 GAGCCCAGTGCTGGGAACACAGG - Intergenic
1099104358 12:78481030-78481052 GAGGCCTTACCCGGGAGCACAGG + Intergenic
1101312793 12:103598948-103598970 GTGTCCTCACCTGGGCTCACAGG - Intronic
1102860518 12:116332219-116332241 TGGCCCTGACCTGTGATCACTGG + Intergenic
1103044082 12:117720801-117720823 GAGCCCAGATCTGAGATCTCAGG + Intronic
1103083371 12:118042968-118042990 GAGCCCTGGCATGGGAGCAGGGG + Exonic
1104058156 12:125245905-125245927 GAGGCCTGACCTGGCAGCTCGGG - Intronic
1104081117 12:125431217-125431239 TAGCCCTCACCTGGGCTCCCAGG - Intronic
1104906879 12:132218257-132218279 GAGGCCTGGGCTGGGAACACAGG - Intronic
1104991155 12:132624566-132624588 GTTCCCTGGCCTGGGGTCACAGG + Exonic
1105864948 13:24451185-24451207 GAGCCCTGACCTGGGAGCAGGGG + Intronic
1105938149 13:25120852-25120874 GAGCACTGGCCTGGAATCAAGGG - Intergenic
1107305535 13:39014290-39014312 GAGACCTGCCCTGGGAACACAGG + Exonic
1112275177 13:98011026-98011048 CTGCCATGACCTGGGATTACAGG + Intronic
1113485167 13:110647612-110647634 GAGCCCCGCCCTGGGGTCAGAGG + Intronic
1113783886 13:112992036-112992058 GAGCTCTGACATGACATCACAGG + Intronic
1113885328 13:113655881-113655903 GAGCCCTGAGCTGTGATGAGAGG + Intronic
1118935502 14:70284250-70284272 TAGCCCTGTACTGGGATTACAGG + Intergenic
1119259098 14:73226847-73226869 GATCCCTGAACTGGGAGCAAGGG - Intergenic
1119608631 14:76043015-76043037 GAGCCCTGGGCTGGGATGAGAGG + Intronic
1119776792 14:77254002-77254024 GAGCCCTGGCCTTGGGGCACAGG - Intronic
1121350895 14:93172002-93172024 CAGCCTTGAGCTGGGATTACAGG + Intergenic
1121698331 14:95931314-95931336 GAGCACTGGCCTGGGAGCACAGG - Intergenic
1122921453 14:104882062-104882084 GCGCCCTGACCTGAGGGCACTGG + Intronic
1122995232 14:105260071-105260093 GAGCCCTGCTCTGGGCTGACGGG + Intronic
1125903285 15:43368968-43368990 AAGCCCAGACCTGGGACCACAGG - Exonic
1128227002 15:66008868-66008890 GAGCCCTGGCCTGGTATTCCAGG - Intronic
1128724560 15:69978899-69978921 GAGGCCTGACCTGAGACCTCAGG - Intergenic
1129230035 15:74192035-74192057 GAGCCCCTGCCTGGAATCACTGG + Intronic
1129466985 15:75729676-75729698 GTTCCCTGACCTGGTAACACTGG - Intergenic
1129687945 15:77696954-77696976 GACCCCTGTCCTGGGATTTCTGG - Intronic
1129720254 15:77874075-77874097 GTTCCCTGACCTGGTAACACTGG + Intergenic
1130203542 15:81854935-81854957 GAGCCCTGACCCAGTCTCACTGG + Intergenic
1130563275 15:84975100-84975122 CAGGCCTCACCTGGGATTACTGG - Intergenic
1132618161 16:852491-852513 CAGCACTGTCCTGGGACCACGGG - Intergenic
1132944914 16:2527469-2527491 GAACTCTGACCTGAGATCTCTGG + Intronic
1135001924 16:18783952-18783974 TGGCCCTCATCTGGGATCACAGG + Intronic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1137037084 16:35576582-35576604 CAACCCTGAGCTGGGAGCACTGG - Intergenic
1137559589 16:49494136-49494158 GAACCCACACCTGGGACCACTGG + Intronic
1137614122 16:49836898-49836920 GAGGCCTGTCCTGGGTTCCCAGG - Intronic
1138548549 16:57734814-57734836 GAGCCCTGACCTGCGGTGAGAGG + Intergenic
1138684449 16:58712386-58712408 CTCCCCTGAGCTGGGATCACAGG - Intronic
1139371659 16:66472936-66472958 AAGCCTTGACCTGGGCTCAAGGG - Intronic
1139775676 16:69315727-69315749 GAGCCCTGACCTGAGATATTAGG + Intronic
1139893330 16:70268660-70268682 CAGGCAGGACCTGGGATCACAGG - Intronic
1140028173 16:71311099-71311121 GAGCCCTGATCCAGGAGCACTGG + Intergenic
1140966788 16:79974262-79974284 GAGCTCTCACCTGGAGTCACTGG - Intergenic
1141932876 16:87217380-87217402 GAGCCCTGAATTGGGGTCAGGGG - Intronic
1141993070 16:87621364-87621386 CAGCCCAGACCTGGGATCCGCGG + Intronic
1142428530 16:90013533-90013555 GGGCCCTGAACCGGGATCCCTGG - Intronic
1142706439 17:1697920-1697942 GTGCCCTGACCTGGGATCTGAGG + Intergenic
1143345715 17:6247369-6247391 GAGCCCTAATCTGGTATGACTGG - Intergenic
1143787162 17:9264502-9264524 GAGACCAGCCCTGGGAACACAGG - Intronic
1144052448 17:11508594-11508616 GAGAAATGACCTGGGAGCACTGG - Intronic
1144127882 17:12219897-12219919 GAGGCCTGAAATGGGTTCACTGG - Intergenic
1147469909 17:40649070-40649092 GATCCCTGACCTGTGGTTACTGG + Intergenic
1149664866 17:58358366-58358388 GGGCCCTGAGCTGGAGTCACTGG + Exonic
1149671032 17:58410341-58410363 AGGCTCTGAGCTGGGATCACAGG + Intronic
1151207612 17:72519450-72519472 GGGCCTCCACCTGGGATCACAGG + Intergenic
1151723924 17:75874021-75874043 GAGCCCTGGCCTGGGAGAAGGGG - Intergenic
1152213316 17:79016703-79016725 GAGCCATGGCCAGAGATCACTGG - Intergenic
1152392293 17:80010059-80010081 CAGCGCTCACCTGGCATCACAGG + Intronic
1152507404 17:80759153-80759175 GAGACCAGCCCTGGGAACACAGG + Intronic
1152839605 17:82558613-82558635 GAGCCCTCTCCTGGGAGGACCGG + Intronic
1152887832 17:82862925-82862947 GAGCTCTGAGCTGGGATATCTGG + Intronic
1155857520 18:30851433-30851455 GCCTCCTGAGCTGGGATCACAGG + Intergenic
1155917721 18:31572582-31572604 GTGCCCTGACCTGAGCTCGCGGG - Intergenic
1156901360 18:42303844-42303866 GAGCCCTGGGCTGGGATCAAGGG - Intergenic
1158327922 18:56330149-56330171 GAGGCCTGAGCTGGGATGATAGG - Intergenic
1158401651 18:57126837-57126859 GAGCCCAGAACTAGCATCACTGG - Intergenic
1161487715 19:4544525-4544547 GAGTCCTGGCCGGGGAGCACAGG + Exonic
1161731323 19:5962537-5962559 GAGCCCTGACCATGGCTCCCTGG - Intronic
1163862302 19:19748705-19748727 GGGCCCAGGCCTGGGAGCACCGG - Intergenic
1163870270 19:19815465-19815487 GAGAGAAGACCTGGGATCACAGG + Intronic
1164452449 19:28378469-28378491 GCGCCCTGGCCTGGGAGCTCAGG - Intergenic
1164679830 19:30126706-30126728 GGACCCTGACCTGGCATCAGGGG + Intergenic
1164698613 19:30265603-30265625 GAGCCCTGAGCAGGGACCACAGG - Intronic
1165118229 19:33542052-33542074 GAGCCCTGGCCTGGCCTCAGGGG - Intergenic
1166129350 19:40736787-40736809 GATCCCACACCTGGGACCACAGG + Intronic
1166846906 19:45733902-45733924 GAGTTCTGATCTGGGATCTCGGG + Intronic
1166921243 19:46230484-46230506 CAGCCCGGACCTCGGATGACAGG + Exonic
1166924840 19:46260444-46260466 CAGCCCTGACCTCGGGTGACAGG - Intergenic
927497728 2:23562139-23562161 GAGCCCGGACCTGTGGTGACAGG - Exonic
927509177 2:23633892-23633914 GAGACCAGACCAGGGAACACGGG - Intronic
927640395 2:24841947-24841969 GAGCCCTGACCTGTGATTCTAGG - Intronic
928378984 2:30802139-30802161 GAGCCCTGGACTGGGAGCTCTGG + Intronic
928698700 2:33876867-33876889 GAGACATGCCCTGGCATCACTGG + Intergenic
928862214 2:35872764-35872786 CAGGGCTGACCTGGGAGCACAGG - Intergenic
930013523 2:46955733-46955755 GAGGCTTGCCCTGGGGTCACAGG + Intronic
930026117 2:47030105-47030127 GGTCCCTCATCTGGGATCACAGG - Intronic
930030476 2:47055580-47055602 GAGCCGTGACCTGGGATCATGGG - Intronic
936053459 2:109242702-109242724 GAGCCCTGGTCTGGGCTCAGAGG + Intronic
936055675 2:109260343-109260365 GCTCCCTGACCTCGGGTCACAGG - Intronic
936515238 2:113177158-113177180 GAGCACTGCCCTTGGAGCACTGG + Intronic
936896543 2:117434224-117434246 CAGCCCTGACCTGGGACCTCTGG + Intergenic
937246857 2:120499250-120499272 GTGCCCTGAGCTAGGAGCACTGG - Intergenic
937480736 2:122256153-122256175 GAACCCTGACCTTGGATTATTGG + Intergenic
942646282 2:178113717-178113739 GAGTCCTGATTTGAGATCACAGG - Intronic
943646010 2:190408440-190408462 GAGCCCTGTCCCCGGAGCACGGG - Exonic
947525727 2:230875667-230875689 GAGTCCGGACCTGGGAGGACAGG - Exonic
947766358 2:232640380-232640402 AAGCCCAGAGCTGGGAACACTGG - Intronic
948186843 2:236027822-236027844 TAGACCTGCCCTGTGATCACAGG + Intronic
948830762 2:240597275-240597297 GAGCCCTGGCTTGGGAACGCAGG + Intronic
948908958 2:240993588-240993610 GAGCCCTGGCCTGGGCTGTCGGG - Intergenic
1169195662 20:3680978-3681000 GAGCCCTATCCTGGGGTCAGGGG - Intronic
1169360779 20:4947067-4947089 GAGCCCAGACCTGGGAACTCTGG - Intronic
1170007956 20:11689260-11689282 GAGCCCTGACGTATGTTCACTGG - Intergenic
1171472281 20:25381779-25381801 AATCCCTCACCTGGGATTACAGG + Intronic
1172870003 20:38129967-38129989 GAGCCCTGACCTTGGCTGACTGG - Exonic
1173664795 20:44756067-44756089 CAGCCCTGACCTGGGACCCCAGG - Exonic
1174449102 20:50608996-50609018 TCTCCCTGACCTGGGACCACAGG + Intronic
1175298531 20:57926609-57926631 AAGCTCTGACTTGGGATCAAAGG + Intergenic
1175840511 20:62023796-62023818 GAGCCCGGCCCTGAGATTACTGG - Intronic
1176115616 20:63430739-63430761 GAGTCTTGCCCTGGCATCACAGG - Intronic
1179333662 21:40429607-40429629 CAGCCCTGAGCTGGGAGCCCAGG - Intronic
1180007658 21:45030371-45030393 GAGCCCCGGCCTGGACTCACAGG + Intergenic
1181098021 22:20519492-20519514 GTGGCCTGACCTCGGCTCACTGG + Intronic
1181168785 22:20996954-20996976 GAGCCCTGACCTTGGTGAACTGG - Exonic
1182310095 22:29398231-29398253 GAGGCCTGAACTGGGGTCAGTGG - Intronic
1182554995 22:31124430-31124452 GTGCCCAGACCTGGGATGTCAGG + Intronic
1182769951 22:32787578-32787600 GAGCCTTGATCTGGGATACCGGG + Intronic
1183420558 22:37709284-37709306 GAGCCTGGGCCTGGGATCCCTGG - Intronic
1183674439 22:39291720-39291742 GTGCCCTGAACTGGGCTCTCTGG - Intergenic
1185357458 22:50382472-50382494 TAGCCCAGGCCTGGGATTACAGG - Intronic
949946969 3:9197670-9197692 GATGCATGATCTGGGATCACAGG - Intronic
950494346 3:13324645-13324667 AGGCCCTCAGCTGGGATCACTGG - Intronic
951050601 3:18089100-18089122 GAGCCCACACCTGATATCACAGG - Intronic
951219371 3:20053263-20053285 GATCCCACACCTGGGATTACAGG - Intronic
954312786 3:49783296-49783318 CAGCCTTGGCCTGGGATTACAGG - Intronic
954418519 3:50406088-50406110 GCCCCCTGGTCTGGGATCACAGG + Intronic
961682393 3:128608021-128608043 CAGCCCTGGCCTGGGAGCTCCGG - Intergenic
962902246 3:139771674-139771696 GAGCCAGGACCTGGGGACACAGG + Intergenic
963148953 3:142023882-142023904 CAGCCCTGACCTGGGCTCAAGGG + Intronic
963597617 3:147347544-147347566 GCCTCCTGACCTGGGATTACAGG - Intergenic
968594096 4:1473472-1473494 CAGCCCTGACCCAGGAGCACAGG + Intergenic
968813899 4:2812078-2812100 GAGCCCTGGCCTCTGACCACAGG + Intronic
970902618 4:21177078-21177100 GATCCCTGAACTAGGATGACAGG + Intronic
971597222 4:28546039-28546061 AACCAGTGACCTGGGATCACTGG + Intergenic
980679104 4:136132182-136132204 TAGTCCAGACCTGGGATCAAAGG - Intergenic
984961518 4:185102191-185102213 GACCCCTCACCTGGGAGCTCCGG + Intergenic
985392001 4:189499754-189499776 GGGGCCTGACCTGGGGTCCCTGG + Intergenic
985573062 5:660833-660855 CAGCCCTGAGCTGGCATCCCTGG + Exonic
986713982 5:10509260-10509282 GAGCCCTTCCCTGGGATTTCTGG + Intronic
987511112 5:18840443-18840465 AAGCCCTGACTTTTGATCACAGG + Intergenic
989424753 5:41283359-41283381 GTGGCCTCACCTGAGATCACAGG + Intergenic
990538965 5:56753183-56753205 GAGGTTTGACCTGGAATCACAGG + Intergenic
992644980 5:78803538-78803560 GAGCCCTGGCCTTGGTCCACTGG + Intronic
997580830 5:135015833-135015855 GAGCCCTTAGCTGGGATCAGGGG + Intergenic
999314840 5:150576662-150576684 GGGCCCTGGCCTTGGAGCACAGG - Intergenic
999399823 5:151256007-151256029 GAGCCCTGACCTTGAGTCCCTGG + Intronic
1001412996 5:171524015-171524037 GCGCCAGGAGCTGGGATCACAGG + Intergenic
1002471649 5:179439214-179439236 GTGCCCTGCCCTGGGATCCTGGG - Intergenic
1002715662 5:181225056-181225078 GAGACCTGATCTGGCATCACCGG - Intronic
1004560457 6:16744495-16744517 GAGCCCTGTCCTGGGAGCAGTGG - Intronic
1006805527 6:36786239-36786261 GAGCCTGGAGCTGGGCTCACGGG + Intronic
1010718605 6:79258178-79258200 GAGCACTGGCCAGAGATCACTGG + Intergenic
1011624581 6:89272691-89272713 GAGCCCTGACCAGGGAACACAGG + Intronic
1016978894 6:149836075-149836097 GAATCCTTACCTGGCATCACAGG + Exonic
1017055198 6:150430208-150430230 AAGCCCAGACCTGAGTTCACTGG - Intergenic
1018204084 6:161420631-161420653 GCGTCCTGAGCTGGGACCACAGG + Intronic
1018468974 6:164079934-164079956 GAGCCCTGATCTAAGATGACTGG - Intergenic
1019346263 7:532233-532255 TGGCCCTGACCTGGGAGCTCAGG + Intergenic
1022027750 7:26464710-26464732 AAGCCCTGACCAGGCATCTCTGG + Intergenic
1023873114 7:44273373-44273395 GAGTCCTGTCCTGGGGTTACGGG - Intronic
1025195258 7:56927570-56927592 GAGGCCTGACGTTGGATGACAGG - Intergenic
1025676694 7:63649373-63649395 GAGGCCTGACGTTGGATGACAGG + Intergenic
1032273452 7:130432677-130432699 CAGCCTTGACCTGGGCTCAAGGG - Intronic
1033556177 7:142490116-142490138 GGACCTTGACCTGGGAGCACAGG + Intergenic
1035717329 8:1764051-1764073 GGCCCCTCACCTGGGATCCCCGG - Intronic
1039193280 8:35001525-35001547 GAGCGCAGACCTGGGATCCAGGG - Intergenic
1045063566 8:98427317-98427339 AAGCGCTTACCTGGGAGCACGGG - Exonic
1047348727 8:124053300-124053322 GAGCCCTGAGCTGGGCACACTGG + Intronic
1048664028 8:136641108-136641130 GAGCCCTAACCTAGGATCATGGG - Intergenic
1049805521 8:144537099-144537121 GAGCACAGCCCTGGGTTCACAGG + Intronic
1050478491 9:6065138-6065160 GAGCACTCACCAGGGAGCACTGG + Intergenic
1051206246 9:14692814-14692836 GAGACCTGCACTGGGATCCCGGG - Intronic
1053062745 9:35044541-35044563 GAGCCCCTACCTGGGAACACAGG - Exonic
1057560323 9:96123077-96123099 GAGTCCTCCCCTGGGATCAGAGG + Intergenic
1058630479 9:106981401-106981423 AAGCTGTGACCTGGGAACACAGG - Intronic
1059281499 9:113137987-113138009 GAGCGCTGGCCTGGGATCAAGGG - Intergenic
1059832296 9:118110773-118110795 GAGCCATTACCTGGCAACACTGG + Intergenic
1061003117 9:127913792-127913814 TAGCCCTGCCCTGGGACTACAGG - Intronic
1061217044 9:129227514-129227536 GAGCCTAGACCTGGGAGCAGGGG + Intergenic
1061381440 9:130260987-130261009 GAGCCCTGTCCAGGGGACACTGG + Intergenic
1061412151 9:130427587-130427609 TCGCCCTGGCCTGGGATGACAGG + Exonic
1062683172 9:137795296-137795318 CAACCCTGACCTGGAATAACTGG - Intronic
1185990403 X:4889045-4889067 GAGCACTGACCTACGCTCACTGG + Intergenic
1187051708 X:15702747-15702769 GAGCCCTGACATTTGATCTCTGG + Intronic
1187104282 X:16223937-16223959 GAGCAATGACCTAGGATAACTGG - Intergenic
1187333372 X:18360979-18361001 GAGCACTGACAGGGGACCACTGG + Intergenic
1187801200 X:23065054-23065076 GAGCTCAAACCTGGGATTACAGG - Intergenic
1189338972 X:40189914-40189936 AAGTGCTGACCTGGGATCCCAGG - Intergenic
1197630478 X:128852562-128852584 GAGCCTTGGTCTGGGATCTCTGG - Intergenic
1197892646 X:131281604-131281626 GGGCACTGATCTGGGATCCCTGG + Intronic
1200117853 X:153776991-153777013 CGGCCCTGACCTGGGGCCACTGG + Intronic
1200919371 Y:8599493-8599515 CTGCCCTGTCCTGGGATCATGGG - Intergenic
1202128493 Y:21589302-21589324 CTGCCCTCTCCTGGGATCACGGG - Intergenic
1202176703 Y:22105035-22105057 CTGCCCTCTCCTGGGATCACGGG + Intergenic
1202214658 Y:22481349-22481371 CTGCCCTCTCCTGGGATCACGGG - Intergenic