ID: 1084677956

View in Genome Browser
Species Human (GRCh38)
Location 11:70647699-70647721
Sequence CTCAGCAGTTAAGCTTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084677955_1084677956 19 Left 1084677955 11:70647657-70647679 CCGTGGCTGTTCGGAGTCTTATT 0: 1
1: 0
2: 2
3: 20
4: 265
Right 1084677956 11:70647699-70647721 CTCAGCAGTTAAGCTTTTGTTGG 0: 1
1: 0
2: 1
3: 10
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084677956 Original CRISPR CTCAGCAGTTAAGCTTTTGT TGG Intronic
906225686 1:44119282-44119304 CCCAGCAGTAGAGCTTGTGTTGG + Intronic
907458762 1:54592903-54592925 CTCAGCAGCCAGGTTTTTGTGGG + Intronic
907777342 1:57530932-57530954 CTGAGCAGAGAATCTTTTGTTGG + Intronic
915784551 1:158595822-158595844 CTTTGCAGTTCAGCTATTGTTGG - Intergenic
916886249 1:169071308-169071330 CTCAGGAATATAGCTTTTGTGGG - Intergenic
921682722 1:218053362-218053384 TTCAGCATTTCAGCTTTTCTTGG - Intergenic
921782132 1:219177297-219177319 GTAAGCATTTTAGCTTTTGTGGG + Intronic
924952489 1:248897749-248897771 CTTAGCTGGTAAGGTTTTGTGGG - Intergenic
1066043455 10:31576554-31576576 CAGAGAAGTCAAGCTTTTGTGGG + Intergenic
1068961412 10:62870188-62870210 CTCACCAGTGATGCTATTGTTGG - Intronic
1074650324 10:115515453-115515475 CTAAGTAGTTAAGCTTGTTTTGG + Intronic
1077766894 11:5167915-5167937 CTAAGCAGTTAAACTAATGTGGG + Intronic
1080616752 11:33951116-33951138 TTCAGCAGTGAAGTTATTGTAGG - Intergenic
1083139363 11:60709142-60709164 GTAAGCAGTTAAGGTTTTGCAGG + Intronic
1084047314 11:66576724-66576746 CTCAGCAGGGGAGCTTTTGCTGG - Intergenic
1084677956 11:70647699-70647721 CTCAGCAGTTAAGCTTTTGTTGG + Intronic
1084830736 11:71767230-71767252 CACAGCACTTAATCCTTTGTGGG - Intergenic
1085473578 11:76773687-76773709 TTCAGCAGGTAAACATTTGTTGG + Intergenic
1089302013 11:117504560-117504582 CTCACCAGTCAACCTTTTCTGGG - Intronic
1089326142 11:117658645-117658667 CTGAGATGTTAACCTTTTGTTGG - Intronic
1093372358 12:18379954-18379976 CTCGTGAGTTTAGCTTTTGTGGG - Intronic
1093396980 12:18694486-18694508 CTCCACAATTAGGCTTTTGTAGG - Intronic
1098519363 12:71418755-71418777 CTCTGCAGTTGACCTTTTATAGG + Intronic
1098685524 12:73415165-73415187 TTCATCAATTAAGCTATTGTTGG - Intergenic
1099109523 12:78540044-78540066 TTCAAAAGTAAAGCTTTTGTGGG + Intergenic
1101291592 12:103375942-103375964 CTCAGATTTTAAGCTTTGGTAGG - Intronic
1107405951 13:40113531-40113553 CTCAAGAGTCAACCTTTTGTAGG - Intergenic
1110172697 13:72521596-72521618 TACAGCAGTTAAACTTTTTTTGG - Intergenic
1111808524 13:93068592-93068614 CTCAGCGTTTAAGATTTAGTTGG - Intergenic
1114311967 14:21476229-21476251 ATAAGCAGTTATGCTTTCGTGGG + Intronic
1117950074 14:61074094-61074116 ATTAGCAGTTAAGTTTTGGTGGG + Intronic
1118124758 14:62889401-62889423 CTCTGCAATTGAGCTTTTTTTGG - Intronic
1120522942 14:85546006-85546028 CTCAGGCGGTAAGCTTTTATTGG + Intronic
1130007950 15:80119920-80119942 CTAAGCATTTAAACTTTTGCTGG - Intronic
1132215708 15:100060263-100060285 CTCAACAGTTAGACTTCTGTGGG + Intronic
1132385130 15:101394943-101394965 CTCAGAAGGTTAGCTTTTCTGGG - Intronic
1133446369 16:5864437-5864459 CTCAGGAGTAAACCTTTTGTCGG + Intergenic
1140299427 16:73741619-73741641 CTCAGTGGTCAAGCTTCTGTGGG - Intergenic
1149219321 17:54397939-54397961 CTCAGGCGTTCAGCTTTTCTGGG - Intergenic
1152980193 18:268988-269010 CTCAGTTGTTAAGATTTTGCTGG - Intergenic
1153386939 18:4509682-4509704 CTCAGTAGTTAAGATTTTCTAGG - Intergenic
1160360383 18:78270355-78270377 GTCAACAGTTAAGCTTTTTCTGG + Intergenic
1162873577 19:13603874-13603896 CCCAGCAGATACGCTTTTCTTGG - Intronic
1163413759 19:17172983-17173005 CTCGACAGTGACGCTTTTGTGGG - Intronic
1164510963 19:28896939-28896961 CTCAGCTGGGAAGCATTTGTTGG - Intergenic
1165253837 19:34560643-34560665 CTCAGGAGTTGAATTTTTGTGGG + Intergenic
1167550051 19:50154312-50154334 CTCAGCACTTTTGCCTTTGTGGG - Intronic
1168429414 19:56266196-56266218 CTCAGCAGTTAAGCTTAATTGGG - Intronic
924981023 2:221749-221771 GTCAGGAGTTGAGCTGTTGTTGG + Intronic
928424669 2:31168228-31168250 CTAAGCAGATAAGCTTCTGGAGG - Intergenic
940298550 2:152155375-152155397 CTCAGCAGTGAAGCTTTGGTTGG - Intronic
940983126 2:160024798-160024820 CTCAGCAGTTCAGGCTTTGTGGG - Intronic
942851595 2:180494342-180494364 CTCAGCAGCTAGTCTTATGTGGG + Intergenic
943626581 2:190208208-190208230 CTCAGCAGTTAAACATTGCTGGG - Intronic
948182426 2:235992851-235992873 CTTTGCAGTTGAGCTTGTGTTGG + Intronic
948403451 2:237701068-237701090 CTGAGCATTGAAGCTTTTCTGGG - Intronic
1174514904 20:51084059-51084081 CTCAGCAGTCAAGTTTCTGTGGG + Intergenic
1177433385 21:21019831-21019853 CTGATAAGTTTAGCTTTTGTGGG + Intronic
1179947978 21:44691748-44691770 TTCACCAGTAAAGCTGTTGTTGG - Intronic
1181383229 22:22523740-22523762 CATAGCAGTTAAGATATTGTTGG + Intergenic
1182046373 22:27277392-27277414 CTCAGAAGTCAGGCTTTTCTGGG + Intergenic
949215093 3:1557805-1557827 CTGAGCACTTCAGCTGTTGTGGG - Intergenic
951190037 3:19757415-19757437 CCCACCAGTCAAGCTTTTATTGG - Intergenic
951364421 3:21763335-21763357 CTCAGCATTTTATCTTTTCTAGG + Intronic
953926762 3:46986501-46986523 CTCAGCAGTTGAGCCTTTATGGG + Intronic
959538340 3:107512474-107512496 CTCAGCAATTAAGGTTTAGAAGG + Intergenic
960571212 3:119187142-119187164 CTCTGCTGTTAAGGTTTTTTGGG + Intronic
963316349 3:143762877-143762899 CTTAGAAGTTAAGCTTTTCATGG + Intronic
963970700 3:151426369-151426391 CTCAGTAGTGAGGCTTCTGTAGG + Intronic
967205102 3:187112407-187112429 CACAGCTGTCAAACTTTTGTTGG + Intergenic
970100594 4:12516840-12516862 CTCAGCAGTTATCCTTTATTTGG - Intergenic
971804176 4:31334007-31334029 CTCAGCAGTTGCGTTTTTCTTGG - Intergenic
972366736 4:38382883-38382905 CTCAGCAGCAATGCTTTTGGGGG - Intergenic
972769471 4:42183845-42183867 CTGAGCACTTTTGCTTTTGTGGG + Intergenic
975810340 4:78161799-78161821 TTCAGAAGTTAGGATTTTGTAGG - Intronic
978476007 4:109131153-109131175 CTCATCAGTAATGTTTTTGTTGG + Intronic
979738225 4:124116576-124116598 ATTAGCAGTTAAGTTTTTGTGGG + Intergenic
979745225 4:124205112-124205134 CACAGCATTTAAGACTTTGTGGG + Intergenic
979795649 4:124843514-124843536 ATCAGCAGTTAAGCTGTATTTGG + Intergenic
980635344 4:135494760-135494782 CACAGCATTAAAGATTTTGTTGG - Intergenic
981399222 4:144293232-144293254 CATCTCAGTTAAGCTTTTGTTGG - Intergenic
981479125 4:145218575-145218597 CTAAGCAGCTAAACTTTTCTTGG + Intergenic
982065921 4:151654385-151654407 GTCAGCAGTTTAGAGTTTGTAGG + Intronic
982232961 4:153225772-153225794 CTCAGAAAGTGAGCTTTTGTTGG + Intronic
983531934 4:168819291-168819313 CTCTGCAGTTACATTTTTGTGGG - Intronic
983561778 4:169108845-169108867 CTCAGCCTCTAAGCTTTAGTAGG - Intronic
983588279 4:169379631-169379653 CTCAGCAGTGAAGCCATTTTAGG - Intergenic
983776005 4:171608710-171608732 CTCAGCATTCAGGCTTTTGAGGG + Intergenic
985371300 4:189288273-189288295 ATTAGCAGTTAAGCTTTTGGGGG - Intergenic
986166981 5:5282043-5282065 CTCACCCGTTGAGCCTTTGTTGG + Intronic
987423116 5:17744225-17744247 TTCAGGAGTCAAGCTTTTCTGGG + Intergenic
990104291 5:52237658-52237680 CTCAGTATTTAAGCTTAAGTTGG - Intergenic
990193641 5:53289309-53289331 CTCAGCGTTTCAGCTTTTGAAGG - Intergenic
990950360 5:61292775-61292797 CTCAGAAGAAAAACTTTTGTTGG - Intergenic
994012675 5:94924877-94924899 GTCAGCAATTAAGATTTTGGAGG + Intronic
994703352 5:103166290-103166312 CTCTGTAGTGAAGATTTTGTGGG - Intronic
997146694 5:131442249-131442271 TTCAGGAGATAAGCTGTTGTAGG - Intronic
1003451416 6:6237013-6237035 CTCAGTAGTTACGGTGTTGTGGG + Intronic
1007504397 6:42323740-42323762 CTAAGCAGGTAAGCATTGGTTGG + Intronic
1009053277 6:58304732-58304754 TTCAGCAGTTTAACTTTAGTCGG + Intergenic
1009237837 6:61145830-61145852 TTCAGCAGTTTAACTTTAGTCGG - Intergenic
1010176195 6:73030897-73030919 CTCAACAGTTGAGCTTTTCGGGG + Intronic
1013861910 6:114645901-114645923 CTCAGAACATAAGCTTTTCTAGG - Intergenic
1014866002 6:126531233-126531255 CTCAGCTGTTAAAATATTGTAGG + Intergenic
1015264487 6:131276894-131276916 GACATCAGTTAAGCTGTTGTTGG + Intronic
1021919072 7:25465559-25465581 CTCAGCAATCAAGTTTTTTTGGG + Intergenic
1023215126 7:37854090-37854112 ATTAGTAGTTAAGCTTTTGGTGG - Intronic
1023404347 7:39816057-39816079 CTCAACAGTTGTGCTTTTGGAGG + Intergenic
1023582467 7:41697434-41697456 CTCAGCACTTCAGCTTTTGGAGG + Intronic
1028491620 7:91418648-91418670 CTCAGCAGTGAGTCCTTTGTAGG - Intergenic
1030323728 7:108197223-108197245 CTAAGCAGTTAAGATATTGGTGG - Intronic
1033767796 7:144513722-144513744 TTCACCAGTTCAGCCTTTGTGGG - Intronic
1033867378 7:145708267-145708289 CTCAGAAATTAAGCTTCTGCAGG + Intergenic
1034924477 7:155110311-155110333 CTCACAAGGTAAGCTTTTGTAGG - Intergenic
1035598871 8:882950-882972 GTCAGAAGTTGAGTTTTTGTTGG + Intergenic
1036115667 8:5958220-5958242 CTCTGCAGTTTTTCTTTTGTGGG + Intergenic
1037205665 8:16316765-16316787 CTCTCCAGTAAATCTTTTGTTGG - Intronic
1038079427 8:24116993-24117015 CTCAGCAGTAAAGCTGTCCTTGG - Intergenic
1041020829 8:53636578-53636600 GTTAGCAATTAAGCTTTTGATGG - Intergenic
1041591898 8:59597029-59597051 ACAAGCAGTTAAGCTATTGTGGG + Intergenic
1042472806 8:69210552-69210574 CTTAGCAGTTAATATTTTATGGG + Intergenic
1042559332 8:70061204-70061226 CTCTGCAGGGATGCTTTTGTAGG - Intronic
1042705127 8:71658891-71658913 CTCAGTAGCAAGGCTTTTGTTGG - Intergenic
1046005736 8:108481049-108481071 CACAGTTGTTAATCTTTTGTTGG + Intronic
1047702813 8:127466654-127466676 CTCACCAGTTCATCTTTTGCTGG + Intergenic
1048073795 8:131046775-131046797 GTCACCACTTAGGCTTTTGTTGG + Intergenic
1054786728 9:69217387-69217409 CTCAAAAGTTTAGGTTTTGTTGG + Intronic
1056128419 9:83560631-83560653 CACACCAATTAAGCTGTTGTTGG + Intergenic
1056371292 9:85957110-85957132 ACCAGTAGTTAAGCTTTTGGGGG - Intronic
1056938271 9:90934582-90934604 CTCACCAGAAAAGATTTTGTGGG + Intergenic
1061928807 9:133821707-133821729 CTCAGCTGTGTTGCTTTTGTGGG + Intronic
1188072427 X:25733249-25733271 CACAGCAGTTTATCTTTTGGTGG - Intergenic
1192752936 X:74013304-74013326 CTCAGCTGTCTAGCTTTTTTTGG - Intergenic