ID: 1084677502

View in Genome Browser
Species Human (GRCh38)
Location 11:70644546-70644568
Sequence GCTGGTCCTGCCCTTGGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 217}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084677502_1084677515 22 Left 1084677502 11:70644546-70644568 CCCCGGCCAAGGGCAGGACCAGC 0: 1
1: 0
2: 1
3: 31
4: 217
Right 1084677515 11:70644591-70644613 CGCCTGCTGCAAATGCAAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 91
1084677502_1084677514 21 Left 1084677502 11:70644546-70644568 CCCCGGCCAAGGGCAGGACCAGC 0: 1
1: 0
2: 1
3: 31
4: 217
Right 1084677514 11:70644590-70644612 CCGCCTGCTGCAAATGCAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 91
1084677502_1084677517 25 Left 1084677502 11:70644546-70644568 CCCCGGCCAAGGGCAGGACCAGC 0: 1
1: 0
2: 1
3: 31
4: 217
Right 1084677517 11:70644594-70644616 CTGCTGCAAATGCAAGAGGGAGG 0: 1
1: 0
2: 1
3: 21
4: 203
1084677502_1084677506 -8 Left 1084677502 11:70644546-70644568 CCCCGGCCAAGGGCAGGACCAGC 0: 1
1: 0
2: 1
3: 31
4: 217
Right 1084677506 11:70644561-70644583 GGACCAGCAGCCCTCCCGCATGG 0: 1
1: 0
2: 1
3: 11
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084677502 Original CRISPR GCTGGTCCTGCCCTTGGCCG GGG (reversed) Intronic
900126490 1:1071102-1071124 GCTGGTCCTGCCATTGGGTGGGG - Exonic
900386168 1:2412100-2412122 GCTGGACCTGCCCTGAGCTGGGG + Intronic
900386573 1:2413462-2413484 GCTGGACCTGCCCTGAGCTGGGG + Intronic
900565747 1:3331116-3331138 GCTGCTCCTGCCCTTCGGCCTGG + Intronic
900805394 1:4764036-4764058 TCTTCTCCTGCCCTTGGCCTTGG + Intronic
901237677 1:7676217-7676239 GCAGGTTCTGGACTTGGCCGGGG + Intronic
901627621 1:10632820-10632842 GCTGGTTCTGCCTTGGGCAGGGG + Intergenic
901643532 1:10704951-10704973 GCCTGTCCTGGCCTCGGCCGTGG + Intronic
902038345 1:13473816-13473838 TCTTCTCCTGCCCTTGGCCTGGG + Intergenic
903764958 1:25728163-25728185 GCAGGTCCTGGCCTAGGCTGGGG - Intronic
903774879 1:25786562-25786584 CCTGGCTCTGCCCTTGGCTGGGG - Intergenic
904484324 1:30814838-30814860 GATGGTGCTGGCCATGGCCGGGG - Intergenic
904623776 1:31790847-31790869 GCTGGTCATGGCTTTGGCCGTGG - Exonic
905314144 1:37070354-37070376 GCTTCTCCTCCCCTGGGCCGTGG - Intergenic
905942260 1:41873427-41873449 GCTTGTCCTGGCCTTAGCTGAGG - Intronic
906153183 1:43599650-43599672 GATGGTCCTGCCCTTGAGCTTGG + Intronic
906535828 1:46550503-46550525 TCTGGTCCTGCCTTTGGCCTGGG + Intronic
908397565 1:63740341-63740363 TCTGGACCTGCCGTTGGCAGAGG - Intergenic
914432359 1:147630330-147630352 GCTGTTTCTGCCCTTGACCCTGG - Intronic
915981458 1:160422614-160422636 GCTGGTCCTGCTCTTAGGCCAGG + Intronic
916053361 1:161051322-161051344 CCTGGCCCTGGCCTTGGCCCTGG - Exonic
922025309 1:221743290-221743312 GCCGGTCCTGGCCTCGGCAGGGG - Intergenic
922418293 1:225441901-225441923 GCGTGTCCTGCTCTTGGCCTGGG + Intergenic
922738351 1:228001885-228001907 GCTGGACCTGCCCTGGGCAGGGG + Intergenic
1063161565 10:3422398-3422420 GCAGGTCTTGCCCTTGGAAGGGG + Intergenic
1066615960 10:37295263-37295285 GCTGGTGCTGCCCATGCCAGGGG + Intronic
1066745576 10:38602550-38602572 GCTCCTGCTGCCCTTGGCCTGGG + Intergenic
1067549131 10:47221155-47221177 GCAGGCCCTGCTCTTGGCTGGGG + Intergenic
1068391984 10:56409429-56409451 GCCGGTCATCCCCTTGGCTGGGG - Intergenic
1069908354 10:71745415-71745437 GAGAGTCCTGCCCTTGGCCTTGG - Intronic
1070667482 10:78355614-78355636 GCTGGCACTGCTCTTGGCTGTGG + Intergenic
1070810005 10:79292953-79292975 CCTGGCCCTGCCCTTGGTCCTGG - Intronic
1072150795 10:92681184-92681206 GCTTGTCCAGCCCATGGCCATGG - Intergenic
1072536174 10:96365187-96365209 GCTTGTCCAACCCTTGGCCCAGG - Exonic
1074363002 10:112837922-112837944 GCAGGTCAAACCCTTGGCCGAGG - Intergenic
1074383768 10:113001102-113001124 CCTCGCCCTGCCCTTGGCTGGGG + Intronic
1074828106 10:117229052-117229074 GTCGTTCCTGCCCCTGGCCGGGG - Intergenic
1074828561 10:117232181-117232203 GTCGTTCCTGCCCCTGGCCGGGG - Intergenic
1075092912 10:119453460-119453482 GCTGGCCCTGCCCTTCTCCCCGG - Intronic
1076032805 10:127173961-127173983 GCAGGTCCTGCCCTGGGCTCTGG - Intronic
1076674266 10:132140198-132140220 CCTGGCCCTGCCCTTGGTGGTGG - Intronic
1076783852 10:132739349-132739371 GCTGGGCCTGAGCTTGGCAGAGG - Intronic
1077045135 11:541337-541359 GCTTGTGCTGCACTTGGCTGGGG - Intronic
1077168974 11:1158020-1158042 GCTGGCCCTGCTCTGGGCCCTGG + Exonic
1078729544 11:13962958-13962980 CCTGGCGCTGCCCCTGGCCGCGG + Exonic
1080456752 11:32426350-32426372 GCTGCTCCTGCCCATTGCCAGGG - Intronic
1082005440 11:47416354-47416376 CCTGGCCCTGCCCTTCACCGTGG + Exonic
1083399048 11:62411405-62411427 GCTGGTTCTGCCAGTGGCCTTGG + Intronic
1084275620 11:68049683-68049705 GGTGGTCCTGGCCTTGGCCATGG + Exonic
1084483753 11:69436440-69436462 TCTGGCCCTGCCCTTAGCTGTGG - Intergenic
1084677502 11:70644546-70644568 GCTGGTCCTGCCCTTGGCCGGGG - Intronic
1088181895 11:107121934-107121956 TCTAGACCTGCCCTGGGCCGGGG + Intergenic
1091124264 11:133082134-133082156 GCTTGTCCTGCCCTTGGCCTGGG - Intronic
1101031655 12:100666821-100666843 GCAGTTCCTGCCTTTGGCCCTGG + Intergenic
1102457569 12:113080177-113080199 ACTGGGCCTGCCCTAGGCTGAGG - Intronic
1102865506 12:116370949-116370971 ACTTGTCCTGCCCGTGCCCGAGG + Intergenic
1105653165 13:22402890-22402912 CCTGGTTCTTCCCTTGGCAGAGG + Intergenic
1107133232 13:36919200-36919222 CCTCCTCCTGCCCTTGACCGTGG - Intronic
1112319742 13:98395461-98395483 GCTGGACCTGTGCTTGGCTGCGG - Exonic
1113400620 13:109989323-109989345 GGTGGTCCTAGCCATGGCCGAGG - Intergenic
1113507263 13:110825835-110825857 ACTGGACCTGCACTTGACCGTGG - Intergenic
1114455889 14:22853293-22853315 GCTGGTAGTGCCCGTGGCCCTGG - Intergenic
1114614822 14:24062756-24062778 ACAGATCCTGCCCTTGGCCTGGG - Exonic
1114968949 14:28001767-28001789 TCTGGACCTGCCCTGGGCAGAGG + Intergenic
1118363687 14:65076566-65076588 GATGGTGCTGCCCTTGGCGTTGG + Exonic
1119231698 14:72985001-72985023 CCTGGCCCTGCCCTTGCCCTAGG + Intronic
1119740678 14:77012034-77012056 GCTGTTCCTCCCCTAGGCCTGGG + Intergenic
1121432312 14:93896267-93896289 GCTGCTCCTGCCCCAGGCCATGG - Intergenic
1122316670 14:100829396-100829418 GCTGGCCAAGCCCTTGGCCCAGG - Intergenic
1122613437 14:103001154-103001176 GCTGGGGCTGCCCTTGGCGGTGG - Intronic
1123044965 14:105507470-105507492 TGTGGTCCTTCCCTTGGTCGGGG + Intergenic
1123078288 14:105680150-105680172 CCTGGCCCTGCCCCTGGCCCTGG + Intergenic
1124177390 15:27439112-27439134 GCTGGTTCTGACCTTGGAGGAGG - Intronic
1125532367 15:40421981-40422003 TCTGGACCTGCCCTAGGCTGGGG - Intronic
1128090555 15:64916087-64916109 CCTGGTCCTGACCTTGGGTGGGG - Intronic
1129376908 15:75139221-75139243 GCTAGTACTGCCCTTAGCTGTGG - Intergenic
1130046988 15:80453275-80453297 ACAGGTCCTGCCCTTGCCCCTGG - Intronic
1131015212 15:89052206-89052228 GCTGGACCTGCCCTAGGTCAAGG + Intergenic
1131215196 15:90530236-90530258 GCGGGTCCCGCCCGCGGCCGTGG - Intronic
1132347268 15:101115911-101115933 GCTGGCCCGGCCCTGGGCCCCGG - Intergenic
1132465875 16:77300-77322 GCTGGGGCTGCCATGGGCCGTGG + Intronic
1132608339 16:802748-802770 CCTCCTCCTGCCCTTGGCCTTGG - Intergenic
1135002689 16:18790195-18790217 GCTGGTCCCCACCTTGGCCGAGG - Intronic
1135564362 16:23500206-23500228 GCAGGGCCAGCCCTTGGCTGTGG - Intronic
1136281064 16:29211678-29211700 GCTGTGCCTGATCTTGGCCGGGG - Intergenic
1139335230 16:66226655-66226677 GCTGGCCCTGGCCCTGGCCCTGG + Intergenic
1141186933 16:81794540-81794562 CCTGGTCCTGCACTTGGTAGGGG + Intronic
1142085424 16:88177601-88177623 GCTGTGCCTGGTCTTGGCCGGGG - Intergenic
1142134393 16:88444938-88444960 GCTGGTCCTCCCCAAGGCCCGGG + Intergenic
1142432554 16:90037863-90037885 GCTGGCCCTGCAGTTGGCGGTGG + Intronic
1203124396 16_KI270728v1_random:1561699-1561721 CCTGGTCCTGGCCCTGGCCCTGG + Intergenic
1144260095 17:13510131-13510153 GAGGGGCCTGCCCTTGGCCCAGG - Intronic
1144366802 17:14552505-14552527 GCTGGTCCAGCCCTTGCCAGAGG - Intergenic
1144703532 17:17353313-17353335 GCTGGGGCTGCCCTAGGCGGTGG + Intergenic
1144829229 17:18122258-18122280 GCTGGTCCTGCCTCTGGCTTCGG + Exonic
1144829860 17:18125244-18125266 GCTGGCCCTGCCCTGGGCCTAGG + Intronic
1147551428 17:41445220-41445242 GCTGGTTCTGCCCTTTCCAGAGG - Intergenic
1148576091 17:48712339-48712361 GCTGGCCCTGCCCTGGCCCAAGG - Intergenic
1148907364 17:50919854-50919876 GCTGGTCCTGCCCGACGCCCGGG - Intergenic
1149010755 17:51854077-51854099 TCTGGTCCTACACTTGGCCACGG + Intronic
1149665888 17:58364566-58364588 GCTGCTCCTGGGCTTGGCCTGGG + Intronic
1151320471 17:73349528-73349550 GCTGCTCCTGCCCTTGGAAATGG + Intronic
1152283080 17:79396736-79396758 GCTGGTCCTGCCCACAGCCTGGG - Intronic
1152460327 17:80438991-80439013 GCTCATGCTGCCCTTGGCCCTGG - Intergenic
1152633976 17:81423017-81423039 GCTGGGACTGCCATGGGCCGGGG - Intronic
1152639459 17:81443617-81443639 GCTGGCCCTGCCCTGCGCCCCGG + Intronic
1152836535 17:82536636-82536658 GATGGGCTTGCCCTTGGCCTAGG + Intronic
1152867909 17:82735342-82735364 GCAGGTCCGGCCCTCGGCCCGGG - Intergenic
1152940805 17:83172214-83172236 GCTCTGCCTGCCCTTGGCCTGGG - Intergenic
1153248908 18:3100752-3100774 GCAGGTTCTGCCCTTGGCGGGGG - Intronic
1153451741 18:5238000-5238022 GCTAGGCCTGGCCTTGTCCGCGG + Intergenic
1155172892 18:23280287-23280309 TCTGCTCCTGCCCTGGGGCGAGG + Intronic
1155597305 18:27502727-27502749 TCTGGACCTGCCCTGGGCCAGGG + Intergenic
1160333655 18:78018063-78018085 GCTGGTCCTCCCCTGGGCGGAGG - Intergenic
1160765342 19:805159-805181 GCTGGACCAGACCATGGCCGCGG + Exonic
1161025303 19:2033994-2034016 GCCCGTCCTGGCCATGGCCGTGG + Intronic
1161250615 19:3278115-3278137 GTTGGAGCTGCCCTTGGCCGTGG + Intronic
1161396675 19:4048234-4048256 GCTTGTCCTGCCTGTGGACGGGG + Exonic
1161406529 19:4094360-4094382 GCTGGGCCTGGCCCTGCCCGGGG - Intronic
1161722850 19:5913341-5913363 GCAGGACCTGCCCTTGGAGGTGG + Intronic
1162700933 19:12514017-12514039 GCTGGGCCTGCTATTGGCTGCGG - Intronic
1163361071 19:16846774-16846796 ACGGGACCTGCCCATGGCCGGGG + Intronic
1165073937 19:33270430-33270452 CCTGGTCCTGCCCCTGCCCCTGG - Intergenic
1165169617 19:33882532-33882554 CCTGGTCCTGGCCTTGCCCTGGG + Intergenic
1165424805 19:35739911-35739933 GCTGGTCCTGCTCCTGACCTTGG - Exonic
1165645501 19:37432073-37432095 TCTGGACCTGCCCGTGGCTGGGG + Intronic
1166878887 19:45914745-45914767 GCTGCTCTTGCCCTTGCCCACGG - Exonic
1167002854 19:46756155-46756177 GCTGGACTTGACCTTCGCCGCGG + Exonic
1167169128 19:47819668-47819690 GCTGGTCCTGCACATGGCCCTGG - Intergenic
1167288871 19:48613914-48613936 GTTCGTCGTGCTCTTGGCCGGGG - Intronic
1167710373 19:51106871-51106893 GCTGGTCCTCCACATGGCTGGGG + Intronic
1168122472 19:54259570-54259592 TCTGGACCTGCCCTGGGCCTGGG - Intronic
1168513142 19:56989422-56989444 GCAGGTCAAGCCCTTGTCCGTGG + Intergenic
925609776 2:5693104-5693126 GCTGGCGCTGGGCTTGGCCGAGG - Exonic
926162602 2:10499405-10499427 GCTGGTCCTGCACTGTGCGGGGG + Intergenic
928272718 2:29871456-29871478 GCTGGTCCTTCACTTAGCAGTGG + Intronic
929127515 2:38535210-38535232 GCCGGTCCAGGCCTTGGCCAGGG + Intergenic
930701105 2:54457712-54457734 CCCGGGGCTGCCCTTGGCCGAGG + Intronic
933651379 2:84852806-84852828 TCTGGTCTTGCCATTGGCCCAGG - Intronic
934526686 2:95056423-95056445 GCAGGGCCTGGCCGTGGCCGTGG - Intergenic
935264318 2:101381729-101381751 GATGCTCTTGCCCTTGGCCCCGG + Intronic
935951660 2:108335290-108335312 ACTAGTCCTGGCCTTGGCCCTGG + Intergenic
936008343 2:108909348-108909370 CCAGGTCCTGCCCTTGGTCCTGG + Intronic
936940321 2:117878078-117878100 TCTGGACCTGCCCATGGCCTAGG - Intergenic
937448148 2:121975856-121975878 AATGGCCCTGCCCTAGGCCGGGG - Intergenic
938266872 2:129934191-129934213 GCTGGCCCTGCTCTGTGCCGTGG - Intergenic
943624137 2:190180437-190180459 GCTGGCCCTGCCCCTGGTCTCGG - Intronic
944855001 2:203759301-203759323 TCTGGACCTGCCCTGGGCCAGGG - Intergenic
944933662 2:204545619-204545641 GCTGGTCCTGGCCCTGGCCCTGG - Intergenic
946310016 2:218878131-218878153 CCTGGCCCTGCCCTGGGCCCTGG - Intergenic
946863559 2:224022810-224022832 CCTGGTCCTGCCCTTGGCACAGG - Intronic
947542318 2:230987492-230987514 GCTGGCCCTGGCCCTGGCCCTGG - Intergenic
948795337 2:240399621-240399643 GCTGGTCCTGCCCTGAGGGGAGG + Intergenic
948975482 2:241461157-241461179 GCTGGTCTTTCCCTTGGCTTAGG + Intronic
1170801049 20:19590672-19590694 GCTGGACCTGACCTTGGCCTTGG - Intronic
1173866895 20:46317981-46318003 GCTGTGCCTGCCCTGGGCTGTGG + Intergenic
1174534958 20:51244237-51244259 GCTGATCCTGCCCCTGGCTGAGG - Intergenic
1174824174 20:53754510-53754532 GCAGCTCCTGCCCTGGGCTGTGG - Intergenic
1175515119 20:59564473-59564495 GCTGGCTCTGCCCTTGGCCTGGG - Intergenic
1175980630 20:62736818-62736840 CCTGGTCCTGCCCTTGACACGGG - Intronic
1176148193 20:63574616-63574638 GCAGGACCTGCCCGTGGCCCTGG + Intergenic
1180739751 22:18044930-18044952 GCTGGCCCTGGCCCTGGCCTTGG - Intergenic
1182624815 22:31638120-31638142 GCTGTGCCTGCCCTTGGCTGTGG + Intronic
1183309945 22:37103918-37103940 GCTGGCACTGCGCTGGGCCGGGG + Intronic
1183617471 22:38954378-38954400 GCTGCACCTGCCCTTGGACAGGG - Intronic
1184179091 22:42807295-42807317 GCAGGACCTGGCCTTGGCAGTGG - Intronic
1184439056 22:44497793-44497815 GCTGGACCTGCTCTGGGCCCTGG + Exonic
1184454205 22:44599793-44599815 GCTTGGCCTGCCCTTGGCTGGGG + Intergenic
1184484081 22:44765671-44765693 GCTGCTCCTGTCCTTGGCCCGGG - Intronic
1184580328 22:45412956-45412978 ACTGCTCTTGCCCTTGGCCCTGG - Intronic
1184687610 22:46103722-46103744 GCTGGTGCTGAGCTTGGCTGGGG + Intronic
1184913606 22:47552054-47552076 TCTCTTCCTGCCCTTGGCTGGGG - Intergenic
949906240 3:8861042-8861064 TCTTTTCCTGCCCTTGGCCTGGG + Intronic
950045604 3:9947081-9947103 GCTCGCCCTGGCGTTGGCCGCGG - Exonic
950525165 3:13519011-13519033 GCTGGTCCTTCCCTTCCCCGAGG + Intergenic
950806390 3:15606836-15606858 GCTTGTCCAACCCTTGGCCCAGG + Intronic
954436134 3:50497338-50497360 GCTGGGCTTGCCCTTGACAGAGG + Intronic
961429737 3:126872817-126872839 GCTGCTCCTTCCCTGGGCTGTGG + Intronic
962973390 3:140425361-140425383 TCTGGTCCTGCCCATGGAAGGGG - Intronic
964871718 3:161319899-161319921 TCTGGACCTGCCCTGGGCAGAGG + Intergenic
967762495 3:193241340-193241362 GCTGGTGCTGGCGTTGGCCCTGG + Exonic
968700958 4:2058312-2058334 GCTGGGCCTGCCCGTGGACGTGG - Intergenic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
969078370 4:4598867-4598889 TCTGCACCTGCCCTTGGCCTTGG - Intergenic
969209320 4:5674546-5674568 GCTAGTTGTGCCCTTGGCTGGGG - Intronic
969369184 4:6720467-6720489 GCTGGTCCAGCCCCTGTCCTCGG + Intergenic
970351670 4:15207567-15207589 CCTGGTCCTGCCCTTGACGTGGG - Intergenic
984314211 4:178105392-178105414 CCTGGTACTGCCCTTGACCCAGG + Intergenic
985033095 4:185811848-185811870 GCTGGTCCTGTGCGTGGCTGTGG - Intronic
986209862 5:5661761-5661783 CTGGGTCCTGCCATTGGCCGGGG - Intergenic
986813677 5:11385218-11385240 GCTGGTCGTGCCCTGTGCCCGGG + Exonic
988294069 5:29331938-29331960 GCTTTTCCTGCCCTTGGCCATGG - Intergenic
990441013 5:55845504-55845526 TCTGGTCCTGCCCTTGACGTGGG - Intergenic
995900052 5:117054986-117055008 ACTGGTCCTCCACTTGGCCATGG - Intergenic
997359479 5:133285583-133285605 GCAGGACATGCCCTTGGCCTTGG - Intronic
997402233 5:133612084-133612106 TCGAGTCCTGGCCTTGGCCGGGG + Intronic
997733865 5:136199464-136199486 GCTGGTCCTGCCCTCAGCCATGG - Intergenic
998153672 5:139771897-139771919 GCAGGCCCTGCCCTTGGAAGGGG - Intergenic
1000339003 5:160262611-160262633 GCTGGTCATGCACTTGCTCGTGG + Intronic
1001332559 5:170772597-170772619 GCAGGTCCTGCCCTGTGCCATGG - Intronic
1001760591 5:174204913-174204935 TCTGCTCATGCCCTTGGCAGGGG + Intronic
1002321769 5:178380729-178380751 GCTGGTCCCGACATTGGCCCCGG - Intronic
1002439751 5:179258177-179258199 GCTGGGACTGCCCATGGCTGTGG + Intronic
1003638533 6:7857021-7857043 GCACCTCCTGCCCTTGTCCGAGG + Intronic
1004479567 6:16005876-16005898 GATGGTCCTGCTCTTGCCCATGG - Intergenic
1007337342 6:41163092-41163114 TCTGCTTCTGCCCTTGGCTGGGG - Exonic
1007727307 6:43924261-43924283 GCTGGTTCTGCCACTGGCTGAGG + Intergenic
1007775769 6:44223638-44223660 GCAGGTGCTGCCCGGGGCCGGGG + Exonic
1009971500 6:70629657-70629679 CCTGGTCCTGCCCTTGACAGAGG - Intergenic
1016590091 6:145735110-145735132 GCGGGGCCTGCCCGAGGCCGAGG + Intronic
1019176052 6:170160084-170160106 GCTGGTGCTGCCCGAGGCCCGGG - Intergenic
1019636031 7:2076175-2076197 GCTGGTTTTGCCCTGGGCCCGGG - Intronic
1021085995 7:16421375-16421397 GCTGCTCCCACCCTCGGCCGGGG + Intergenic
1023058671 7:36309652-36309674 GCTGCTCCTGCCCTGGGTAGAGG - Intergenic
1023862204 7:44223536-44223558 GCTGTTCCTGTCCTTGCCCCTGG + Intronic
1026864101 7:73811907-73811929 GCTGGGCCAGCCCACGGCCGCGG - Intronic
1026938933 7:74275514-74275536 GCTCGGCGTGCCCTTGGCCCTGG - Intergenic
1032128357 7:129210717-129210739 GCTGGCTCTGCCCTTGGCCCAGG - Intronic
1032550621 7:132780914-132780936 GCTGGTCCTGCCCATCTCCCTGG - Intergenic
1032833342 7:135651308-135651330 GGTGGTGCTGCCCTTGGCATTGG - Intergenic
1034778991 7:153859928-153859950 CCTGGTCCTGCCCTTGACACAGG + Intergenic
1035319554 7:158019957-158019979 TCAGGTCCAGCCATTGGCCGCGG + Intronic
1039379065 8:37067829-37067851 GCTTGTCCAGCCCTTGGTGGTGG - Intergenic
1041089370 8:54288048-54288070 CCTGGTCCTGCCCTCAGCAGGGG + Intergenic
1043134153 8:76500400-76500422 TCTGGACCTGCCCTGGGCTGTGG - Intergenic
1044118482 8:88364639-88364661 CCTGGCCCTGGCCTTGGCCCTGG - Intergenic
1048292612 8:133192088-133192110 GCAGGTCCTGCCCTGGGCTGTGG - Intronic
1048320927 8:133399718-133399740 GCTGGGCCTGCCTTGGGCTGGGG + Intergenic
1048324150 8:133426175-133426197 TCTTTTCCTGCCCTTGGCCTTGG + Intergenic
1049221849 8:141432085-141432107 GCTGGCCCCACCCTGGGCCGGGG + Exonic
1049600848 8:143506892-143506914 GGTGGCCGTGCCCTGGGCCGTGG + Intronic
1056622399 9:88225215-88225237 GCTGGTCCCTCCCTGGGCCCTGG - Intergenic
1056729575 9:89154068-89154090 GCTAGTCCAACCCTTGGCCATGG + Intronic
1059301420 9:113316769-113316791 GCAGTTCCAGCCCTTGGCTGTGG + Exonic
1059408363 9:114116418-114116440 CTTGGCCCTGCCCTGGGCCGTGG + Intergenic
1059486119 9:114628178-114628200 GCTGCTCGTGACCCTGGCCGCGG + Exonic
1060811374 9:126613072-126613094 ACTGCTCCTGCCCCTGCCCGGGG + Intergenic
1061578753 9:131523956-131523978 GCTGGGGCTGCCCATGGCAGCGG + Exonic
1061822039 9:133234366-133234388 GCTGGCCTTGCCCTTGGCATTGG - Intergenic
1062267676 9:135694874-135694896 GCTGGTCCTGTCCTGGGCTGTGG + Intronic
1062326302 9:136014147-136014169 GCTGGGGCTGGCCTTGGCCATGG - Intronic
1062350374 9:136135775-136135797 GCATTTCCTGCCGTTGGCCGGGG + Intergenic
1062460970 9:136662452-136662474 GCTGGTCCCTGCCTTGGCCTGGG + Intronic
1062461610 9:136664740-136664762 GCAGCTCCTGCCCCTGTCCGGGG + Exonic
1062713151 9:137987630-137987652 GCTGATCCTACCCTTGGTCAGGG + Intronic
1191916527 X:66207292-66207314 TCTGGTCCAGTCCTTGGCCGAGG - Exonic
1192180814 X:68914562-68914584 GCTGGTCCTGCCCCCAGCTGAGG - Intergenic
1193650382 X:84123735-84123757 CCTGGTCCTGCCCGGGGCCTGGG + Intronic
1199928690 X:152496037-152496059 CCTGGCCCTGCCCTTGACAGTGG + Intergenic
1201525993 Y:14935208-14935230 GCTGCTTCTGCCCTTGGCCTAGG - Intergenic